Recombinant plasmid and preparation method thereof, protein composition, application, vaccine and combined vaccine

Abstract

The invention belongs to the field of biology, and discloses a recombinant plasmid, the recombinant plasmid comprises an expression vector and a target gene connected to the expression vector, and the target gene comprises an IFN gamma gene and a T alpha 1 gene; the nucleotide sequence of the IFN gamma gene is as shown in SEQ ID No. 1; the nucleotide sequence of the T alpha 1 gene is as shown in SEQ ID No. 2. The recombinant plasmid can significantly improve the level of an HI antibody after immunization, and the effect of the recombinant plasmid is more significant than that of a mixed preparation of a recombinant plasmid connected with an IFN gamma gene and a recombinant plasmid connected with a Talpha1 gene, which indicates that the selected specific IFN gamma gene and Talpha1 gene can generate obvious synergy after being cloned to a carrier at the same time; meanwhile, the invention further discloses a preparation method, a protein composition, application, a vaccine and a combined vaccine of the recombinant plasmid.

Description

Technical Field

[0001] The present invention belongs to the biological field, and specifically relates to a recombinant plasmid and a preparation method thereof, a protein composition, uses, a vaccine, and a combined vaccine. Background Art

[0002] As strong biological response modifiers, thymosin and interferon have played an increasingly important role in disease prevention and treatment in medical and veterinary clinics, attracting more and more attention, promoting the extensive development and application of thymosin and interferon preparations, and achieving gratifying results.

[0003] In the research of chicken interferon, since Sekellick et al. cloned the interferon gene of chicken embryo fibroblasts in 1994, the research of chicken IFN has entered the molecular level, and many scholars have conducted research afterwards. In 1995, Digby et al. used RT-PCR to obtain the chicken IFNγ gene, whose reading frame was 492 bases, and the mature protein was speculated to be 145 amino acids, with a molecular weight of 16.8KD. The homology with the amino acid sequence of horse and human was 35% and 32% respectively, while the homology with IFN-I type was only 15%. Liu Shengwang et al. (2000) cloned the chicken interferon gene from chicken spleen lymphocytes stimulated by mitogens, and the gene obtained was consistent with the chicken IFNγ reported by Digby et al. Wu Zhiguang et al. (2001) cloned the type II interferon gene from Huiyang bearded chickens and compared the homology with poultry and mammals. They found that the amino acid homology of IFNγ with poultry IFNγ and mammals IFNγ was 62.2% to 92.7% and 26.5% to 31.8%, respectively, and it can be defined as a new subtype of chicken type II interferon. Dai Jianhua (2003) amplified the Roman laying hen IFNγ gene. Compared with other reported IFNγ coding region sequences, the amino acid level homology reached 92.8% to 100%. Bao Ming et al. (2004) and Xie Kun et al. (2007) cloned the SPF chicken IFNγ gene. Wei Xuetao et al. (2008) cloned the common chicken IFNγ, which had a homology of 99.6% with the IFNγ sequence published in Genbank. Xu Genliang et al. (2008) cloned and prokaryotically expressed the Xiaoshan chicken IFNγ mature protein gene. The experimental sequencing results of Wu Shuhua et al. (2009) showed that the full length of the Hy-Line chicken IFNγ gene is 495bp, with a complete open reading frame, encoding 164 amino acids, and the homology with the IFNγ sequence published abroad is 100%. The above data further show that the IFNγ coding region is highly conserved in different breeds of chickens.

[0004] In recent years, scholars from various countries have extensively carried out research on the antiviral effects of poultry recombinant interferon. Chicken recombinant interferon has significant therapeutic effects on viral diseases such as Newcastle disease, infectious bursal disease, infectious bronchitis, Marek's disease, and avian influenza (Ma Liang, 1995). In addition, recombinant IFNγ has high anti-coccidial activity. Studies have found that IFNγ can inhibit the development of coccidia sporozoites in cells, promote the rapid recovery of chickens from coccidia infection, and reduce the weight loss caused by coccidiosis. It also has obvious immunomodulatory activity (Ye Xiuhua et al., 2005).

[0005] In the prior art, for viral infections such as avian influenza, most of them are prevented and treated in the form of basic vaccines combined with immunopotentiators. The immunopotentiators are usually selected as materials such as Chinese medicine extracts or polypeptides. For example, CN117815385A discloses an immunopotentiator with double-chain poly I-cysteinyl, muramyl dipeptide, imiquimod, levamisole hydrochloride, concanavalin and astragalus polysaccharide as active ingredients; CN117180301A discloses the use of Pseudostellaria heterophylla polysaccharide in the preparation of a live vaccine against Mycoplasma gallisepticum, etc.

[0006] The technical problem to be solved by the present invention is: how to significantly improve the immune enhancement ability of existing immune enhancers. Summary of the invention

[0007] In view of the deficiencies in the prior art, the object of the present invention is to provide a recombinant plasmid, which can significantly improve the HI antibody level after immunization, and the recombinant plasmid is more effective than a mixed preparation of a recombinant plasmid connected to the IFNγ gene and a recombinant plasmid connected to the Tα1 gene. This shows that the specific IFNγ gene and Tα1 gene selected by the present invention can produce obvious synergy after being cloned into a vector at the same time. The difference in the length of protein expression of the recombinant plasmid of the present invention, the recombinant plasmid connected to the IFNγ gene, and the recombinant plasmid connected to the Tα1 gene also proves that even if it is the same gene, the protein expressed is different, which is the fundamental reason for the difference in effect.

[0008] At the same time, the invention also discloses the preparation method, protein composition, use, vaccine and combined vaccine of the recombinant plasmid.

[0009] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0010] A recombinant plasmid, comprising an expression vector and a target gene connected to the expression vector, wherein the target gene comprises an IFNγ gene and a Tα1 gene;

[0011] The nucleotide sequence of the IFNγ gene is shown in SEQ ID No. 1;

[0012] The nucleotide sequence of the Tα1 gene is shown in SEQ ID No.2.

[0013] In the above-mentioned recombinant plasmid, the expression vector is a eukaryotic expression vector pIRES.

[0014] At the same time, the present invention also discloses a method for preparing the recombinant plasmid as described above, and the method is specifically as follows:

[0015] Primers Ts1 / Ts2 are used to add restriction sites to the Tα1 gene, and primers IF3 / IF4 are used to add restriction sites to the IFNγ gene; and the Tα1 gene and IFNγ gene with restriction sites are inserted into the expression vector.

[0016] The nucleotide sequence of primer Ts1 is shown in SEQ ID No. 5;

[0017] The nucleotide sequence of primer Ts2 is shown in SEQ ID No.6;

[0018] The nucleotide sequence of primer IF3 is shown in SEQ ID No.9;

[0019] The nucleotide sequence of primer IF4 is shown in SEQ ID No.10.

[0020] In the above preparation method, the expression vector is the eukaryotic expression vector pIRES; the IFNγ gene with added restriction sites is inserted into the multiple cloning site A region of the eukaryotic expression vector pIRES; the Tα1 gene with added restriction sites is inserted into the multiple cloning site B region of the eukaryotic expression vector pIRES.

[0021] Meanwhile, the present invention also discloses a protein composition, comprising a first target protein and a second target protein;

[0022] The amino acid sequence of the first target protein is shown in SEQ ID No.13;

[0023] The amino acid sequence of the second target protein is shown in SEQ ID No.14.

[0024] The above protein composition is obtained by prokaryotic expression using the above recombinant plasmid.

[0025] The invention also discloses the use of the recombinant plasmid in preparing vaccines.

[0026] The invention also discloses the use of the protein composition in preparing vaccines.

[0027] Finally, the present invention also discloses a vaccine comprising:

[0028] Recombinant plasmid as described above;

[0029] and / or,

[0030] A protein composition as described above.

[0031] and, a combination vaccine, including a basic vaccine and an immune booster;

[0032] The basic vaccine is a vaccine used to prevent and treat viral infection, using inactivated or attenuated viruses as antigens;

[0033] The immunopotentiator is the recombinant plasmid as described above; and / or the protein composition as described above.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The recombinant plasmid can significantly improve the HI antibody level after immunization, and the recombinant plasmid is more effective than a mixed preparation of a recombinant plasmid connected to an IFNγ gene and a recombinant plasmid connected to a Tα1 gene, which illustrates that the specific IFNγ gene and Tα1 gene selected by the present invention can produce obvious synergy after being cloned into a vector at the same time. The difference in the length of protein expression of the recombinant plasmid of the present invention, the recombinant plasmid connected to the IFNγ gene, and the recombinant plasmid connected to the Tα1 gene also proves that even if it is the same gene, the protein it expresses is different, which is the fundamental reason for the difference in effect.

[0036] The research of the present invention can further prove that chicken IFNγ and Tα1 have a strong immune promotion effect on avian influenza H5N1 vaccine and play a good immune protection effect; they have a synergistic effect, and the effect is best when expressed in the same expression system (IFNγ-pIRES-Tα1), and a certain dosage relationship is presented, and the immune effect is most ideal at a low dose (50μg / bird). This lays a foundation for the application of chicken IFNγ and Tα1 in animal husbandry production. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is the RT-PCR product of chicken IFNγ gene.

[0038] Figure 2 It is a schematic diagram of the structure of plasmid pMD19-T.

[0039] Figure 3 This is a schematic diagram of the construction of the recombinant plasmid pMD19-T-IFNγ.

[0040] Figure 4 This is the result of PCR identification of chicken IFNγ;

[0041] Figure 5 The enzyme digestion identification diagram of the recombinant plasmid;

[0042] Figure 6 The nucleotide sequence of chicken IFNγ and its deduced amino acid sequence are shown in FIG.

[0043] Figure 7 This is a diagram of systematic evolutionary relationship analysis based on the nucleotide sequence of the IFNγ gene;

[0044] Figure 8 This is a diagram of systematic evolutionary relationship analysis based on the amino acid sequence of IFNγ gene;

[0045] Fig. 9 is the agarose electrophoresis diagram of the PCR amplification product of Tα1 gene;

[0046] Fig.10 This is a test result diagram of the PCR product with the Tα1 gene fragment and restriction sites added;

[0047] Fig.11 This is the PCR identification result of the recombinant plasmid pcDNA6-Tα1;

[0048] Fig.12 is the SDS-PAGE test result of pcDNA6-Tα1 positive supernatant;

[0049] Fig.13 The figure is the result of agarose gel electrophoresis of PCR product of IFNγ gene with restriction sites added;

[0050] Fig.14 This is the PCR identification result of the recombinant plasmid pcDNA6-IFNγ;

[0051] Fig.15 The electrophoresis results of RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ are shown;

[0052] Fig.16A This is the result of SDS-PAGE detection of the supernatant of pcDNA6-IFNγ positive cells;

[0053] Fig. 16B This is the result of SDS-PAGE detection of IFNγ-pIRES-Tα1 positive cell supernatant;

[0054] Fig.17 This is the PCR identification result of the recombinant plasmid pMD19-T-Tα1;

[0055] Fig.18 This is the result of enzyme digestion identification of the recombinant plasmid pMD19-T-Tα1;

[0056] Fig.19 This is the double enzyme digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1;

[0057] Fig. 20 Schematic diagram of the structure of pIRES plasmid;

[0058] Fig.21 This is the result of PCR identification of the recombinant plasmid IFNγ-pIRES;

[0059] Fig. 22 This is the result of PCR identification of the recombinant plasmid IFNγ-pIRES-Tα1;

[0060] Fig.23 This is the double enzyme digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1;

[0061] Fig.24 Figure 2 is the product of RT-PCR in cells;

[0062] Fig.25 Schematic diagram of the construction of the recombinant plasmid IFNγ-pIRES-Tα1. DETAILED DESCRIPTION

[0063] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0064] Before describing each embodiment and comparative example, the sources of the relevant raw materials involved in the present invention are introduced:

[0065] The genetically engineered host strain E.coil DH5α was maintained by the Genetic Engineering Laboratory, College of Animal Science, South China Agricultural University, with the following genotypes: supE44, ΔlacU169(ф80, lacZΔM15, hsdR17, recA1, endA1, gyrA96, thi-1, relA1;

[0066] The pMD19-T vector plasmid system is a product of Dalian Bao Bioengineering Co., Ltd.;

[0067] pcDNA6 / His TM The eukaryotic expression plasmid was a product of Invitrogen;

[0068] Restriction enzymes EcoRI (15u / uL), XhoI (10u / uL), NheI (10u / uL), XbaI (10u / uL), SalI (10u / uL) and their corresponding buffers were products of Promega;

[0069] ExTaq enzyme, DNA Ligation Kit (Mighty Mix), and calf intestinal alkaline phosphatase (CAIP) were products of TaKaRa;

[0070] pUC18 / Msp I Marker and DNA Marker15000 molecular weight standards were provided by Guangzhou Dongsheng Biotechnology Co., Ltd.

[0071] pUC18 / Msp I: 501, 404, 353, 242, 149, 147, 110, 89, 67, 34bp.

[0072] DL15000: 15,000, 10,000, 7,500, 5,000, 2,500, 1,000, 250bp.

[0073] The endotoxin-free plasmid large-scale extraction kit is a product of TIANGEN Biological Co., Ltd.;

[0074] Acrylamide and N,N-methylenebisacrylamide were purchased from Huamei Bioengineering Company;

[0075] Tris, sodium dodecyl sulfate (SDS), and glycine (analytical grade) were purchased from Beijing Dingguo Biotechnology Co., Ltd.;

[0076] TEMED (N,N,N',N'-tetramethylethylenediamine) is a product of Promega;

[0077] Low molecular weight standard proteins (94,000, 66,200, 45,000, 35,000, 26,000, 20,000, 14,400) were purchased from Biotech Biotechnology Co., Ltd.;

[0078] Small peptide protein molecular weight standards (20,000, 15,000, 10,000, 6,000, 3,500, 2,500) were purchased from Jet Biotech Co., Ltd.;

[0079] Prestained SDS-PAGE standards, Mid Range (2-105 kDa) were from Hou-Bio;

[0080] Nitrocellulose membrane was purchased from Genentech;

[0081] NBT / BCIP is an AMRESCO product;

[0082] Coomassie brilliant blue G250 was purchased from Shanghai Shenggong Bioengineering Co., Ltd.;

[0083] Lipofectamine TM 2000, a liposome transfection kit, is a product of Invitrogen;

[0084] LB liquid medium: Tryptone 10g, Yeast Extract 5g, NaCl 10g, double distilled water to 1000mL, autoclave for 20min and store at 4℃;

[0085] LB solid medium: Add agar powder to LB liquid medium to a final concentration of 1.5% (w / v) 15g, sterilize under high pressure and cool to about 45℃, pour into a plate, and store at 4℃ after solidification;

[0086] Agar plate containing Amp (100 μg / mL): When the temperature of the sterilized LB solid medium drops to about 50°C, add Amp to a final concentration of 100 μg / mL, dispense into sterilized plates, and store at 4°C after solidification;

[0087] Amp stock solution: Prepare 100 mg / mL with triple distilled water, sterilize with 0.22 μm filter membrane, and store at -20°C after aliquoting;

[0088] DMEM medium, fetal bovine serum, and trypsin were purchased from GIBCO;

[0089] Basic culture medium: 0.37g NaHCO3, 0.25g glucose dissolved in 100ml DMEM medium, adjust pH to 6.8-7.0 with 1mol / l HCL, filter to sterilize with 0.22μm filter membrane, and store at 4℃;

[0090] Complete culture medium: a basic culture medium containing 10% fetal bovine serum, with penicillin, streptomycin and L-glutamine added to the final concentrations of 100 IU / mL, 100 ug / mL and 1 mmol / mL respectively;

[0091] Solution A (acrylamide stock solution): 30% (w / v) acrylamide, 0.8% (w / v) N,N-methylenebisacrylamide, prepared with triple distilled water, stored in a brown bottle at 4°C away from light;

[0092] Solution B (4× separation gel buffer): 1.5 mol / L Tris-HCl (pH 8.8), 0.4% SDS; stored at 4°C;

[0093] Solution C (4× stacking gel buffer): 0.5 mol / L Tris-HCl (pH 6.8), 0.4% SDS; stored at 4°C;

[0094] 1×SDS-PAGE electrophoresis buffer: 25mmol / L Tris-HCl, 250mmol / L glycine, 0.1% SDS, adjust the pH to 8.3, and store at room temperature;

[0095] 5× SDS-PAGE electrophoresis loading buffer: 60 mmol / L Tris-HCl (pH 6.8), 14.4 mmol / L DTT, 2% SDS, 0.1% bromophenol blue, 25% glycerol;

[0096] Coomassie Brilliant Blue staining solution: 0.25 g Coomassie Brilliant Blue was dissolved in 100 mL methanol / acetic acid solution and filtered through Whatmam No. 1 filter paper;

[0097] Decolorizing solution (methanol / acetic acid solution): 100 mL methanol, 100 mL glacial acetic acid, 800 mL double distilled water;

[0098] Transfer buffer: 25 mmol / L Tris, 192 mmol / L glycine, 20% (v / v) methanol, 0.037% (w / v) SDS, pH adjusted to 8.3 with HCl;

[0099] TBS buffer: 150 mmol / L NaCl, 10 mmol / L Tris-HCl (pH 7.5);

[0100] Blocking solution: 5% (w / v) skim milk powder, 0.5% Tween 20, prepared in TBS buffer;

[0101] 1% skim milk powder / TBS: TBS solution containing 1% skim milk powder is used for diluting antibodies (including primary antibodies and secondary antibodies);

[0102] Color development solution: Dissolve 6 mg of diaminobenzidine in 9 mL of 0.01 mol / L Tris-HCl (pH 7.6) buffer, add 1 mL of 0.3% cobalt chloride (CoCl2), and finally add 10 μL of 30% hydrogen peroxide (H2O2), mix well and use immediately;

[0103] The His Taq AP Western Reagents kit against 6×His was purchased from Beijing Biosun Biotechnology Co., Ltd.;

[0104] Chicken IFNγ ELISA kit was purchased from Shanghai Jingtian Biotechnology Co., Ltd.;

[0105] One-day-old white Leghorn SPF chickens were purchased from the SPF chicken farm of Guangdong Wens Food Group Co., Ltd.;

[0106] The virulent strain of avian influenza H5N1 was collected and preserved by the Laboratory of Animal Molecular Virology and Animal Viral Immunology, School of Life Sciences, Sun Yat-sen University;

[0107] Methyl tetrazolium salt (MTT), a product of Sigma, was purchased from Guangzhou Meijin Biological Co., Ltd.;

[0108] Lymphocyte separation fluid (polysucrose-diatrizoate separation fluid) is a product of Tianjin Haoyang Biological Products Co., Ltd.;

[0109] Fetal bovine serum (FBS) was purchased from GIBCOBRL;

[0110] ConA is a product of Sigma;

[0111] Sodium dodecyl sulfate (SDS) was purchased from Beijing Dingguo Biotechnology Co., Ltd.;

[0112] Procaine was purchased from the Pet Hospital of South China Agricultural University;

[0113] The avian influenza H5 subtype inactivated vaccine (RE-5) and standard antigens were provided by the Poultry Research Laboratory of the Production Technology Department of Guangdong Wens Group;

[0114] 10×PBS solution: 15.4g Na2HPO·12H2O, 2gKH2PO4, 80g NaCl, 2g KCl, add double distilled water to 1,000ml, sterilize by high pressure for 20min and store at room temperature. The working solution is 1×PBS, pH7.2;

[0115] Anticoagulant: 3.8 g trisodium citrate dissolved in 100 mL 1× PBS solution, filtered through a 0.22 μm filter membrane;

[0116] RPMI1640 culture medium: contains 2mmol / L glutamine, inactivated 10% fetal bovine serum, and 100 units of penicillin and streptomycin per ml;

[0117] Trypan blue staining solution: 0.2 g trypan blue was dissolved in 100 mL 1× PBS solution, filtered with filter paper, and stored at room temperature;

[0118] MTT solution: Prepare a 5 mg / mL solution with 1×PBS solution containing 0.05% glucose, filter with a 0.22 μm filter membrane to remove bacteria in the solution, and store at 4°C in the dark. During preparation and storage, it is best to wrap the container with aluminum foil and use it immediately after preparation;

[0119] Acidified SDS solution: SDS is dissolved in 0.01 mol / L hydrochloric acid solution to a final concentration of 100 g / L, prepared just before use;

[0120] ConA solution: Prepare to the optimal concentration with serum-free RPMI-1640, filter sterilize, and store at 4°C;

[0121] FITC-labeled rabbit anti-chicken CD3 + , CD4 + , CD8 + Monoclonal antibodies against surface marker proteins were purchased from Southern Biotech, USA.

[0122] Part I

[0123] 1. Origin, homology and evolutionary tree analysis of chicken IFNγ gene

[0124] The chicken IFNγ gene selected in the present invention comes from lymphocytes isolated from spleen tissue of Foshan Ma chicken;

[0125] The cDNA length of Foshan Ma chicken IFNγ gene is 495bp, encoding 164 amino acids, with a molecular weight of 16.8KD. The obtained gene sequence was compared with the IFNγ sequences of different chicken breeds and other species. It was found that the sequence had a nucleotide sequence homology of 93.5% to 100% with other chicken IFNγ genes of different breeds, and an amino acid homology of 87.3% to 99.4%; the nucleotide homology with the IFNγ sequence of other species was 28.5% to 95.6%, and the amino acid homology was 6.4% to 93.3%; among them, the homology with Japanese quail was the highest, and the homology with mammals was lower. This shows that the chicken IFNγ gene is very conservative and has a high species specificity.

[0126] The specific source is: using the designed specific primers C1 / C2 (sequence as follows), RT-PCR was used to amplify specific fragments from the total RNA extracted from the spleen tissue lymphocytes of Foshan Ma chickens stimulated with ConA for 12, 16, and 20 hours. The RT-PCR products were detected by electrophoresis on 1% agarose gel, and an electrophoresis band of about 500 bp was observed (see Figure 1 ), the size was consistent with the expected. No specific fragment was amplified in the total RNA of spleen tissue lymphocytes that were not stimulated by ConA, nor in the total RNA of peripheral blood and spleen tissue lymphocytes that were stimulated by ConA for 4 and 8 hours.

[0127] C1: 5'-CG GAATTC CCACCATGACTTGCCAGAC-3'(SEQ ID No.15)

[0128] C2: 5'-GC GTCGAC TTAGCAATTGCATCTCCTCTGA-3'(SEQ ID No.16)

[0129] Figure 1The markers are: M: DNA Marker DL2000; 1: RT-PCR product of unstimulated chicken spleen lymphocytes; 2, 3, 4, 5, 6 are RT-PCR products of spleen lymphocytes stimulated with ConA at 4, 8, 12, 16, 20 hours, respectively.

[0130] The RT-PCR product of chicken IFNγ gene was purified and inserted into the foreign gene insertion site of pMD19-T vector (see Figure 2 ) to obtain a recombinant plasmid carrying the IFNγ gene, named pMD19-T-IFNγ (see Figure 3 ).

[0131] The specific preparation method of the recombinant plasmid pMD19-T-IFNγ is as follows:

[0132] 1.1 RT-PCR amplification of IFNγ gene

[0133] The target gene (SEQ ID No. 1) was amplified by RT-PCR. The specific operation was referred to PrimeScript TM OneStep RT-PCR Kit Ver.2 instructions.

[0134] The RT-PCR reaction system is:

[0135]

[0136] The above reaction system was mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 50°C for 30 min, 94°C for 2 min, one cycle; 94°C for 30 s, 56°C for annealing for 40 s, and 72°C for 1 min, 30 cycles. The amplified product was detected by 1% agarose gel electrophoresis (containing 0.5 μg / mL EB).

[0137] Figure 6 The nucleotide sequence of chicken IFNγ and its deduced amino acid sequence (SEQ ID No. 13), the underlined parts in the figure are primers and two glycosylation sites.

[0138] 1..2 Recovery and purification of PCR products

[0139] Follow the instructions of the gel purification kit of Omega. After the PCR product is electrophoresed by 1% agarose gel, cut the agarose gel containing the target DNA fragment as small as possible, cut it into pieces according to the weight ratio of 1:3 (DNA fragment: Binding Buffer, weight-to-volume ratio), add Binding Buffer, and bathe at 65℃ until the gel is completely dissolved; add the above solution to the ion exchange column, centrifuge at 10,000rpm for 1min, and discard the filtrate; add 700μL of alcohol-containing eluent and elute twice at 10,000rpm, pour off the filtrate, and centrifuge again at 10,000rpm for 1min to get rid of the residual washing solution. Place the purification column in a new centrifuge tube, add an appropriate amount of preheated triple distilled water, place it at room temperature for 1min, centrifuge at 10,000rpm to elute the nucleic acid, and use 1% agarose electrophoresis to detect the recovery effect. The purified DNA is stored at -20℃ for use.

[0140] 1.3 Construction of pMD19-T-IFNγ recombinant plasmid

[0141] The PCR product was connected to the pMD19-T vector according to the instructions of the pMD9-T Vector kit. The connection reaction system was (10 μL in total):

[0142] Solution I 5μL

[0143] 4 μL of purified PCR product

[0144] pMD19-T Vector 1μL

[0145] After centrifugation and mixing, the mixture was ligated overnight at 4°C to obtain the ligation product recombinant plasmid pMD19-T-IFNγ, which was directly used for transformation.

[0146] The above recombinant plasmid was transformed into E.coli DH5α, spread on LA plates, and cultured overnight at 37°C. A single white colony of transformed E.coli DH5α was selected for culture. The cultured bacterial liquid was directly used as a template for PCR identification, and a fragment of about 500 bp was amplified (see Figure 4 ). The reported chicken IFNγ gene sequence was analyzed using Primer5.0 software and it was found that it contained an EcoR V restriction site. If the chicken IFNγ gene was cut with EcoR V, it would be cut into two fragments. Therefore, the plasmid extracted from the PCR positive colony was digested with EcoR I and Sal I for identification. After digestion, the recombinant plasmid produced two bands, one of which was the vector plasmid with a size of about 2,600 bp and the other was the inserted exogenous fragment with a size of about 500 bp (see Figure 5 The results showed that the full-length cDNA of chicken IFNγ gene had been successfully cloned into the vector plasmid pMD19-T.

[0147] Figure 4 The meanings of the symbols in the figure are as follows: M: DNA Marker DL2000; 0: negative control; 1, 2, 4, 5, 6, 7, 8: positive clones of pMD19-T-IFNγ, with the amplified product size of 513 bp; 3: transformant without IFNγ gene inserted.

[0148] Figure 5 The meanings of the symbols in the figure are as follows: M1: DL2000 plus; M2: DNA Marker DL2000; 1: double restriction enzyme digestion product of pMD19-T-IFNγ plasmid; 2: PCR product of IFNγ, with a size of 513 bp.

[0149] The recombinant plasmid pMD19-T-IFNγ identified by PCR and enzyme digestion was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequence determination. A 513 bp gene fragment was obtained through sequence determination, which contained a complete open reading frame of 495 bp, encoding a precursor protein of 164 amino acids, a signal peptide formed by the N-terminal 19 amino acid residues, a mature protein of 145 amino acids, a molecular weight of about 16.8 kD, two glycosylation sites and a stop codon (see Figure 6 ), Figure 6 In the figure, the primer and two glycosylation sites are underlined.

[0150] The measured full-length IFNγ gene sequence was compared with the IFNγ nucleotide sequences registered in GenBank using the NCBI BLAST program. The results showed that the IFNγ nucleotide sequence obtained in this experiment was 100% homologous to the original chicken IFNγ with sequence numbers AY501004, X99774 and U27465, and the top 9 sequences with higher homology were all original chicken IFNγ genes.

[0151] DNASTAR software was used to compare the DNA sequences obtained in this experiment with the IFNγ DNA sequences of other animals in GenBank and the sequences of other chicken breeds, namely AF424744 (Shiqi mixed chicken), AJ001263 (guinea fowl), AJ001289 (pheasant), AJ634956 (Indian broiler), AY163160 (Huiyang bearded chicken), AY501004 (white Leghorn chicken), AY705909 (Isa brown chicken), DQ470471 (Luoyang native chicken), NM205149 (jungle chicken), U27465 (Roman chicken), X99774 (avain), AJ000725 (turkey), AJ001678 (Japanese quail), AJ012254 (duck), AY524421 (goose), DQ479967 (pig), AB010386 (rabbit), AF126247 (dog), AF493993 (pig), BC119065 (rat), DQ410715 (sheep), EU000431 (giraffe), EU000433 (horse), X07902 (cattle), DQ630727 (giant panda), AY376145 (rhesus monkey), X13274 (human). By comparison, it can be seen that the IFNγ gene cloned by the present invention has a nucleotide sequence homology of 28.5% to 33.9% and 93.5% to 100% compared with the gene sequences of mammals (human, pig, cattle, sheep, etc.) and other strains of poultry. Comparing the homology of IFNγ nucleotide sequences between different species, the homology between chicken and Japanese quail IFNγ gene was the highest, at 95.8%, and the homology between chicken and cattle was the lowest, at 27.6%.

[0152] The DNA sequence was converted into the corresponding amino acid sequence for homology comparison. The results showed that the amino acid sequence homology of the IFNγ gene cloned in this experiment was 6.4% to 8.5% and 66.7% to 99.4% compared with the gene sequences of mammals (human, pig, cattle, sheep, etc.) and other strains of poultry. The IFNγ amino acid sequence homology between different species was compared. The chicken and Japanese quail IFNγ gene had the highest homology, which was 93.3%, while the chicken and sheep and giraffe, and the giant panda and duck and goose had the lowest homology, which was 5.5% each.

[0153] Phylogenetic tree from nucleotide sequences and deduced amino acid sequences ( Figure 7 , Figure 8 ) can be seen that chicken IFNγ is on the same branch as Japanese quail, pigeon, duck and goose, and the species on this branch all belong to birds, while cattle, sheep, giraffe, pig, dog, giant panda, rhesus monkey, human, rabbit, horse and mouse IFNγ are on another branch, and the species in this branch belong to mammals.

[0154] 2. Synthesis and identification of Tα1 sequences

[0155] 2.1 Synthesis of Tα1 sequence

[0156] The 28 amino acids of Tα1 (SEQ ID No. 14) were converted into the nucleotide sequence as follows:

[0157] 5′AGC GAC GCC GCC GTG GAC ACC AGC AGC GAG ATC ACC ACC AAG GAC CTG AAGGAG AAG AAG GAG GTG GTG GAG GAG GCC GAG AAC 3′(SEQ ID No. 2)

[0158] 3′TCG CTG CGG CGG CAC CTG TGG TCG TCG CTC TAG TGG TGG TTC CTG GAC TTCCTC TTC TTC CTC CAC CAC CTC CTC CGG CTC TTG 5′ (complementary sequence of SEQ ID No. 2)

[0159] Based on the above nucleotide sequence, two fragments T1 and T2 were designed to amplify the Tα1 gene. The fragment sequences are as follows:

[0160] T1: AGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCACCAAGGA CCTG (SEQ ID No. 11)

[0161] T2: GTTCTCGGCCTCCTCCACCACCACCTCCTTCTCCTTCAGGTCCTTGGT (SEQ ID No. 12)

[0162] 2. PCR amplification of 2Tα1 gene

[0163] The Tα1 gene fragment was amplified by PCR, with primers T1 and T2, and itself as the template. The PCR reaction system was 100 μL in total, and the composition was as follows:

[0164]

[0165] The above reaction systems were mixed and centrifuged respectively, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 94°C pre-denaturation for 3 min, one cycle; 94°C for 40 s, 56°C for 40 s, 72°C for 1 min, 30 cycles; 72°C post-extension for 20 min. PCR products were detected by 3% agarose gel electrophoresis.

[0166] refer to Fig. 9 , Fig. 9 is the agarose electrophoresis diagram of the PCR amplification product of Tα1 gene;

[0167] Fig. 9 In the figure, the meanings of the numbers are as follows: M: Marker pUC18 / MspI; 1, 2: PCR products of Tα1 gene fragment, with a size of 84 bp;

[0168] 2.3 Recovery and purification of PCR products

[0169] The gel purification kit of Omega was used as per its instruction.

[0170] 2.4 Construction of pMD19-T-Tα1 recombinant plasmid

[0171] Follow the instructions of the pMD9-T Vector kit. The ligation reaction system is (10 μL in total):

[0172] Solution I 5μL

[0173] 4 μL of PCR product of Tα1 gene

[0174] pMD19-T Vector 1μL

[0175] After centrifugation and mixing, the cells were ligated overnight at 4°C. The ligation product was used directly for transformation.

[0176] 2.5 Transformation of ligation products into DH5α competent cells

[0177] Take the ligation product in 2.4 and transform it into E.coil DH5α competent cells, the method is the same as 1.3. Pick a single colony from the above overnight culture plate, inoculate it in 3mL LB liquid culture medium containing Amp (100mg / L), shake and culture it at 37℃ overnight, directly use the bacterial liquid as a template for PCR reaction for identification, and set up a negative control at the same time.

[0178] 2.6 Enzyme digestion identification of recombinant plasmid

[0179] Transformants with positive PCR results were selected and cultured overnight at 37°C and 220 rpm, and plasmids were extracted using the EZNA Plasmid Minipreps Kit. The above recombinant plasmids were digested and identified, and the digestion reaction systems were as follows:

[0180] The enzyme digestion reaction system of the recombinant plasmid pMD19-T-Tα1 is:

[0181]

[0182] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 2 h.

[0183] After the Tα1 gene PCR product was purified, it was inserted into the exogenous gene insertion site of the pMD19-T vector to obtain a recombinant plasmid carrying the Tα1 gene, named pMD19-T-Tα1. The above recombinant plasmid was transformed into E.coli DH 5α, smeared on LA plates, and cultured overnight at 37°C. The white single colony of the transformed E.coli DH 5α was picked for culture, and the cultured bacterial liquid was directly used as a template for PCR identification, and a fragment of about 90 bp was amplified (see Fig.17 ). The plasmid was extracted from the PCR-positive bacterial solution and digested with EcoR V for identification. The recombinant plasmid produced two bands after digestion, one of which was the vector plasmid with a size of about 2,600 bp and the other was the inserted exogenous fragment with a size of about 90 bp (see Fig.18 The results showed that the Tα1 gene had been successfully cloned into the vector plasmid pMD19-T.

[0184] Fig.17 The PCR identification results of the recombinant plasmid pMD19-T-Tα1. The meanings of the numbers in the figure are as follows: M: MarkerpUC18 / MspI; 0: negative control; 1, 2, 3, 4, 5, 6, 7, 9: pMD19-T-Tα1 positive clones, product size is 84 bp; 8: transformant without Tα1 gene inserted

[0185] Fig.18 The results of enzyme digestion identification of the recombinant plasmid pMD19-T-Tα1. The meanings of the numbers in the figure are: M1: DNA Marker DL15000; M2: DNA Marker DL2000; 1: enzyme digestion product of the recombinant plasmid pMD19-T-Tα1; 2: PCR product of Tα1 gene.

[0186] Part 2

[0187] Construction and expression of recombinant eukaryotic expression plasmids of chicken IFNγ and TA1

[0188] 2.1 Synthesis and identification of recombinant plasmid pcDNA6-IFNγ

[0189] 2.1.1 Synthesis of recombinant plasmid primers

[0190] Primer5.0 software was used to generate the pcDNA6 / His TM The restriction sites on the vector were used to design primers IF1 / IF2 for the IFNγ gene and pcDNA6 / His TM Vector connection. The primer sequences are as follows:

[0191] IF1: TAT GAATTCTGATGACTTGCCAG (SEQ ID No. 7)

[0192] IF2: TAT CTCGAG CTTAGCAATTGCA (SEQ ID No. 8)

[0193] The primers were synthesized by Beijing Aoke Biotechnology Co., Ltd. The synthesized primers were diluted to 25 mM with triple distilled water.

[0194] The solution was stored at -20°C.

[0195] 2.1.2 PCR amplification of IFNγ gene with restriction site

[0196] Different restriction sites were added to the IFNγ gene using primers IF1 / IF2;

[0197] Dilute the pMD19-T-IFNγ recombinant plasmid in the first part 100 times and use it as a template for PCR reaction. The PCR reaction system is 100 μL in total, which is:

[0198]

[0199]

[0200] The above reaction systems were mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 94°C pre-denaturation for 3 min, one cycle; 94°C for 40 s, 56 / 62 / 53 / 57°C for 40 s, 72°C for 1 min, 30 cycles; 72°C post-extension for 20 min. PCR products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0201] refer to Fig.13 , Fig.13 The agarose gel electrophoresis results of the PCR products of the IFNγ gene with restriction sites added; the meanings of the numbers in the figure are: DNA Marker DL2000; 1, 2: PCR products with IF1 / IF2 as primers, the size is 516bp; 3, 4: PCR products with IF3 / IF4 as primers, the size is 513bp;

[0202] 2.1.3 Recovery and purification of PCR products

[0203] The gel purification kit of Omega was used as per its instruction.

[0204] 2.1.4 Enzyme digestion of PCR purified products and ligated vectors

[0205] 2.1.4.1 Reaction of PCR Purified Products and pcDNA6 / His Empty Plasmid

[0206] The restriction digestion reaction system of the PCR product amplified with primers IF1 / IF2 is as follows:

[0207]

[0208] The reaction system was centrifuged and mixed, and then digested at 37°C for 4 h.

[0209] The restriction enzyme digestion reaction system of pcDNA6 / His empty plasmid is as follows:

[0210]

[0211]

[0212] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 4 h.

[0213] 2.1.4.2 Recovery of enzyme digestion products

[0214] Prepare 1% agarose gel recovery gel, perform electrophoresis on the digested product, cut the agarose gel containing the target DNA fragment as small as possible, and recover it according to the instructions of the gel purification kit of Omega Company.

[0215] 2.4.1.3 Ligation of enzyme digestion products and vector

[0216] The ligation reaction system is (15 μL in total):

[0217] PCR digestion recovery product 6μL

[0218] Plasmid digestion recovery product 1.5μL

[0219] Ligation Mix 7.5μL

[0220] After centrifugation and mixing, the ligation was carried out overnight at 4°C. The ligation product was used directly for transformation.

[0221] 2.1.5 Transformation of ligation products into DH5α competent cells

[0222] Take the ligation product in 2.4.1.3 and transform it into E.coil DH5α competent cells. Take 50μL of the competent cells prepared above, add 5μL of the ligation product prepared in 1.2.4.1, mix well, ice bath for 30min, heat shock at 42℃ for 90s, then quickly ice bath for 2min, add 200μL of LB liquid culture medium without antibiotics, shake and culture at 37℃ in a shaker at 160rpm for 45min; spread the bacterial solution on a preheated LB plate containing Amp, and culture at 37℃ overnight.

[0223] 2.1.6 Screening and identification of positive colonies

[0224] Pick a single colony from the above overnight culture plate, inoculate it into 3mL LB liquid culture medium containing Amp (100mg / L), shake and culture it at 37℃ overnight, and directly use the bacterial liquid as a template for PCR reaction for identification, and set up a negative control at the same time. The reaction system is as follows:

[0225]

[0226]

[0227] The PCR reaction procedure was the same as in 2.1.2. The PCR product was detected by 1% agarose gel electrophoresis.

[0228] 2.1.7 Enzyme digestion and identification of recombinant plasmids

[0229] Transformants with positive PCR results were selected and cultured overnight at 37°C and 220 rpm, and plasmids were extracted using the EZNA Plasmid Minipreps Kit. The above recombinant plasmids were digested and identified, and the digestion reaction systems were as follows:

[0230]

[0231] After centrifugation and mixing, the enzyme digestion was carried out at 37°C for 2 h. The digestion products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0232] refer to Fig.14 , Fig.14 The PCR identification results of the recombinant plasmid pcDNA6-IFNγ. The meanings of the numbers in the figure are: M: DNA Marker DL2000; 1, 2, 5, 6, 7, 8, 9: positive clones of pcDNA6-IFNγ, with a PCR product size of about 500 bp; 0: negative control; 3, 4: transformants without the IFNγ gene inserted.

[0233] 2.1.8 Sequence determination of reading frames of positive clones

[0234] The bacterial liquid identified as positive by the above PCR and plasmid double enzyme digestion was sent to Shanghai Boshang Biotechnology Co., Ltd. for sequence determination.

[0235] 2.1.9 Large-scale extraction of recombinant eukaryotic plasmids

[0236] Refer to the TIANGEN endotoxin-free plasmid large-scale extraction kit to obtain the detoxified plasmid pcDNA6-IFNγ. The specific operation method is as follows:

[0237] (1) Inoculate the correctly sequenced positive bacterial solution into 400 mL of LB medium containing Amp and culture at 37°C with shaking overnight. For best results, use about 1 mL of positive bacterial solution as inoculum;

[0238] (2) Column equilibration step: Add 2.5 mL of equilibration solution BL to the adsorption column CP5 (the adsorption column is placed in a 50 mL collection tube), centrifuge at 10,000 rpm for 2 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube (the column treated with the equilibration solution should be used immediately);

[0239] (2) Aliquot the overnight culture into 100 mL centrifuge tubes and centrifuge at 10,000 rpm for 5 min at room temperature to collect the bacteria. Pour or aspirate the culture medium and discard it. Remove the supernatant as much as possible. To ensure that all the supernatant is aspirated, use a clean pipette tip to remove water droplets on the tube wall.

[0240] (3) Add 7 mL of P1 solution (with RNase A added) to the centrifuge tube containing the bacterial cell pellet and vortex or pipette to thoroughly suspend the bacterial cell pellet;

[0241] (4) Add 7 mL of P2 buffer to the resuspension and immediately gently invert the mixture 6 to 8 times to obtain a clear lysate. Let the lysate stand at room temperature for 5 min.

[0242] (5) Add 7 mL of solution P4 to the centrifuge tube and gently turn it upside down 6 to 8 times to mix thoroughly. A white flocculent precipitate will appear. Then leave it at room temperature for about 10 minutes. Centrifuge at 10,000 rpm for 5 to 10 minutes, pour all the solution into the filter CS, slowly push the push handle to filter, and collect the filtrate in a clean 50 mL centrifuge tube;

[0243] (6) Add 0.3 times the volume of isopropanol to the filtrate (adding too much isopropanol can easily lead to RNA contamination), mix by inverting, and transfer to the adsorption column CP5. Centrifuge at 10,000 rpm for 2 min at room temperature, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0244] (7) Add 10 mL of rinsing solution PW with anhydrous ethanol to the adsorption column, centrifuge at 10,000 rpm for 2 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; repeat the washing once;

[0245] (8) Add 3 mL of anhydrous ethanol to the adsorption column, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the waste liquid in the collection tube; put the adsorption column back into the collection tube, centrifuge at 10,000 rpm for 5 min, and then leave it at room temperature for several minutes to remove the residual rinse liquid in the adsorption column;

[0246] (9) Place the adsorption column CP5 in a clean 50 mL collection tube, add 1-2 mL of elution buffer TB to the middle of the adsorption film, let it stand at room temperature for 5 min, and centrifuge at 10,000 rpm for 2 min. Transfer all the eluate in the 50 mL centrifuge tube to a clean 1.5 mL centrifuge tube and store at -20°C.

[0247] (10) Take an appropriate sample and dilute it 20 to 50 times, and measure its absorbance at 260 nm and 280 nm. The plasmid concentration can be calculated according to the following formula:

[0248] [DNA concentration] = OD 260 ×50×(dilution factor)μg / ml

[0249] OD of purified plasmid DNA 260 With OD 280 The ratio is usually around 1.8 to 2.0, and can be directly used in cell transfection or even in vivo animal experiments.

[0250] 2.1.10 Liposome-mediated transfection of eukaryotic expression vector into COS-7 cells

[0251] 2.1.10.1 Recovery, culture and subculture of COS-7 cells

[0252] (1) Take out the IMDM complete culture medium containing calf serum and double antibody from the refrigerator and warm it to room temperature;

[0253] (2) Remove the COS-7 cell cryopreservation tube from liquid nitrogen and quickly place it in a 37°C water bath, shaking it to thaw it in about 1 minute;

[0254] (3) Centrifuge at 800 rpm for 5 min at room temperature, discard the supernatant, add IMDM complete culture medium to about 1.5 mL for rinsing, centrifuge for 5 min, discard the supernatant, add fresh culture medium to resuspend the cells, transfer to a culture flask, add culture medium to a total volume of about 4 mL, and culture at 37°C in a 5% CO2 incubator.

[0255] (4) When the cells reach the optimal growth state, continue to subculture in 6-well plates. When the cell plating density reaches 90% to 95%, they can be used for transfection experiments.

[0256] 2.1.10.2 Transfection of COS-7 cells with pcDNA6-IFNγ recombinant plasmid and pcDNA6 empty plasmid

[0257] The plasmid was transfected into COS-7 cells using the liposome method. The specific operation is as follows:

[0258] (1) 3×10 5~4×10 5 COS-7 cells were seeded at a density of / mL in a 6-well cell culture plate and cultured in a 5% CO2 incubator at 37°C with 2mL of culture medium containing fetal bovine serum until the cells reached 90% to 95% confluence;

[0259] (2) Prepare solution A: add 5 μg of detoxified plasmid pcDNA6-IFNγ to 100 μL of culture medium; solution B: add 5 μL of transfection reagent to 100 μL of culture medium and incubate for 5 min; gently mix solutions A and B and incubate at room temperature for 20 min;

[0260] (3) Rinse the cells in the 6-well plate twice with serum-free medium and then add 2 mL of serum-free medium;

[0261] (4) Add the mixture of the two solutions dropwise into the wells, shake the culture plate and gently mix. Incubate at 37°C in a 5% CO2 incubator for 12 h, replace with complete culture medium and continue culturing;

[0262] (5) 24 hours after cell transfection, the cell culture supernatant was harvested in a 5 mL sterile tube and centrifuged at 3,000 rpm for 5 min. The supernatant was transferred to a new centrifuge tube and concentrated with sucrose. The cells were subcultured, and the culture supernatant after subculture was collected and treated in the same way. The obtained cell supernatant was stored at -80°C for future use.

[0263] 2.1.11 RT-PCR detection of COS-7 cells transfected with recombinant plasmid

[0264] RT-PCR detection mainly includes two parts: extraction of total cell RNA and RT-PCR identification.

[0265] (1) Extraction of total cellular RNA

[0266] Collect the transfected cells in 2.1.10.2, freeze and thaw repeatedly several times, and extract total RNA using the TRIzol Reagent RNA kit. The specific steps are as follows: add 1 mL of Trizol to each well of the six-well plate (transfected and untransfected COS-7 cells), place on ice for 5 minutes, and blow with a pipette; aspirate the lysate in each well into a 1.5 mL EP tube, add 0.2 mL of chloroform / tube, shake vigorously for 15 seconds, incubate at 15℃~30℃ for 2~3 minutes, and centrifuge at 4℃12,000rpm for 15 minutes; after centrifugation, the liquid is divided into three layers (the upper layer is a colorless water layer for RNA, the middle layer is white for DNA, and the bottom layer is red for protein), and carefully aspirate the upper layer Transfer the colorless liquid to a new EP tube; add an equal volume of isopropanol (0.4-0.5ml), mix well, incubate at 15℃-30℃ for 10-30min, centrifuge at 12,000rpm for 15min at 4℃ (if after adding an equal volume of isopropanol, place it on a test tube rack and seal it with PE gloves, put it in a 4℃ refrigerator, and precipitate for 30min for better results); discard the supernatant, add 1mL of 75% ethanol to the precipitate, vortex oscillate for 30s, centrifuge at 7,500rpm for 5min at 4℃; carefully discard the supernatant, and let the precipitate in the tube stand in a clean bench with air blowing and dry for 3min-5min. It is best to use a gun tip to absorb the supernatant and remove as much as possible; add 20μL of DEPC water to dissolve, dispense 5μL / tube, and store in a -80℃ refrigerator.

[0267] (2) RT-PCR identification

[0268] The target gene was amplified by RT-PCR. The specific operation was referred to PrimeScript TM One Step RT-PCRKit Ver.2 instructions. RT-PCR reaction system is:

[0269]

[0270] The above reaction system was mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 50℃30min, 94℃ pre-denaturation for 2min, one cycle; 94℃30s, 56 / 62 / 53 / 57℃ annealing for 40s, 72℃ extension for 1min, 30 cycles. 5μL of the amplified product was detected by agarose gel electrophoresis.

[0271] refer to Fig.15 , Fig.15 The electrophoresis results of RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ, where M: DNA Marker DL2,000, 1, 2: RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ;

[0272] 2.1.12 SDS-PAGE detection of expression products

[0273] The concentrated cell supernatant was subjected to SDS-PAGE detection to determine the expression of the pcDNA6-IFNγ recombinant plasmid in COS-7 cells.

[0274] Protein SDS-polyacrylamide gel (PAGE) electrophoresis was performed according to the method in "Protein Electrophoresis Experimental Technique".

[0275] Prepare 4.5 mL of 16.5% separation gel according to the following ratio:

[0276]

[0277] Immediately after mixing, carefully inject the separation gel into the gap between the prepared glass plates, leaving enough space for the stacking gel, and add deionized water on the top layer to prevent the oxygen in the air from inhibiting the gel polymerization.

[0278] After the polymerization is completed, pour off the covering liquid, wash the upper part of the gel with deionized water several times, and use filter paper to absorb the residual liquid on the top of the gel as much as possible.

[0279] Prepare 2 mL of 4% stacking gel:

[0280]

[0281]

[0282] After the stacking gel is polymerized, rinse the comb hole with deionized water to remove unpolymerized acrylamide, put the cast gel into the electrophoresis tank, add 1× electrophoresis buffer, take 20μL of the concentrated supernatant in 1.2.11, add 5μL of 5× loading buffer, boil in a water bath for 10min, centrifuge at 10,000rpm for 2min, take 15μL of the supernatant, and perform electrophoresis. The initial voltage is 30V. After the dye enters the separation gel, increase the voltage to 80V, and continue electrophoresis until the dye reaches the bottom of the separation gel. Disconnect the power supply, remove the gel, soak it with at least 5 times the volume of Coomassie Brilliant Blue staining solution, and place it on a shaker and rotate slowly at room temperature for 3 to 4h; replace and recover the staining solution, and decolorize it with methanol / acetic acid solution until the background is colorless. The destained gel is stored using a gel imaging system.

[0283] 2.1.13 Western Blot Detection of Expression Products

[0284] The method was carried out according to the Protein Technology Manual.

[0285] The expression product was subjected to SDS-PAGE electrophoresis. Cut a nitrocellulose (NC) membrane and two filter papers of the same size as the SDS-PAGE gel, and immerse them in the transfer buffer together with the gel after electrophoresis. Soak for 15 minutes at room temperature, and install the transfer clip in the order of sponge pad-filter paper-gel-NC membrane-filter paper-sponge pad; connect the side of the transfer clip with the NC membrane to the positive electrode, and transfer at a voltage of 15V for 1.5 hours. After the transfer, the membrane was removed and blocked with 5% skim milk powder / TBS solution for 90 minutes; the blocking solution was discarded, and the membrane was washed three times with TBS solution, each for 10 minutes; TBS was discarded, and 8 mL of primary antibody diluted 1:200 in 1% skim milk powder / TBS was added, and the membrane was gently shaken for at least 1 hour; the primary antibody was discarded, and the membrane was washed twice with TBS, each for 10 minutes; TBS was discarded, and 8 mL of secondary antibody diluted 1:500 in 1% skim milk powder / TBS was added, and the membrane was gently shaken for at least 1 hour; the secondary antibody was discarded, and the membrane was washed with TBS for 30 minutes, for a total of three washes. TBS was discarded, NBT / BCIP substrate colorimetric solution was added for colorimetric development, and the nitrocellulose membrane was gently shaken, and the colorimetric reaction was terminated by washing the membrane with double distilled water after the color development reached a certain degree.

[0286] refer to Fig.16A , Fig.16A The results of SDS-PAGE detection of pcDNA6-IFNγ positive cell supernatant are shown in the figure. In the figure, protein bands appear at 21KD in the pcDNA6-IFNγ positive supernatant.

[0287] 2.2 Synthesis and identification of recombinant plasmid pcDNA6-Tα1

[0288] 2.2.1 Synthesis of recombinant plasmid primers

[0289] Using Primer5.0 software, the nucleotide sequence corresponding to the start codon was added before the Tα1 gene, and the nucleotide sequence corresponding to the stop codon was added after the Tα1 gene. Primers Ta1 / Ta2 were designed for Tα1 and pcDNA6 / His TM Vector connection. The primer sequences are as follows:

[0290] Primer Ta1: TAT GAATTC TGATGAGCGACGCCGCCGTGGAC(SEQ ID No.3)

[0291] Primer Ta2: TAT CTCGAG CGTTCTCGGCCTCCTCCACCACCAC(SEQ ID No.4)

[0292] The primers were synthesized by Beijing Aoke Biotechnology Co., Ltd. The synthesized primers were diluted with triple distilled water to a 25 mM solution and stored at -20°C.

[0293] 2.2.2 PCR amplification of Tα1 gene with restriction site

[0294] Primers Ta1 / Ta2 mainly add different restriction sites to the Tα1 gene, and the template is the PCR product in 2.2..1. The PCR reaction system is 100 μL in total, which are:

[0295]

[0296] The above reaction systems were mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 94°C pre-denaturation for 3 min, one cycle; 94°C for 40 s, 56 / 62 / 53 / 57°C for 40 s, 72°C for 1 min, 30 cycles; 72°C post-extension for 20 min. PCR products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0297] refer to Fig.10 , Fig.10 The detection results of the PCR product with restriction sites added to the Tα1 gene fragment. The meanings of the numbers in the figure are as follows: M: DNA marker 2000; 1, 2: PCR products amplified with Ta1 / Ta2 as primers, with a size of 105 bp; 3, 4: PCR products amplified with Ts1 / Ts2 as primers, with a size of 106 bp;

[0298] from Fig.10 It can be seen that two fragments were successfully cloned, with sizes of 105 bp and 106 bp respectively.

[0299] 2.2.3 Recovery and purification of PCR products

[0300] The gel purification kit of Omega was used as per its instruction.

[0301] 2.2.4 Enzyme digestion of PCR purified products

[0302] The enzyme digestion reaction system of the PCR product amplified with primers Ta1 / Ta2 is as follows:

[0303]

[0304] The reaction system was centrifuged and mixed, and then digested at 37°C for 4 h.

[0305] 2.2.5 Recovery of enzyme digestion products

[0306] Prepare 1% agarose gel recovery gel, perform electrophoresis on the digested product, cut the agarose gel containing the target DNA fragment as small as possible, and recover it according to the instructions of the gel purification kit of Omega Company.

[0307] 2.2.6 Ligation of enzyme digestion products and vector

[0308] The ligation reaction system is (15 μL in total):

[0309] PCR digestion recovery product 6μL

[0310] Plasmid digestion recovery product 1.5μL

[0311] Ligation Mix 7.5μL

[0312] Refer to Section 2.1.4.1 for plasmid digestion and recovery of products;

[0313] After centrifugation and mixing, the ligation was carried out overnight at 4°C. The ligation product was used directly for transformation.

[0314] 2.2.7 Transformation of DH5α competent cells with ligation products

[0315] The ligation product of Tα1 and the vector was transformed into E.coil DH5α competent cells.

[0316] 2.2.8 Screening and identification of positive colonies

[0317] Pick a single colony from the above overnight culture plate, inoculate it into 3mL LB liquid culture medium containing Amp (100mg / L), shake and culture it at 37℃ overnight, and directly use the bacterial liquid as a template for PCR reaction for identification, and set up a negative control at the same time. For pcDNA6-Tα1, use Ta1 and Ta2 as primers. The reaction system is as follows:

[0318]

[0319]

[0320] The PCR reaction procedure was the same as in 2.1.2. The PCR product was detected by 1% agarose gel electrophoresis.

[0321] 2.2.9 Enzyme digestion identification of recombinant plasmid

[0322] Transformants with positive PCR results were selected and cultured overnight at 37°C with shaking at 220 rpm. The plasmid was extracted using EZNA Plasmid Minipreps Kit to obtain the recombinant plasmid pcDNA6-Tα1.

[0323] The above recombinant plasmids were subjected to enzyme digestion identification, and the enzyme digestion reaction systems were as follows:

[0324]

[0325] After centrifugation and mixing, the enzyme digestion was carried out at 37°C for 2 h. The digestion products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0326] Test result reference Fig.11 , Fig.11 The PCR identification results of the recombinant plasmid pcDNA6-Tα1. The meanings of the numbers in the figure are: M: DNA Marker DL2000; 0: negative control; 1, 2, 3, 4, 6, 7, 8, 9: positive clones, with a PCR product size of 105 bp; 5: transformant without Tα1 gene inserted.

[0327] 2.2.10 Sequence determination of reading frames of positive clones

[0328] The bacterial liquid identified as positive by the above PCR and plasmid double enzyme digestion was sent to Shanghai Boshang Biotechnology Co., Ltd. for sequence determination.

[0329] 2.2.11 Large-scale extraction of recombinant eukaryotic plasmids

[0330] Follow the method in 2.1.9.

[0331] 2.2.12 Transfection of COS-7 cells with recombinant plasmid pcDNA6-Tα1

[0332] Follow the method in 2.1.10.2.

[0333] 2.2.13 RT-PCR detection of COS-7 cells transfected with recombinant plasmid

[0334] RT-PCR detection mainly includes two parts: extraction of total cell RNA and RT-PCR identification.

[0335] The method for extracting total cellular RNA was carried out according to 2.1.11.

[0336] The target gene was amplified by RT-PCR. The specific operation was referred to PrimeScript TM One Step RT-PCRKit Ver.2 instructions. RT-PCR reaction system is:

[0337]

[0338] The above reaction system was mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 50℃30min, 94℃ pre-denaturation for 2min, one cycle; 94℃30s, 56 / 62 / 53 / 57℃ annealing for 40s, 72℃ extension for 1min, 30 cycles. 5μL of the amplified product was detected by agarose gel electrophoresis.

[0339] refer to Fig.15 , Fig.15 The electrophoresis results of RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ, where M: DNA Marker DL2,000, 1, 2: RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ;

[0340] 2.2.14 SDS-PAGE and Western Blot Detection of Expression Products

[0341] Refer to the methods in 2.1.12 and 2.1.13 to detect the expression product.

[0342] refer to Fig.12 , Fig.12 The positive supernatant of pcDNA6-Tα1 showed a protein band at 8KD in SDS-PAGE detection.

[0343] 2.3 Synthesis and identification of recombinant plasmid IFNγ-pIRES-Tα1

[0344] The construction strategy of the recombinant plasmid IFNγ-pIRES-Tα1 can be found in Fig.25 ;

[0345] 2.3.1 Synthesis of recombinant plasmid primers

[0346] Using Primer5.0 software, according to the restriction sites on the pIRES vector, the nucleotide sequence corresponding to the start codon was added before the Tα1 gene, and the nucleotide sequence corresponding to the stop codon was added after the Tα1 gene. Ts1 / Ts2 was designed for the connection between Tα1 and the pIRES vector; primers IF3 / IF4 were designed for the connection between the IFNγ gene and the pIRES vector. The primer sequences are as follows:

[0347] Ts1: CCA TCTAGA GTATGAGCGACGCCGCCGTGGAC(SEQ ID No.5)

[0348] Ts2: CCG GTCGAC ACGTTCTCGGCCTCCTCCACCACCAC(SEQ ID No.6)

[0349] IF3: CCA GCTAGC ATGACTTGCCAG (SEQ ID No. 9)

[0350] IF4: CCG GAATTC TTAGCAATTGCA (SEQ ID No. 10)

[0351] The primers were synthesized by Beijing Aoke Biotechnology Co., Ltd. The synthesized primers were diluted with triple distilled water to a 25 mM solution and stored at -20°C.

[0352] 2.3.2 PCR amplification of Tα1 and IFNγ gene with restriction site

[0353] Use primers Ts1 / Ts2 to add restriction sites to the Tα1 gene, and primers IF3 / IF4 to add restriction sites to the IFNγ gene. Dilute the pMD19-T-IFNγ recombinant plasmid obtained above 100 times and use it as a template for PCR reaction. The PCR reaction system is 100 μL in total, which are:

[0354]

[0355] The above reaction systems were mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 94°C pre-denaturation for 3 min, one cycle; 94°C for 40 s, 56 / 62 / 53 / 57°C for 40 s, 72°C for 1 min, 30 cycles; 72°C post-extension for 20 min. PCR products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0356] 2.3.3 Recovery and purification of PCR products

[0357] The gel purification kit of Omega was used as per its instruction.

[0358] 2.3.4 Restriction reaction of PCR purified products and pIRES empty plasmid

[0359] The PCR product of chicken IFNγ amplified by IF3 / IF4 is inserted between the two restriction sites of Nhe I and EcoR I in the multi-cloning site A region (MCSA region) of the pIRES vector, so the restriction digestion reaction system is as follows:

[0360]

[0361] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 4 h.

[0362] The PCR product of Tα1 amplified with primers Ts1 / Ts2 is used to insert between the two restriction sites of Sal I and Xba I in the multi-cloning site B region (MCS B region) of the pIRES vector, so the restriction digestion reaction system is as follows:

[0363]

[0364] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 4 h.

[0365] The MCS A region of the pIRES empty plasmid was first double-digested, and the reaction system was as follows:

[0366]

[0367]

[0368] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 4.5h.

[0369] The recovery of the pIRES empty plasmid and IFNγ gene digestion products after MCS A region double digestion was performed according to the operation steps in 2.2.5. The ligation reaction system of the IFNγ gene digestion product and the MCS A region double digestion pIRES empty plasmid digestion product was (total 15 μL):

[0370] IFNγ gene PCR digestion recovery product 6μL

[0371] pIRES empty plasmid digestion product recovery 1.5 μL

[0372] Ligation Mix 7.5μL

[0373] After centrifugation and mixing, the cells were ligated at 4°C overnight.

[0374] After the MCS A region is double-digested, the pIRES empty plasmid is connected to the IFNγ gene to construct the recombinant plasmid IFNγ-pIRES, and then the MCS B region of the recombinant plasmid IFNγ-pIRES is double-digested to obtain the plasmid enzyme digestion recovery product. The system is as follows:

[0375]

[0376] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 4.5h.

[0377] The recovery of the MCS B region double digestion recovery product of the recombinant plasmid IFNγ-pIRES is carried out according to the operation steps in 2.2.5. The recovered MCS B region double digestion recombinant plasmid IFNγ-pIRES product and the Tα1 double digestion product are connected. The connection reaction system is (a total of 15 μL):

[0378] 6 μL of Tα1 PCR digestion product

[0379] Recombinant plasmid IFNγ-pIRES digestion recovery product 1.5μL

[0380] Ligation Mix 7.5μL

[0381] After centrifugation and mixing, the ligation was carried out overnight at 4°C. The ligation product was used directly for transformation.

[0382] 2.3.5 Transformation of ligation products into DH5α competent cells

[0383] Take the ligation product IFNγ-pIRES-Tα1 in 2.3.4 and transform it into E.coil DH5α competent cells.

[0384] 2.3.6 Screening and identification of positive colonies

[0385] Pick a single colony from the above overnight culture plate, inoculate it into 3mL LB liquid culture medium containing Amp (100mg / L), shake and culture it at 37℃ overnight, and directly use the bacterial liquid as a template for PCR reaction for identification, and set up a negative control at the same time. For IFNγ-pIRES, use primers IF3 and IF4; for IFNγ-pIRES-Tα1, use primers Ts1 and Ts2. The reaction system is as follows:

[0386]

[0387] The PCR reaction procedure was the same as in 2.1.2. The PCR product was detected by 1% agarose gel electrophoresis.

[0388] 2.3.7 Enzyme digestion identification of recombinant plasmid

[0389] Transformants with positive PCR results were selected and cultured overnight at 37°C and 220 r / m with shaking. The plasmid was extracted using the EZNA Plasmid Minipreps Kit. The above recombinant plasmids were digested and identified. The digestion reaction systems were as follows:

[0390] Recombinant plasmid IFNγ-pIRES restriction enzyme digestion reaction system:

[0391]

[0392]

[0393] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 2 h.

[0394] Recombinant plasmid IFNγ-pIRES-Tα1 restriction enzyme digestion reaction system:

[0395]

[0396] After centrifugation and mixing, enzyme digestion was carried out at 37°C for 2 h.

[0397] The above enzyme digestion products were detected by 3% and 1% agarose gel electrophoresis, respectively.

[0398] Fig.19The double enzyme digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1; the meanings of the numbers in the figure are: M1: DNA Marker DL15,000; M2: DNA Marker DL2,000; 1, 4: digestion products of the recombinant plasmids pcDNA6-IFNγ and pcDNA6-Tα1; 2, 3: PCR products of IFNγ and Tα1 genes;

[0399] pIRES vector is a eukaryotic expression vector that can be used to express two gene fragments at the same time. Fig. 20 As shown in Figure 1, an internal ribosome entry site (IRES) was inserted between its two multiple cloning sites (MCS) region A and region B, and two open reading frames can be translated simultaneously through the same messenger RNA. According to the characteristics of the pIRES vector, we used IF3 / IF4 as primers and pGEM-T-IFNγ as a template to PCR amplify a fragment of 513bp in size; after double restriction digestion, the fragment was connected with the pIRES empty plasmid digested with the same enzyme to obtain the recombinant plasmid IFNγ-pIRES. After the ligation product was transformed into DH5α competent cells, a single colony was picked for culture, and PCR identification was performed using the bacterial solution as a template, and a fragment of the expected size was amplified. The plasmid was extracted from the bacterial solution that was positive for PCR identification, and the plasmid was double-enzyme digestion identified, indicating that the recombinant plasmid IFNγ-pIRES was successfully constructed. The plasmids with correct double enzyme digestion were sequenced, and the correct plasmids were double digested with Sal I and Xba I, and the recovered products were connected with the recovered products of Tα1 gene double digested with Sal I and Xba I. The connected products were transformed into DH5α competent cells. After the single colony was shaken overnight, PCR identification was performed using the bacterial solution as a template and Ts1 / Ts2 as primers, and a fragment of about 106 bp was amplified ( Fig.21 ), which was initially identified as a positive clone, and the recombinant plasmid IFNγ-pIRES-Tα1 ( Fig. 22 The plasmid extracted from the positive clone was identified by double restriction enzyme digestion, and the expected result was obtained ( Fig.23 ). This indicated that the recombinant plasmid was successfully constructed. The obtained positive clones were named DH-pIRES-IFNγ and DH-IFNγ-pcDNA6-Tα1.

[0400] Fig. 20 Schematic diagram of the structure of pIRES plasmid;

[0401] Fig.21The PCR identification results of the recombinant plasmid IFNγ-pIRES; the meanings of the numbers in the figure are: M: DNAMarker DL2,000; 0: negative control; 1, 2, 3, 4, 6, 7, 9: positive clones of IFNγ-pIRES, the PCR product size is about 500 bp; 5, 8: transformants without IFNγ gene inserted;

[0402] Fig. 22 The PCR identification results of the recombinant plasmid IFNγ-pIRES-Tα1; the meanings of the numbers in the figure are: M: Marker pUC18 / MspI; 0: negative control; 1, 2, 6, 7, 8, 9: positive clones, the size of the PCR product is 106 bp; 3, 4, 5: transformants without Tα1 gene inserted;

[0403] Fig.23 The double enzyme digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1; the meanings of the numbers in the figure are: M1: DNA Marker DL2,000; M2: DNA Marker DL15,000; 1, 4: PCR products of IFNγ and Tα1 genes; 2, 3: enzyme digestion products of the recombinant plasmid IFNγ-pIRES and IFNγ-pIRES-Tα1;

[0404] 2.3.11 Sequence determination of reading frames of positive clones

[0405] The bacterial liquid identified as positive by the above PCR and plasmid double enzyme digestion was sent to Shanghai Boshang Biotechnology Co., Ltd. for sequence determination.

[0406] 2.3.12 Large-scale extraction of recombinant eukaryotic plasmids

[0407] Follow the method in 2.1.9.

[0408] 2.2.13 Transfection of COS-7 cells with IFNγ-pIRES-Tα1 recombinant plasmid and pIRES empty plasmid

[0409] Follow the method in 2.1.10.2.

[0410] 2.2.14 RT-PCR detection of COS-7 cells transfected with recombinant plasmid

[0411] RT-PCR detection mainly includes two parts: extraction of total cell RNA and RT-PCR identification.

[0412] The method for extracting total cellular RNA was carried out according to 2.1.11.

[0413] The target gene was amplified by RT-PCR. The specific operation was referred to PrimeScript TMOne Step RT-PCRKit Ver.2 instructions. RT-PCR reaction system is:

[0414]

[0415] The above reaction system was mixed and centrifuged, and the following reaction program was performed on a PCR Express Gradient PCR instrument: 50℃30min, 94℃ pre-denaturation for 2min, one cycle; 94℃30s, 56 / 62 / 53 / 57℃ annealing for 40s, 72℃ extension for 1min, 30 cycles. 5μL of the amplified product was detected by agarose gel electrophoresis.

[0416] The results can be found in Fig.24 , Fig.24 The figure is a picture of cell RT-PCR products; the meanings of the numbers in the figure are: M: DNA MarkerDL2,000, 1, 2: RT-PCR products of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ; 3, 4: RT-PCR products of cells transfected with IFNγ-pIRES-Tα1;

[0417] 2.2.15 SDS-PAGE and Western Blot Detection of Expression Products

[0418] The obtained cell concentrated supernatant was subjected to SDS-PAGE detection to determine the expression of IFNγ-pIRES-Tα1 recombinant plasmid in COS-7 cells. For specific operation methods, see reference 2.1.12.

[0419] Perform Western Blot detection on the expression product according to the method in the Protein Technology Manual. For specific operation methods, see 2.1.13.

[0420] refer to Fig. 16B , Fig. 16B This is the SDS-PAGE detection result of IFNγ-pIRES-Tα1 positive cell supernatant. The cell positive supernatant of IFNγ-pIRES-Tα1 plasmid showed protein bands at 17KD and 4KD at the same time.

[0421] Part 3

[0422] Study on the Immunoenhancing Effect of Chicken IFNγ and Tα1 Recombinant Plasmids on H5 Subtype Avian Influenza Vaccine

[0423] The nucleic acid content of four endotoxin-free plasmids, pcDNA6-Tα1, pcDNA6-IFNγ, IFNγ-pIRES-Tα1 and pcDNA6 / His, was measured by spectrophotometer, and the concentration of the immunogen in the four plasmids was calculated. The four immunogens were diluted to the required concentration as needed.

[0424] 3.1 Immunoassay

[0425] 3.1.1 Experimental groups and treatments

[0426] 260 one-day-old white Leghorn SPF chickens were randomly divided into 13 groups, 20 in each group, and kept in an isolator in the special animal room of Guangdong Wenshi Dahuanong Branch. The drinking water and feed were sterilized by high pressure sterilization, and multivitamins were added to the drinking water after sterilization with a 0.22μm filter membrane. The group treatments are shown in Table 1. After being raised to 14 days of age, they were inoculated. The first group was a blank group without immunization; the second group was injected with 0.2 ml / bird of inactivated oil vaccine (RE-5) of avian influenza H5N1 subtype subcutaneously in the neck; the remaining 11 groups were several immune enhancement groups, and at the same time as RE-5 was injected subcutaneously in the neck of the chickens, the recombinant DNA vaccine was injected into the wing head muscle of the chickens: the third group was an empty plasmid control group, and the chickens were injected with 200 ug / bird of pcDNA6 endotoxin-free empty plasmid; the fourth, fifth, and sixth groups were high-dose groups (200 μg / bird), medium-dose groups (100 μg / bird), and low-dose groups (50 μg / bird) inoculated with recombinant plasmid pcDNA6-IFNγ, respectively; the seventh group was an empty plasmid control group, and the chickens were injected with 200 μg / bird of pcDNA6-IFNγ, medium-dose groups (100 μg / bird), and low-dose groups (50 μg / bird) respectively. Groups 1, 8, and 9 were high-dose (200 μg / bird), medium-dose (100 μg / bird), and low-dose (50 μg / bird) inoculated with recombinant plasmid pcDNA6-Tα1; Groups 10, 11, and 12 were high-dose (200 μg / bird), medium-dose (100 μg / bird), and low-dose (50 μg / bird) inoculated with recombinant plasmid IFNγ-pIRES-Tα1; Group 13 was a mixed immunization group of recombinant plasmids pcDNA6-IFNγ and pcDNA6-Tα1, with a dose of 100 μg / bird for each of pcDNA6-IFNγ and pcDNA-Tα1. 0.25% procaine was injected into the wing head muscle one day before the vaccine was injected, and the specific injection site was marked (i.e., when the chickens were 13 days old), and the DNA vaccine was injected into the same site the next day.

[0427] Table 1 Grouping and treatment of animals in immunization experiments

[0428]

[0429]

[0430] 3.1.2 Detection of HI antibodies in immune serum

[0431] The method was carried out in accordance with the Quality Standards of Veterinary Biological Products of the People's Republic of China. On the day, 7, 14, 21, and 28 days after immunization, 0.5 mL of blood was drawn from the subwing vein of 10 chickens randomly selected from each group, and the serum was separated for the detection of HI antibodies.

[0432] 3.2.1 Hemagglutination test (HA)

[0433] (1) Preparation of 1% chicken red blood cell suspension: After taking 1 mL of sodium citrate into a 10 mL test tube, 5 mL of blood was drawn from the hearts of three healthy chickens and placed in a centrifuge tube for centrifugation at 3,000 rpm for 10 min. The supernatant was discarded and the suspension was washed three times with 1× PBS solution, each time at 2,000 rpm for 5 min to thoroughly wash away the plasma, white blood cells, etc. The deposited red blood cells were diluted with 1× PBS solution to a 1% suspension for later use.

[0434] (2) Add 25 μL of 1× PBS solution to wells 1 to 12 of the microplate. Use a micropipette to draw 25 μL of antigen into the first well and mix well.

[0435] (3) Pipette 25 μL of antigen solution from well 1 and add it to well 2. After mixing, pipette 25 μL and add it to well 3. Repeat this process until well 11. Pipette 25 μL of the solution from well 11 and discard it. Add 25 μL of 1× PBS solution to well 12 as a control.

[0436] (4) Add 25 μL of 1% chicken red blood cell suspension to each well, mix well, and place at room temperature for 30 min to observe the results.

[0437] (5) Result judgment: Red blood cells agglutinate into a thin film, evenly covering the bottom of the well. When the agglutination is strong, the agglutination shrinks into a mass or the edges are jagged, which means 100% red blood cell agglutination; red blood cell agglutination is a thin layer, but the area is small, and red blood cells are deposited in the center of the bottom of the well as small dots, which means 50% red blood cell agglutination; all red blood cells sink to the center of the bottom of the well as small dots, with smooth surroundings and no scattered red blood cells, which means no agglutination. The highest virus dilution that can cause complete agglutination of red blood cells is taken as the hemagglutination titer of the virus.

[0438] (6) The antigen is diluted according to 4 units of hemagglutination titer, and a calibration test is performed: 25 μL of 1× PBS solution is added to the first four wells, 25 μL of diluted antigen is added to the first well and diluted to the third well, and then 25 μL of red blood cells is added to the first well and diluted to the fourth well. After 30 minutes at 37°C, if the first two wells show 100% red blood cell agglutination, the third well shows 50% red blood cell agglutination, and the fourth well shows 100% no agglutination, the antigen dilution is accurate; otherwise, dilute again.

[0439] 3.1.2.2 Hemagglutination inhibition test (HI):

[0440] (1) Add 25 μL of 1× PBS solution to all wells of the microplate. Add 25 μL of the serum to be tested to the first well. Mix thoroughly and then pipette 25 μL into the second well. Repeat this process until the tenth well. Discard 25 μL.

[0441] (2) Well 11 was used as an antigen control, and well 12 was used as a saline blank control;

[0442] (3) Add 25 μL of diluted antigen to each well except well 12, and leave at room temperature for 25 min. Then add 25 μL of 1% chicken red blood cell suspension, and leave at 37°C for 30 min to observe the results.

[0443] (4) Result determination: The maximum dilution of serum that completely inhibits red blood cell agglutination is taken as the hemagglutination inhibition titer of the serum. The determination criteria are: HI titer less than or equal to 3log2 is considered negative for HI test; HI titer equal to 4log2 is suspicious and needs to be repeated; HI titer greater than or equal to 5log2 is positive.

[0444] 3.1.3 MTT method to measure lymphocyte transformation effect

[0445] On the 7th, 14th, 21st and 28th days after immunization, 5 chickens were randomly selected from each group to collect 2 mL of blood aseptically, anticoagulated with sodium heparin, and lymphocytes were separated. The MTT method (Yang Falong et al., 2002; Li Qingzhang et al., 1994) was used to detect the transformation and proliferation effect of peripheral blood T lymphocytes. The specific operation is as follows:

[0446] 3.1.3.1 Isolation of peripheral blood lymphocytes

[0447] Three chickens were randomly selected from each group, and 2 mL of anticoagulated blood was collected aseptically. The blood was diluted with an equal volume of 1× PBS solution and carefully overlapped on an equal volume of lymphocyte separation solution. After centrifugation at 2,500 rpm for 20 min, the middle white cell layer was removed, washed three times with serum-free RPMI1940, and resuspended in a small amount of culture medium. The cells were counted so that the cell content was about 1×10 6 / mL, and the cell viability was detected by trypan blue exclusion method>95%.

[0448] 3.1.3.2 Determination of peripheral blood lymphocyte proliferation response

[0449] Add the prepared lymphocytes to a 96-well cell culture plate, and add 50 μL (cell number 1×10 7 / mL). ConA solution with a final mass concentration of 15μg / mL and 50μL of RPMI1640 medium with a final calf serum concentration of 10% were added to each well. Three replicates were set for each group, and blank control wells (cells and medium without ConA solution) were set at the same time. Culture was carried out at 37°C, 5% CO2 and saturated humidity for 60h. MTT (5mg / mL) 10μL was added to each well 3 hours before terminating the culture. After continuing to culture for 3h, 100μL of 10% SDS-0.01molHCI was added. After being placed in an incubator for 2h, the OD value of each well was detected at a wavelength of 570nm using an enzyme marker. The lymphocyte transformation rate was calculated according to the following formula:

[0450]

[0451] 3.1.4 Detection of dynamic changes in the number of peripheral blood T lymphocytes

[0452] The changes of T lymphocyte subsets in the peripheral blood of chickens were determined by flow cytometry (FACS) according to the method of Collissona et al. (2000).

[0453] 3.1.4.1 Preparation of lymphocyte samples

[0454] Five experimental chickens were randomly selected from each group to track and detect the changes in their T lymphocyte subtypes. After the chickens were immunized, 1 mL of heparin anticoagulated blood was collected from the chicken wing vein once a week, diluted with serum-free 1× PBS solution, and slowly added to 4 mL of lymphocyte separation solution containing compound pan-diatrizoate (so that the floating density is 1.070-1.080), and centrifuged at 2,500 rpm for 20 minutes at room temperature. The lymphocyte layer in the middle part was carefully aspirated and injected into an 8 mL centrifuge tube containing 3%-5% bovine serum PBS solution, and centrifuged at 1,500 rpm for 7-8 minutes at room temperature (if there are too many red blood cells in the precipitate, gently suspend the precipitate with serum-containing PBS solution and re-isolate the lymphocytes). The supernatant was discarded, and the cells were washed with PBS solution containing 5% fetal bovine serum, centrifuged at 1,500 rpm for 5 minutes at room temperature, and the supernatant was discarded. The washing was repeated three times, and an appropriate amount of PBS was added for the last time so that the lymphocyte content was about 1×10 6 / mL~5×10 6 / mL, divide appropriate amount into 4 1.5mL centrifuge tubes, mark them as A, B, C and D respectively, centrifuge and drain for later use.

[0455] 3.1.4.2 Determination of T lymphocyte subsets

[0456] The prepared lymphocytes were diluted with an appropriate amount of CD3 + 、CD4 + and CD8 +Three monoclonal antibodies were added to three tubes respectively, and lymphocytes were resuspended. Tube D was resuspended with PBS solution and kept as a control; the tube was placed in an ice water bath for reaction for 30 minutes. After the reaction was completed, centrifuged at 1,500rpm for 5 minutes and the supernatant was discarded. Lymphocytes were washed repeatedly with 200μL PBS solution for 3 times, and finally the cell pellet was fully suspended with 1mL of serum-free PBS solution, and then detected on the FACS (canTM Flow Cytomer BDIS, San Joes, CA) instrument. If the measurement is not performed immediately, 0.7% formaldehyde solution can be added and stored at 4°C, but the storage time is generally not more than 24h. 20,000 cells were detected by flow cytometry, and the obtained data were statistically processed.

[0457] 3.1.5 Detection of organ immune coefficient

[0458] On the 14th and 28th day after immunization, three chickens were randomly selected from each group and then weighed and killed. The spleen, bursa of Fabricius and thymus were completely removed. The surface moisture and blood of the tissues were absorbed with filter paper, and then the weight was weighed and recorded. The immune index was calculated according to the following formula:

[0459] Bursal index = bursal weight (g) / body weight (kg)

[0460] Thymus index = thymus weight (g) / body weight (kg)

[0461] Spleen index = spleen weight (g) / body weight (kg)

[0462] 3.1.6 Challenge protection test

[0463] (1) LD of H5N1 subtype avian influenza virus 50 Determination: Refer to the "China Import and Export Animal Quarantine Standards" for operation

[0464] The H5N1 virus allantoic fluid was diluted 10-fold in sequence and diluted to 10 with sterile saline. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 10 dilutions were made, and a control (i.e., inoculated with saline) was set up. The diluted H5N1 virus allantoic fluid was inoculated into 35-day-old SPF chickens, with 0.2 mL inoculated into each chicken; 10 chickens were inoculated into each dilution of the virus allantoic fluid, and the mortality of the chickens was observed every day for 7 consecutive days, and the results were recorded. The AIV challenge dose when half of the chickens died was taken as the LD 50 The calculation formula is:

[0465] LD 50 Logarithm of = logarithm of virus dilution with mortality rate higher than 50% + distance ratio × logarithm of dilution multiple

[0466] Distance ratio = (% of deaths above 50% - 50%) / (% of deaths above 50% - % of deaths below 50%)

[0467] (2) According to LD 50 The value of the challenge dose is determined

[0468] H5N1 virus allantoic fluid LD 50 The test results are shown in Table 2. The LD of H5N1 virus was calculated according to the Reed-Muench method. 50 For 10 -7 / 0.2mL.

[0469] (3) 28 days after immunization, each group of chickens were treated with 200LD 50 The challenge test was carried out by intramuscular injection of the dose. The condition of the chickens after challenge was observed and recorded and the protection rate of challenge was calculated:

[0470] Protection rate of virus attack = (total number of chickens attacked with virus - number of dead chickens) / total number of chickens attacked with virus

[0471] Table 2H5N1 virus LD 50 Test results

[0472]

[0473] All data in this experiment were analyzed by variance analysis using SAS statistical software, and Duncan's test was used for multiple comparisons between groups of data when there were significant differences.

[0474] 3.2 Results and Statistics

[0475] 3.2.1 Preparation of immunogen

[0476] The concentration and purity of the plasmid DNA extracted using the TIANGEN endotoxin-free plasmid extraction kit were determined by agarose gel electrophoresis and spectrophotometer. Take 3 μL of the extracted plasmid and detect it by 1% agarose electrophoresis. According to the calculation formula of double-stranded DNA content in the UV spectrophotometer manual: OD260nm×50×dilution factor (μg / mL), the concentrations of the four immunogens were calculated. The results are shown in Table 3, which shows that the extracted plasmid DNA has a high purity.

[0477] Table 3 Concentration of immunogen (mg / mL)

[0478]

[0479] 3.2.2 Detection of serum HI antibodies

[0481] Four weeks after immunization, the average neutralizing antibody levels in the serum of the experimental chickens in each group are shown in Table 4: It can be seen from Table 4 that the antibody titer of the blank group was negative throughout the experiment. Seven days after immunization, the antibody titer of the experimental chickens in each vaccine group was less than 3log2, that is, negative. Fourteen days after immunization, the antibody titer of the chickens in each vaccine group increased rapidly. There was no difference between the H5N1 inactivated vaccine injection, the empty plasmid group and the pcDNA-Tα1, pcDNA-IFNγ booster immunization medium dose group and the IFNγ and Tα1 mixed immunization group (P>0.05); there was no difference between the low, medium and high doses of the pcDNA-Tα1 booster immunization group (P>0.05); among the pcDNA-IFNγ booster immunization groups, the difference between the medium dose and the low and high doses was significant (P<0.05), and there was no difference between the low and high doses; the difference between the doses of the IFNγ-pIRES-Tα1 booster immunization group was significant (P<0.05). 21 days after immunization, the antibody titers of each vaccine group continued to rise; there was no difference between the H5N1 inactivated vaccine injection and the empty plasmid group and the pcDNA-IFNγ low-dose group (P>0.05), which was the highest (10.63log2); there were significant differences with other groups (P<0.05). There was no difference between the low, medium and high doses of pcDNA-Tα1 and pcDNA-IFNγ booster immunization groups (P>0.05); there was no difference between the low and medium doses of IFNγ-pIRES-Tα1 booster immunization group, and there was a significant difference with the high dose (P<0.05); there was no difference between the IFNγ and Tα1 combined immunization group and the pcDNA-Tα1 and pcDNA-IFNγ medium dose groups and the IFNγ-pIRES-Tα1 low and medium dose groups, and there were significant differences with other groups (P<0.05). 28 days after immunization, the antibody titers among the immunization groups reached the same level, and there was no significant difference (P>0.05).

[0482] Table 4 Average HI antibody titer of experimental chickens after immunization

[0483]

[0484]

[0485]

[0486] Note: In the same column, the differences are significant (P<0.05) for different shoulder letters, and insignificant (P>0.05) for the same shoulder letters, the differences are the same as in the following table.

[0487] 3.2.3 Lymphocyte transformation effect detection

[0488] As can be seen from Table 5, after the chickens in each group were immunized, the transformation rate of peripheral blood lymphocytes showed a downward trend over time. The lymphocyte transformation rate of the low-dose IFNγ-pIRES-Tα1 group was the highest at all stages after immunization, and there were significant differences between the other groups, and there were also significant differences between the three dose groups (P<0.05). There were differences between the low-dose pcDNA-Tα1 booster immunization group and the medium-high dose group (P<0.05), and there were no significant differences between the medium-high dose groups. The differences between the dose groups of pcDNA-IFNγ booster immunization were significant (P<0.05). Based on the results of four weeks after immunization, there were differences between the IFNγ and Tα1 mixed immunization group and the pcDNA-Tα1 booster immunization group and the pcDNA-IFNγ booster immunization group (P<0.05), and their lymphocyte transformation rates were all lower than those of the two single booster immunization groups.

[0489] Table 5 Effects of chicken IFNγ and Tα1 on the transformation rate of chicken peripheral blood lymphocytes

[0490]

[0491]

[0492] 3.2.4 Dynamic changes in the number of peripheral blood T lymphocytes

[0493] 3.2.4.1 Peripheral blood CD3 + Changes in T lymphocytes

[0494] As can be seen from Table 6, chicken peripheral blood CD3 + The number of T lymphocytes increased from 7 to 21 days after immunization and then began to decline. Four weeks after immunization, the peripheral blood CD3 + The percentage of T lymphocytes was significantly lower than that of the other immune enhancement groups (P<0.05). + The number of T lymphocytes was the highest, and the difference between the other groups was significant (P<0.05); the difference between it and other dose groups was also significant (P<0.05). + The number of T lymphocytes was high, and the difference between the medium and high dose groups was significant (P<0.05), and the difference between the high and medium dose groups was not significant. The difference between the pcDNA-IFNγ dose groups was not significant (P>0.05). +The number of T lymphocytes was higher than that in the pcDNA-Tα1 boosted immunization group and the pcDNA-IFNγ boosted immunization group, but the difference was not significant (P>0.05).

[0495] Table 6 Peripheral blood CD3 of chickens after immunization + Dynamic changes of T lymphocyte count (%)

[0496]

[0497] 3.2.4.2 Peripheral blood CD4 + Changes in T lymphocytes

[0498] It can be seen from Table 7 that during the entire test, the blank group CD4 + The percentage of T lymphocytes in the other experimental groups was basically the same, and it reached the highest level at 14 to 21 days after immunization, and then decreased, but was still greater than the percentage at 7 days at 28 days. + The percentage of T lymphocytes in the IFNγ-pIRES-Tα1-boosted group was higher than that in the blank group, oil vaccine group, and empty plasmid group (P<0.05). + The percentages of T lymphocytes were 33.59%, 30.58% and 27.99% respectively. We can also see from the table that in the IFNγ-pIRES-Tα1 low-dose boost group, the peripheral blood CD4 + The percentage of T lymphocytes was the highest in all groups, and the difference was significant (P<0.05). There was no difference in the pcDNA-Tα1 booster immunization group from 7d to 14d after immunization, but from 21d to 28d after immunization, the CD4 + The percentage of T lymphocytes was significantly higher than that of the high-dose group (P<0.05). However, there was no significant difference between the three dose groups in the pcDNA-IFNγ booster group three weeks after immunization (P>0.05); until 28 days after immunization, there was a significant difference between the low-dose group and the medium-dose group (P<0.05), but there was no significant difference between the high-dose group and the medium- and low-dose groups. Four weeks after immunization, the peripheral blood CD4 + The percentage of T lymphocytes in the immunized groups was higher than that in the pcDNA-Tα1 and pcDNA-IFNγ groups, but the difference was not significant (P>0.05).

[0499] Table 7 Peripheral blood CD4 after chicken immunization + Dynamic changes of T lymphocytes (%)

[0500]

[0501]

[0502] 3.2.4.3 Peripheral blood CD8 + Changes in T lymphocytes

[0503] As can be seen from Table 8, the CD8 + The percentage of T lymphocytes began to increase rapidly 7 days after immunization, reached the highest level 21 days after immunization, and then showed a downward trend over time. + The percentage of T lymphocytes was the highest and significantly higher than that of other experimental groups (P<0.05). Four weeks after immunization, the percentage of T lymphocytes in the pcDNA-Tα1 booster immunization group was the highest in the low-dose group; 14 to 28 days after immunization, it was significantly higher than the medium and high-dose groups (P<0.05). There was no difference between the pcDNA-IFNγ dose groups (P>0.05). There was no difference between the IFNγ and Tα1 mixed immunization group and the pcDNA-Tα1 and pcDNA-IFNγ immunization group. The CD8 + The percentage of T lymphocytes in the chickens of the oil vaccine group was higher than that in the blank group and the empty plasmid group (P<0.05). + There was no difference in the proportion of T lymphocytes between the medium and high dose groups of pcDNA-Tα1 and the low and medium dose groups of pcDNA-IFNγ.

[0504] Table 3.9 Peripheral blood CD8 after chicken immunization + Dynamic changes of T lymphocytes (%)

[0505]

[0506]

[0507] 3.2.5 Detection of organ immune coefficient

[0508] 2.5.1 Effect of DNA vaccine on chicken bursal index

[0509] As can be seen from Table 9, at 14 and 28 days after chickens were immunized, the differences between the vaccine injection groups and the blank group were significant (P<0.05), indicating that the injection of the above vaccines has a promoting effect on the bursa of Fabricius in chickens. The low- and medium-dose groups injected with IFNγ-pIRES-Tα1 were significantly different from the three dose groups injected with pcDNA-Tα1 and pcDNA-IFNγ alone, as well as the IFNγ and Tα1 combined immunization group (P<0.05). The high-dose group had the same immune enhancement effect as the low-dose pcDNA-Tα1 group and the IFNγ and Tα1 combined immunization group, with no difference (P>0.05). The IFNγ and Tα1 combined immunization group had the same effect as the low-dose pcDNA-Tα1 group 14 days after immunization, and there was a difference at 28 days after immunization; the difference between it and the other groups was significant at 14 days and 28 days after immunization (P<0.05). The bursal index of chickens injected with pcDNA-Tα1, pcDNA-IFNγ and IFNγ-pIRES-Tα1 low dose groups was higher than that of the other two dose groups injected with the three plasmids. Among them, the differences among the three dose groups injected with pcDNA-Tα1 and IFNγ-pIRES-Tα1 were significant at 14 days after immunization (P<0.05); the differences among the low and medium dose groups injected with pcDNA-IFNγ were not significant, but the differences with the high dose group were significant (P<0.05); the differences among the three dose groups injected with pcDNA-Tα1, pcDNA-IFNγ and IFNγ-pIRES-Tα1 were significant at 28 days after immunization (P<0.05); while the differences between the high dose groups injected with pcDNA-Tα1 and pcDNA-IFNγ alone and the control group and the empty plasmid group were not significant (P>0.05). Compared with 14 days and 28 days after immunization, the bursal index of each group decreased, indicating that the bursa of the chickens degenerated.

[0510] Table 9 Effects of chicken IFNγ and Tα1 on bursal index of chickens immunized with avian influenza vaccine

[0511]

[0512]

[0513] 3.2.5.2 Effect of DNA vaccine on chicken thymus index

[0514] As can be seen from Table 10, the thymus index of the chickens in the vaccine group was higher than that in the blank group, indicating that the injection of the above vaccine has a promoting effect on the thymus of chickens. After 14d and 28d of immunization, the differences among the three dose groups of IFNγ-pIRES-Tα1 were significant (P<0.05); among them, the differences between the medium and low dose groups and the other groups were significant (P<0.05), and the high dose group was not significantly different from the IFNγ and Tα1 combined immunization group (P>0.05), but was significantly different from the other groups (P<0.05). After 14d of immunization, the differences between the IFNγ and Tα1 combined immunization group and the single injection of pcDNA-Tα1 and pcDNA-IFNγ were significant (P<0.05); there was no difference between 28d of immunization and the single injection of pcDNA-Tα1. 14d and 28d after chickens were immunized, there were significant differences between the low-dose group and the medium- and high-dose groups injected with pcDNA-Tα1, and the effects between the medium- and high-dose groups were comparable, while there were no differences among the three dose groups injected with pcDNA-IFNγ (P>0.05).

[0515] Table 10 Effects of chicken IFNγ and Tα1 on thymus index of chickens immunized with avian influenza vaccine

[0516]

[0517]

[0518] 3.2.5.3 Effect of DNA vaccine on chicken spleen index

[0519] From Table 11, it can be seen that the differences between the DNA vaccine injection group and the blank group, control group and empty plasmid group were significant (P<0.05), indicating that the injection of each dose of DNA vaccine has a promoting effect on the spleen of chickens. The differences between the low-dose group of IFNγ-pIRES-Tα1 injected chickens and other groups were significant (P<0.05), and there was no significant difference between the medium- and high-dose groups (P>0.05); there was a significant difference between the medium-dose group and the groups injected with other vaccines (P<0.05), but there was no difference between the high-dose group and the IFNγ and Tα1 combined immunization group (P>0.05). The IFNγ and Tα1 combined immunization group had no difference with the pcDNA-Tα1 low-dose group and the pcDNA-IFNγ low-dose group at 14 days after immunization, and had a significant difference with other groups (P<0.05); 28 days after immunization, there were significant differences between the groups injected with pcDNA-Tα1 and pcDNA-IFNγ at each dose (P<0.05). Chickens injected with pcDNA-Tα1 alone showed no difference between the various dose groups at 14 days after immunization; at 28 days after immunization, there were differences between the low-dose group and the medium-high dose group (P<0.05), but the effects of the medium-high dose group were equivalent (P>0.05). Chickens injected with pcDNA-IFNγ alone showed significant differences between the low-dose group and the medium-high dose group at 14 days and 28 days after immunization (P<0.05), but there was no difference between the medium-high dose groups.

[0520] Table 11 Effects of chicken IFNγ and Tα1 on spleen index of chickens immunized with avian influenza vaccine

[0521]

[0522] 3.2.6 Detection of antiviral ability

[0523] On the second day after the infection, the chickens became ill, with a sharp drop in feed and water intake, depression, ruffled feathers, difficulty breathing, and a tendency to lie down. From the third day, chickens in the blank group, the group injected with the inactivated H5N1 vaccine, and the empty plasmid group began to die. The autopsy of the dead chickens revealed: severe congestion of the respiratory tract, especially the laryngeal and tracheal mucosa; bleeding of the gastric gland papillae and hematoma of the duodenal mucosa; pancreatic necrosis and obvious bleeding spots in the pericardial fat. On the sixth day after the infection, all the chickens in the blank group died, and the chickens in the other groups began to resume feeding and drinking, with symptoms alleviated and spirits improved.

[0524] From the results in Table 12, it can be seen that one week after the experimental chickens were challenged with the virus, all the chickens in the blank group died, the protection rate against the virus was 0, and there was no protection effect on the chickens; there were only 2 deaths in the group injected with the H5N1 inactivated vaccine, and the protection rate against the virus was 80%; the protection rate against the virus in the empty plasmid group was 81.8%; there were no deaths in the chickens in the other immune-boosting groups, and the protection rates against the virus were 100%, indicating that the protection effect on the experimental chickens was good.

[0525] Table 12 Immune protection effect after challenge

[0526]

[0527] Part 4

[0528] Results Analysis

[0529] 4.1 Four high-purity immunogens IFNγ-pIRES-Tα1, pcDNA6-IFNγ, pcDNA6-Tα1 and pcDNA6 empty plasmid were obtained using the TIANGEN endotoxin-free plasmid extraction kit. Their concentrations were 13.65 mg / mL, 17.45 mg / mL, 13.75 mg / mL and 15.70 mg / mL, respectively.

[0530] 4.2 The results of the test on the neutralizing antibody level of experimental chickens after immunization with H5N1 avian influenza vaccine showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 could not increase the neutralizing antibody level in chicken serum.

[0531] 4.3 The results of the present invention preliminarily show that recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 can significantly increase the transformation level of chicken peripheral blood T lymphocytes. IFNγ-pIRES-Tα1 can more effectively promote the proliferation and differentiation of T lymphocytes than pcDNA6-IFNγ, pcDNA6-Tα1, and mixed immunization of IFNγ and Tα1, and its effect shows a certain dose-effect relationship with the dosage of recombinant plasmid IFNγ-pIRES-Tα1.

[0532] 4.4 The results of the analysis of the content of T lymphocyte subtypes in the peripheral blood of experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 could significantly increase the content of CD3 + 、CD4 + and CD8 + The proportion of T lymphocytes is increased, and the cellular immune function of the body is enhanced. IFNγ-pIRES-Tα1 has the best effect, and its effect is also in a dose-effect relationship with the dosage.

[0533] 4.5 The results of the study on the immune organ index of the experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 can significantly increase the immune index of the chicken bursa of Fabricius, thymus, and spleen tissues, and promote the body's immune function. IFNγ-pIRES-Tα1 has the best effect, and its effect also shows a dose-effect relationship with the dosage.

[0534] 4.6 The study on the protective effect of virus attack on experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 can significantly improve the protection of chickens against avian influenza virus.

[0535] In summary, chicken IFNγ and Tα1 as vaccine adjuvants can significantly improve the immune function of H5N1 oil emulsion inactivated vaccine, and the co-expression (IFNγ-pIRES-Tα1) form has the best effect. And its immune enhancement effect shows a certain dose-effect relationship with the dosage of IFNγ-pIRES-Tα1, and the lowest dose (50ug / head) is the best.

[0536] The applicant declares that the present invention illustrates the process method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned process steps, and it does not mean that the present invention must rely on the above-mentioned process steps to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of the raw materials selected by the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid includes an expression vector and a target gene connected to the expression vector, wherein the target gene includes an IFNγ gene and a Tα1 gene; The nucleotide sequence of the IFNγ gene is shown in SEQ ID No. 1; The nucleotide sequence of the Tα1 gene is shown in SEQ ID No.

2.

2. The recombinant plasmid according to claim 1, characterized in that The expression vector is a eukaryotic expression vector pIRES.

3. A method for preparing a recombinant plasmid as claimed in claim 1 or 2, characterized in that: The method is specifically as follows: Primers Ts1 / Ts2 are used to add restriction sites to the Tα1 gene, and primers IF3 / IF4 are used to add restriction sites to the IFNγ gene; and the Tα1 gene and IFNγ gene with restriction sites are inserted into the expression vector. The nucleotide sequence of primer Ts1 is shown in SEQ ID No. 5; The nucleotide sequence of primer Ts2 is shown in SEQ ID No.6; The nucleotide sequence of primer IF3 is shown in SEQ ID No.9; The nucleotide sequence of primer IF4 is shown in SEQ ID No.

10.

4. The preparation method according to claim 3, characterized in that: The expression vector is the eukaryotic expression vector pIRES; the IFNγ gene with added restriction sites is inserted into the multiple cloning site A region of the eukaryotic expression vector pIRES; the Tα1 gene with added restriction sites is inserted into the multiple cloning site B region of the eukaryotic expression vector pIRES.

5. A protein composition, characterized in that including a first target protein and a second target protein; The amino acid sequence of the first target protein is shown in SEQ ID No.13; The amino acid sequence of the second target protein is shown in SEQ ID No.

14.

6. The protein composition according to claim 5, characterized in that The recombinant plasmid as claimed in claim 1 or 2 is used to obtain the product through prokaryotic expression.

7. Use of the recombinant plasmid as claimed in claim 1 or 2 in preparing a vaccine.

8. Use of the protein composition according to claim 5 or 6 in the preparation of a vaccine.

9. A vaccine, characterized in that contain: The recombinant plasmid according to claim 1 or 2; and / or, The protein composition according to claim 5 or 6.

10. A combination vaccine, characterized in that Includes basic vaccines and immune boosters; The basic vaccine is a vaccine used to prevent and treat viral infection, using inactivated or attenuated viruses as antigens; The immunopotentiator is the recombinant plasmid according to claim 1 or 2; and / or the protein composition according to claim 5 or 6.

Images