Application of molecular marker in preparation of product for diagnosing or monitoring non-alcoholic fatty liver disease

Abstract

The invention belongs to the technical field of non-alcoholic fatty liver disease diagnosis, and provides application of a molecular marker in preparation of a product for diagnosing or monitoring a non-alcoholic fatty liver disease aiming at the problems that the existing known NAFLD non-invasive diagnosis marker is poor in clinical applicability and cannot meet clinical requirements. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1. The molecular marker has a relatively high expression level in the blood of an NAFLD patient, and can be used as the NAFLD molecular marker for diagnosing the NAFLD; the detection kit provided by the invention can be used for accurately and quickly detecting the expression level of the NAFLD molecular marker in blood and helping clinicians to accurately identify early NAFLD.

Description

Technical Field

[0001] The present invention belongs to the technical field of non-alcoholic fatty liver disease diagnosis, and specifically relates to use of a molecular marker in preparing a product for diagnosing or monitoring non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) refers to a clinical pathological syndrome characterized by lipid accumulation in hepatocytes caused by factors other than alcohol and other clear liver damage factors. Its disease spectrum includes non-alcoholic fatty liver, non-alcoholic steatohepatitis (NASH) and its related fibrosis and cirrhosis. With the prevalence of obesity and type 2 diabetes (T2DM), the prevalence and incidence of NAFLD are increasing worldwide, and it has replaced viral hepatitis as the number one chronic liver disease. In addition, NAFLD is causally related to metabolic syndrome and T2DM, and together they promote the onset of arteriosclerotic cardiovascular disease, chronic kidney disease, liver decompensation, and malignant tumors such as hepatocellular carcinoma. Therefore, NAFLD is one of the important global public health issues in the 21st century.

[0003] NAFLD usually has an insidious onset, may be asymptomatic, or may have mild and non-specific symptoms, which may manifest as discomfort in the liver area, dull pain, abdominal distension, fatigue, and sleep disorders. Even if NASH or even cirrhosis has occurred, the symptoms are sometimes still mild, so it is often discovered accidentally during the evaluation of other diseases or health examinations through liver function and imaging tests. The diagnostic techniques of NAFLD can be simply divided into two categories: invasive and non-invasive. The invasive method specifically refers to liver puncture biopsy, and the non-invasive method includes imaging and blood marker tests. Compared with liver puncture biopsy and imaging examinations, blood marker screening has higher convenience and feasibility, and patients have higher tolerance and lower cost, which is very suitable for large-scale screening of people susceptible to NAFLD. More and more studies have shown that non-coding small RNAs may play an important regulatory role in the occurrence and development of NAFLD. tRNA-derived small RNA (tsRNA) is an emerging class of non-coding small RNA molecules. tsRNAs are not the product of random degradation of tRNA, but are produced by recruiting nucleases such as Dicer, ELAC2 / RNase Z and Angiogenin to accurately cut tRNA under specific conditions. According to the different cleavage positions of mature or precursor tRNA, tsRNAs can generally be classified as tRF-1, tRF-3, tRF-5 and tRNA half molecules. Different tsRNAs have their specific molecular size, nucleotide composition, physiological function and biogenesis.

[0004] Currently, the well-validated blood markers for NAFLD mainly include the following: pre-proinsulin, leptin, adiponectin and cytokeratin fragments. The above markers can often be used to obtain diagnostic evidence through routine hospital examinations, meeting the basic needs of large-scale screening, but they have shortcomings such as uneven detection performance, unclear marker mechanisms and low specificity. Other biomarkers, such as some miRNA markers, seem to change dynamically in expression in different individuals or under different conditions, which limits their clinical use as diagnostic biomarkers; hsa-miR-452, as a non-invasive diagnostic marker, is mainly used for the non-invasive diagnosis of NASH and its fibrosis, and there is no clear explanation for the diagnosis and evaluation of NAFLD; some circRNA markers can only assist in the diagnosis of non-alcoholic cirrhosis; the process of detecting the protein level or mRNA level of SLC26A6, SLC46A3 or SULT1B1 to diagnose whether NAFLD is present is relatively cumbersome; tRF-1, as a type of engineered nucleic acid molecule for the treatment of liver injury, has not been validated at the population level; the clinical prediction model of Porphyromonas gingivalis fimA subtypes I, Ib, and IV combined as biomarkers can only predict the progression of NAFLD, but cannot predict the risk of NAFLD. Therefore, the currently known non-invasive diagnostic markers for NAFLD have the disadvantage of weak clinical applicability and cannot meet actual clinical needs. There is an urgent need to develop new biomarkers to meet the clinical needs for non-invasive and accurate diagnosis of NAFLD. Summary of the invention

[0005] In view of the above-mentioned problem that the currently known non-invasive diagnostic markers for NAFLD have weak clinical applicability and cannot meet clinical needs, the present invention provides a use of a molecular marker in the preparation of a product for diagnosing or monitoring non-alcoholic fatty liver disease. The molecular marker has a high expression level in the blood of NAFLD patients and can be used as a NAFLD molecular marker for diagnosing non-alcoholic fatty liver disease. The detection kit provided by the present invention can accurately and quickly detect the expression level of NAFLD molecular markers in the blood, helping clinicians to accurately identify early-stage NAFLD.

[0006] The present invention is achieved through the following technical solutions: The present invention provides use of a molecular marker in preparing a product for diagnosing or monitoring non-alcoholic fatty liver disease, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO:1.

[0007] The present invention provides a product for diagnosing or monitoring non-alcoholic fatty liver disease, wherein the product comprises a reagent for detecting the molecular marker.

[0008] Furthermore, the product comprises primers for specifically amplifying the molecular marker or probes for specifically recognizing the molecular marker.

[0009] Furthermore, the reagents include reagents for detecting the molecular markers using real-time quantitative PCR or high-throughput sequencing platforms.

[0010] Furthermore, the reagents for detecting the molecular markers by real-time quantitative PCR include at least a pair of primers for specifically amplifying the molecular markers.

[0011] Furthermore, the nucleotide sequences of the primers are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0012] Furthermore, the product is a reagent or kit for detecting the molecular marker in plasma.

[0013] The present invention provides the application of the molecular marker in constructing a computer model for predicting non-alcoholic fatty liver disease.

[0014] The present invention provides the use of the molecular marker in in vitro screening of drugs for treating non-alcoholic fatty liver disease.

[0015] The present invention has the following beneficial effects: the molecular marker provided by the present invention has a high expression level in the blood of NAFLD patients, and using it as a NAFLD molecular marker can improve the accuracy of detection. The detection kit of the present invention has good detection accuracy and high detection efficiency, and is helpful for the early detection of NAFLD. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the amplification curve of tRF-1:23-Val-AAC-4-M2 detected by real-time fluorescence quantitative PCR; Figure 2 This is the expression difference analysis table of tRF-1:23-Val-AAC-4-M2 in NC group and NAFLD group; Figure 3 ROC curve for testing the diagnostic efficacy of tRF-Val-CAC-024. DETAILED DESCRIPTION

[0017] The present invention is further described in detail below with reference to specific embodiments and accompanying drawings.

[0018] Example

[0019] A detection kit for non-alcoholic fatty liver disease, the kit is used to detect molecular markers in plasma, the nucleotide sequence of the molecular marker is GTTTCTGTAGTGTAGTGGTTATC (SEQ ID NO: 1), and it is named tRF-1:23-Val-AAC-4-M2. It belongs to tRF-3, 1:23 represents that this tFR has 23 nucleotide sequences, Val is the amino acid corresponding to its complete tRNA, AAC represents the codon, and 4 represents the fourth codon corresponding to Val. The detection kit contains PCR specific primer F and PCR specific primer R, the nucleotide sequence of the PCR specific primer F is 5'-AGGAGCGATCCTCGTTAGTATAGTG-3' (SEQ ID NO: 2), and the nucleotide sequence of the PCR specific primer R is 5'-ATCCAGTGCAGGGTCCGAGG-3' (SEQ ID NO: 3).

[0020] The following experiments demonstrate that tRF-1:23-Val-AAC-4-M2 has a higher expression level in NAFLD and that the primers in the detection kit are effective for detecting tRF-1:23-Val-AAC-4-M2.

[0021] Chinese-English comparison of some technical terms: Demethylase, RNase Inhibitor, Terminal Enzyme Mix, Terminal Enzyme Reaction Buffer, Nuclease-free Water, Demethylation Reaction Buffer, ATP, Ligation Reaction Buffer, Ligation Enzyme Mix, T4 RNA Ligase 1, RNA Spike-in, exogenous RNA molecules of known concentration, 3'Adaptor 3' adapter, Reverse Transcription Primer, Adaptor Ligated RNA, First-Strand Synthesis Reaction Buffer, Reverse Transcriptase, Master Mix reaction mixture.

[0022] The 75% ethanol used in the following experiments was an ethanol solution diluted with nuclease-free pure water. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions were followed. If the manufacturer of the reagents or instruments used was not specified, they were all conventional products that can be purchased through regular channels.

[0023] 1. Extraction of total RNA from plasma samples

[0024] Commercially available total RNA extraction reagents such as TRIzol, chloroform, and isopropanol were used to extract RNA with high concentration and purity according to the product instructions, and 1 mL of plasma was collected from the NAFLD group and the healthy control (NC) group for testing.

[0025] 2. RNA Pretreatment and cDNA Synthesis

[0026] 1. 3'-cP removal and 5'-P phosphorylation

[0027] (1) Gently thaw all kit components except the demethylase. Vortex all reagents to mix and immediately place on ice.

[0028] (2) Add the following reagents in sequence: 1 µg ≤ RNA ≤ 5 µg, 1 µL RNase inhibitor, 1 µL Terminase mixture, 3 µL 10 × Terminase reaction buffer, 3 µL 10 × mM ATP, 3 µL nuclease-free water to make up the total volume / sample to 30 µL.

[0029] (3) Vortex briefly to mix and centrifuge, then incubate in a thermal cycler at 37°C for 30 min.

[0030] (4) Add 170 µL of nuclease-free water and 200 µL of chloroform to terminate the reaction.

[0031] (5) RNA purification

[0032] (a) Mix the contents of the tube in step (4) by inverting it upside down, incubate it at room temperature for 10 minutes, and then centrifuge it at 12,000 rpm for 10 minutes; (b) Carefully transfer the top aqueous phase to an RNase-free tube using a micropipette and discard the bottom organic phase. (c) Mix the RNA with an equal volume of isopropanol and precipitate it from the aqueous phase. Vortex and place in a -80°C refrigerator for 30 minutes, then centrifuge at 12,000 rpm for 10 minutes. (d) Discard the supernatant in the tube, leaving only the RNA pellet; (e) Add 1 ml of 75% ethanol to wash the RNA pellet and mix by inverting. (f) Centrifuge at 7500 rpm for 5 min at 4°C and discard the washing solution; (g) Air-dry the RNA pellet for 5-10 minutes or dry it by vacuum centrifugation; (h) Dissolve the RNA pellet completely with 30 µL of nuclease-free water and incubate in a thermal cycler at 55-60°C for 10-15 minutes.

[0033] 2. Demethylation

[0034] (1) Prepare fresh demethylation reaction buffer (4×) by mixing DRB-C1, C2, C3, C4, and C5 at a volume ratio of 1:1:1:1:1 and place on ice. The total volume of demethylation reaction buffer (4×) required is 1.1 × 25 × number of samples (µL). Note: Fresh demethylation reaction buffer (4×) must be prepared before each use.

[0035] (2) Remove the demethylase from the refrigerator, flick the tube to mix (do not vortex), centrifuge briefly, and place on ice until use.

[0036] (3) Preparation of demethylation reaction solution: Demethylation reaction buffer (4×) 25 µL, demethylase 5 µL, RNase inhibitor 2 µL, nuclease-free pure water 38 µL, total volume / sample 70 µL.

[0037] (4) Demethylation reaction (a) adding the demethylation reaction solution to step 1.(5) (h); (b) Briefly vortex to mix and centrifuge; (c) Incubate in a thermal cycler at 25°C for 2 h; (d) Add 100 µL of nuclease-free water and 200 µL of chloroform to terminate the reaction.

[0038] (5) RNA purification (a) Mix the contents of the tube in step 2.(4) (d) by inverting it upside down, incubate it at room temperature for 10 minutes, and then centrifuge it at 12,000 rpm for 10 minutes; (b) Carefully transfer the top aqueous phase to an RNase-free tube using a micropipette and discard the bottom organic phase. (c) Mix the RNA with an equal volume of isopropanol and precipitate it from the aqueous phase. Vortex and place in a -80°C refrigerator for 30 minutes, then centrifuge at 12,000 rpm for 10 minutes. (d) Discard the supernatant in the tube, leaving only the RNA pellet; (e) Add 1 ml of 75% ethanol to wash the RNA pellet and mix by inverting. (f) Centrifuge at 7500 rpm for 5 min at 4°C and discard the washing solution; (g) Air-dry the RNA pellet for 5-10 minutes or dry it by vacuum centrifugation; (h) Dissolve the RNA pellet completely with 11 µL of nuclease-free water and incubate in a thermal cycler at 55-60°C for 10-15 minutes.

[0039] 3. Ligation of 3' adapter

[0040] Note: To reconstitute the RNA Spike-in and transcription primers, add 40 µL and 60 µL of nuclease-free water to the corresponding tubes, respectively.

[0041] If the total RNA input amount is 100 ng, dilute the 3'Adaptor 1:2 with nuclease-free water before use.

[0042] (1) Add the following reagents in sequence to a 200 µL RNase-free PCR tube: RNA 7.3 µL, 3'Adaptor 1 µL, RNA Spike-in 0.5 µL, total volume 8.8 µL.

[0043] (2) Incubate in a thermal cycler at 70°C for 2 minutes and then move the PCR tube to ice.

[0044] (3) Add the following reagents to connect the 3' linker to the RNA: 3' ligation reaction buffer 7.2 µL, 3' ligase mixture 1 µL, RNase inhibitor 1 µL, total volume 9.2 µL;

[0045] (4) Incubate in a thermal cycler at 25°C for 1 hour.

[0046] Note: Prolonging the incubation time and lowering the incubation temperature (18h; 16°C) can increase the ligation efficiency of methylated RNA such as piRNA, but it may also form tandem products.

[0047] 4. Reverse transcription primer hybridization This step is critical to inhibit the formation of adapter dimers. The reverse transcription primer can hybridize with the excess 3' adapter, thereby converting the single-stranded DNA adapter into a double-stranded DNA molecule. Double-stranded DNA molecules are not substrates for single-stranded RNA ligase, so the excess 3' adapter will not ligate to the 5' adapter. Note: If the total RNA starting amount is 100 ng, dilute the reverse transcription primer 1:2 with nuclease-free water.

[0048] (1) Add the following reagents to the PCR tube in step 3. (4): 1 µL of nuclease-free pure water, 1 µL of reverse transcription primer, and the total volume of all reagents in the PCR tube is 20 µL.

[0049] (2) Incubate in a thermal cycler at 75°C for 5 min, 37°C for 15 min, and 25°C for 15 min.

[0050] 5. Ligation of 5' adapter

[0051] Note: If the total RNA input amount is 100 ng, dilute the 5' adapter 1:2 with nuclease-free water. Store the unused 5' adapter in a -80℃ freezer.

[0052] (1) Add 1.1 × the amount of sample (µL) of 5' adapter to a separate 200 µL RNase-free PCR tube.

[0053] (2) Incubate the 5' adapter at 70°C in a thermal cycler for 2 minutes and then immediately cool on ice.

[0054] Note: To avoid RNA degradation, use adapters within 30 minutes after adapter denaturation.

[0055] (3) Add the following reactants to the PCR tube in step 4. (2) in sequence and mix thoroughly: 5' adapter (denatured) 1 µL, 10 mM ATP 2.5 µL, 5' ligation buffer 0.5 µL, 5' ligase mix 1 µL, total volume 25 µL.

[0056] (4) Incubate in a thermal cycler at 25°C for 1 hour.

[0057] 6. Reverse transcription reaction

[0058] (1) Add the following reactants to a 200 µL nuclease-free PCR tube: 25 µL of adapter-ligated RNA, 8 µL of first-strand synthesis buffer, 3 µL of 0.1 M DTT, 2 µL of 2.5 mM dNTP Mix, 1 µL of ribonuclease inhibitor, 1 µL of reverse transcriptase, total volume 40 µL.

[0059] (2) Incubate at 45°C in a thermal cycler for 1 hour and then immediately cool on ice. The reaction product can be used directly in PCR amplification reaction.

[0060] Note: If you are not planning to perform PCR amplification immediately, incubate the samples at 70°C for 15 minutes in a thermal cycler to terminate the RT reaction. Then store the samples in a -20°C freezer.

[0061] 3. Perform real-time fluorescence quantitative PCR reaction

[0062] 1. Prepare real-time fluorescence quantitative PCR reaction system for all cDNA samples. The system configuration is as follows: 2 × reaction mixture 10 µL, 10uM PCR specific primer F (SEQ ID NO: 2) 0.5 µL, 10uM PCR specific primer R (SEQ ID NO: 3) 0.5 µL, add water to a total volume of 18 µL; flick the bottom of the tube to mix the solution, and briefly centrifuge at 5000rpm.

[0063] 2. Add sample

[0064] (1) Add 18 μl of the mixture to each corresponding well of the 96-PCR plate.

[0065] (2) Add 2 µL of the corresponding cDNA.

[0066] (3) Carefully adhere the sealing film and briefly centrifuge to mix.

[0067] (4) Place the prepared PCR plate on ice before setting up the PCR program.

[0068] 3. Place the above 96-PCR plate on a real-time fluorescence quantitative PCR instrument for PCR reaction.

[0069] All indicators were performed according to the following program: 95°C, 30 seconds; 40 PCR cycles (95°C, 5 seconds; 60°C, 30 seconds (collecting fluorescence)).

[0070] In order to establish the melting curve of the PCR product, after the amplification reaction, press (95℃, 10 seconds; 60℃, 60 seconds; 95℃, 15 seconds); and slowly heat from 60℃ to 99℃ (heating rate of 0.05℃ / second).

[0071] IV. Results and Calculations

[0072] The target gene and housekeeping gene of each sample were subjected to real-time fluorescence quantitative PCR reaction respectively. According to the gradient dilution DNA standard curve drawn, the concentration results of the target gene and housekeeping gene of each sample were directly generated by the software. The concentration of the target gene of each sample divided by the concentration of its housekeeping gene was the corrected relative content of this gene in this sample.

[0073] like Figure 1 As shown, tRF-1:23-Val-AAC-4-M2 ( Figure 1 Figure A) and internal reference RNU6 ( Figure 1The results of gene sequencing were consistent with those of Figure 2(B).

[0074] like Figure 2 As shown, there was a significant difference in the expression of tRF-1:23-Val-AAC-4-M2 between the NC group and the NAFLD group. The expression level in the NAFLD group was 2.82 times that in the NC group (P < 0.0001), and the difference was statistically significant.

[0075] In order to evaluate the clinical diagnostic efficacy of tRF-Ala-AGC-2-M4, plasma samples from 15 NAFLD patients and 15 healthy subjects were collected from the sample bank of Qingdao Municipal Hospital, and RNA from clinical samples was extracted, processed and detected according to steps 1 to 3. Figure 3 As shown, the levels of tRF-1:23-Val-AAC-4-M2 were detected in 15 cases in the NC group and the NAFLD group, and the ROC curve was drawn. The area under the curve (AUC) was 0.9644, P < 0.0001, indicating that tRF-1:23-Val-AAC-4-M2 has a high diagnostic value for NAFLD.

[0076] The embodiments described above are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a molecular marker in the preparation of a product for diagnosing or monitoring non-alcoholic fatty liver disease, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

2. A product for diagnosing or monitoring non-alcoholic fatty liver disease, characterized in that: The product includes a reagent for detecting the molecular marker.

3. The product according to claim 1, characterized in that The reagent is a reagent that specifically amplifies the molecular marker or specifically recognizes the molecular marker.

4. The product according to claim 3, characterized in that The reagent is a reagent for detecting the molecular marker by real-time quantitative PCR or a high-throughput sequencing platform.

5. The product according to claim 4, wherein the reagent for detecting the molecular marker by real-time quantitative PCR comprises at least a pair of primers for specifically amplifying the molecular marker; and the reagent for specifically identifying the molecular marker comprises at least a probe for specifically identifying the molecular marker.

6. The product according to claim 5, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. The product according to any one of claims 1 to 6, characterized in that: The product is a reagent or kit for detecting the molecular marker in plasma.

8. Use of the molecular marker according to claim 1 in constructing a computer model for predicting non-alcoholic fatty liver disease.

9. Use of the molecular marker according to claim 1 in in vitro screening of drugs for treating non-alcoholic fatty liver disease.

Images