InDel molecular marker located in chromosome 6 and related to yield of medicago sativa and application of InDel molecular marker

Abstract

The invention belongs to the technical field of molecular markers, and discloses an InDel molecular marker located in a chromosome 6 and related to the yield of medicago sativa and application of the InDel molecular marker, an upstream primer sequence of a primer pair for amplifying the molecular marker is as shown in SEQ ID NO.1, and a downstream primer sequence is as shown in SEQ ID NO.2. The molecular marker is located on a chromosome 6 of medicago sativa, and the nucleotide sequence of an insertion or deletion fragment of the molecular marker is shown as SEQ ID NO.3 in a sequence table. The InDel molecular marker and the primer pair provided by the invention can be used for predicting, identifying or assisting in identifying the yield traits of medicago sativa. Meanwhile, the invention further provides a method for identifying the alfalfa yield character by using the InDel molecular marker, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an InDel molecular marker located on chromosome 6 and related to alfalfa yield and an application thereof. Technical Background

[0002] Alfalfa (Medicago sativa L.) is a perennial herb of the genus Alfalfa in the Leguminosae family and one of the most widely distributed forage grasses in the world. Its crude protein content can reach more than 20% and it has good palatability. It is a high-quality source of animal feed and is widely planted in northern my country. With the increasing demand for meat, eggs and dairy products, the animal husbandry industry is facing higher development requirements. Alfalfa, as a plant with extremely high protein content, is crucial to the development of animal husbandry. Therefore, cultivating high-yield and high-quality new alfalfa materials is of great significance to increasing the yield of alfalfa and promoting the development of forage and animal husbandry.

[0003] With the continuous development and improvement of modern biological genetic technology, scholars pay more and more attention to the use of molecular marker technology to assist genetic breeding, so as to improve breeding efficiency and eliminate blindness in the breeding process. Marker breeding technology selects target trait genes by tracking genetic markers, thereby achieving the goal of new material breeding. This technology has the advantages of accuracy, rapidity, and high efficiency, and is widely used in more and more crops. Genome-wide association analysis (GWAS) is one of the efficient methods for analyzing quantitative traits. It searches for genetic information related to complex traits by typing large-scale population DNA samples with high-density genetic markers of the whole genome. The present invention constructs a population using 231 alfalfa materials, resequencing them, and performing whole-genome association analysis in combination with fresh weight traits, and develops an InDel site related to yield. The present invention provides theoretical support and gene resources for high-yield molecular genetic improvement and new material breeding of alfalfa. Summary of the invention

[0004] One of the purposes of the present invention is to provide an InDel molecular marker located on chromosome 6 and related to alfalfa yield.

[0005] The second object of the present invention is to provide the application of the InDel molecular marker located on chromosome 6 and related to alfalfa yield.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a molecular marker related to alfalfa yield, which is located on chromosome 6 of alfalfa and is named Ms_Chr6_85122344.

[0008] The primer pair for amplifying the above molecular markers has the following sequence:

[0009] Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG (shown in SEQ ID NO. 1);

[0010] Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG (shown in SEQ ID NO. 2);

[0011] The present invention also discloses the application of the molecular marker primer pair in alfalfa yield-assisted breeding. That is to say, the molecular marker of the present invention can be used in future molecular marker-assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the yield-related traits of alfalfa materials. The detection can use a PCR detection method, specifically the molecular marker primer pair, and the detection can also be performed by a sequencing method.

[0012] The present invention also discloses the application of the molecular marker in identifying the yield trait of alfalfa, especially in screening and identifying the high and low yield trait of alfalfa. Specifically, the specific steps for identifying whether alfalfa has the high yield trait are as follows:

[0013] (1) The DNA of the test germplasm was used as the template for PCR amplification, and the markers Ms_Chr6_85122344-F and Ms_Chr6_85122344-R were used as primers. The reaction system of PCR amplification was as shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 18 s, 35 cycles; extension at 72°C for 10 min; storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 4 μL and judge the alfalfa yield results based on the results of the bands.

[0018] PCR amplification was performed using primers Ms_Chr6_85122344-F and Ms_Chr6_85122344-R.

[0019] If the PCR amplification product has only one characteristic band with a length of 105 bp as shown in SEQ ID NO.4, the alfalfa is a high-yield type; if the PCR amplification product has both a characteristic band with a length of 105 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 78 bp as shown in SEQ ID NO.5, the alfalfa is a low-yield type.

[0020] In addition, the present invention also protects a kit for identifying alfalfa yield traits, wherein the kit comprises primer pairs Ms_Chr6_85122344-F and Ms Chr6_85122344-R. The other components of the kit are all conventional reagents. Specifically, the kit also comprises PCR Buffer, dNTP and Taq DNA polymerase. The present invention has no special restrictions on the concentration of the primer pair, and the primer concentration well known in the art can be used. The present invention has no special restrictions on the sources of the PCR Buffer, dNTP and Taq DNA polymerase, and the common PCR amplification reagents well known in the art can be used.

[0021] The kit of the present invention can be used to quickly identify the yield trait of alfalfa, and can also quickly identify the yield genotype of alfalfa. The specific method is to refer to the identification of whether alfalfa has a high-yield trait. The specific steps are: by electrophoresis detection and / or sequencing of the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 105bp as shown in SEQ ID NO.4, the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 105bp as shown in SEQ ID NO.4 and a characteristic band with a length of 78bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous low-yield genotype.

[0022] The present invention has the following advantages:

[0023] (1) Screening with markers linked to yield traits is conducive to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0024] (2) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, quickly and high-throughput applied to alfalfa high-yield breeding practice and material identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The whole genome association analysis result of alfalfa yield is a Manhattan diagram obtained based on EMMAX software analysis. The red dots indicate the positions of the InDels associated with the present invention.

[0026] Figure 2 It is a box plot of fresh weight distribution corresponding to the genotype of the Ms_Chr6_85122344 locus of the alfalfa population of the present invention; 0 / 0 means that the genotype of the Ms_Chr6_85122344 locus is a homozygous high-yield genotype, and 0 / 1 means that the Ms_Chr6_85122344 locus is a heterozygous low-yield genotype; the dots are extreme values ​​of the data, and **** represents P<0.0001.

[0027] Figure 3 This is the partial sequence comparison result of high-yield material and low-yield material in the yield-related region.

[0028] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 16 alfalfa germplasm resources, the concentration of agarose gel is 3%. In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0030] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0031] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0032] Example 1 Development of molecular markers related to alfalfa yield

[0033] The present invention measures the yield of alfalfa by the fresh weight of alfalfa at the initial flowering stage. The higher the value, the higher the yield of alfalfa; the lower the value, the lower the yield of alfalfa. After measuring the fresh weight of the alfalfa population, an InDel site ( Figure 1Red site), named Ms_Chr6_85122344. This site is located at the 85122344 site on chromosome 6 of the alfalfa reference genome, where the first allele type is 0 / 0; the second allele type is 0 / 1. The Ms_Chr6_85122344 yield high and low distribution box plot corresponding to the genotype of the population Ms_Chr6_85122344 site ( Figure 2 ), indicating that the yield of alfalfa strains with genotype 0 / 0 was significantly higher than that of alfalfa with genotype 0 / 1. At site 85122344 on chromosome 6 of alfalfa, the insertion / deletion fragment ACCCTTCAATTCAATATGAGCTACAAT (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the yield of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is a high-yield alfalfa; the alfalfa without the fragment shown in SEQ ID NO.3 is a low-yield alfalfa.

[0034] According to the InDel variation and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0035] Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG (shown in SEQ ID NO. 1);

[0036] Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG (shown in SEQ ID NO. 2);

[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous high-yield alfalfa sample had only a characteristic band of 105 bp, while the PCR product of the heterozygous low-yield alfalfa sample had both a characteristic band of 105 bp and a characteristic band of 78 bp.

[0038] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0039] 231 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0040] Table 2 Yield of 231 germplasm materials and the genotypes corresponding to the Ms_Chr6_85122344 locus

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0047] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×SanTaq PCR Mix 10μL, deionized water to 20μL; the reaction program of PCR amplification is preferably: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 18s, 35 cycles; 72℃ extension for 10min; 4℃ storage. 3% agarose gel electrophoresis separation, after spotting, electrophoresis at 120V DC voltage for 60min, and then read the PCR band type of each sample.

[0048] 2) judging the yield of alfalfa according to the size of the PCR product: when the PCR product of the alfalfa to be identified lacks the fragment shown in SEQ ID NO.3, the alfalfa to be identified is a low-yield alfalfa;

[0049] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a high-yield alfalfa;

[0050] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 105 bp (SEQ ID NO.4), then the alfalfa to be identified is a high-yield alfalfa.

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052] CATGTTGCAGTCACGAGCTATGCCACCACCAGCGCCGATGCACTACCCTTCAATTCAATATGAGCTACAATCCCAATATCTTTCACAACATCCTCAGCATCATGC.

[0053] When the fragment shown in SEQ ID NO.3 is missing from the PCR product of the alfalfa to be identified, the band length of the PCR product is 78 bp (SEQ ID NO.5), and the alfalfa to be identified is low-yield alfalfa.

[0054] The sequence of SEQ ID NO.5 is as follows:

[0055] CATGTTGCAGTCACGAGCTATGCCACCACCAGCGCCGATGCACTCCCAATATCTTTCACAACATCCTCAGCATCATGC.

[0056] Moreover, as can be seen from Table 2, this study identified 231 alfalfa materials, of which 121 alfalfa materials only amplified a characteristic band of 105bp, and the identification result was a homozygous high-yield genotype (0 / 0). After measurement, the average fresh weight of these 121 alfalfa materials was 0.897kg; 110 alfalfa materials amplified both a 105bp characteristic band and a 78bp characteristic band, and the identification result was a heterozygous low-yield type (0 / 1). After measurement, the average fresh weight of these 110 alfalfa materials was 0.743kg, which was lower than the average value of 121 high-yield alfalfa materials. Variance analysis showed that the fresh weight of high-yield genotypes and low-yield genotypes was extremely significantly different (P<0.0001).

[0057] We randomly selected 16 germplasms to verify the above results. Figure 4 The PCR test results of 16 germplasms (CF048304, CF039888, Ju Neng 601, Long Yin BeZa87, Knight 2, Crown, Xin Mu No. 1, SK3010, CF020828, Plato MS, PI641378, CF050057, CF020827, UC-1465, Gong Nong No. 4, Xin Mu No. 4) were shown, which were consistent with the actual fresh weight weighing results, and the electrophoresis diagrams of the remaining germplasms were also consistent with the actual fresh weight weighing results. Therefore, the InDel molecular marker of the present invention can effectively identify the yield high and low traits of alfalfa, and can be used for the prediction and screening of high-yield alfalfa materials.

[0058] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 6 and associated with alfalfa yield, characterized in that: The molecular marker is named Ms Chr685122344, and the sequence of the primer pair for amplifying the molecular marker is: Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG; Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG.

2. Use of the molecular marker described in claim 1 in molecular marker-assisted breeding of alfalfa.

3. The use according to claim 2, characterized in that: The molecular marker is used for predicting, identifying or assisting in identifying the yield traits of alfalfa.

4. A method for identifying yield traits of alfalfa, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: PCR amplification was performed using primers Ms Chr685122344-F and Ms Chr685122344-R. If the PCR amplification product had only one characteristic band with a length of 105 bp as shown in SEQ ID NO.4, the alfalfa was a high-yield type; if the PCR amplification product had both a characteristic band with a length of 105 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 78 bp as shown in SEQ ID NO.5, the alfalfa was a low-yield type.

5. A kit for identifying alfalfa yield, characterized in that: Comprising the primer pair described in claim 1.

6. Use of the kit according to claim 5 in identifying alfalfa yield genotype.

7. The use according to claim 5, characterized in that: The method for identifying alfalfa yield genotype comprises the following steps: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products are subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 105 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 105 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 78 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous low-yield genotype.

Images