Application of targeted Schwann cell VEGFA (vascular endothelial growth factor A) in preparation of medicine for treating gastric cancer and research of treatment method
Through clinical sample analysis and cell-level research, the role of Schwann cells in gastric cancer was determined, and the VEGFA signaling pathway was used to inhibit the proliferation and migration of gastric cancer cells, providing new targets and treatment ideas, and solving the early screening and treatment of gastric cancer. The problem has achieved effective inhibition of gastric cancer.
Patent Information
- Application Number
- CN202311604469.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-28
- Publication Date
- 2024-12-27
AI Technical Summary
Difficulty in early screening of gastric cancer, gold-free standard therapy, poor late prognosis, and high incidence and recurrence of residual gastric cancer after surgery. The existing treatment methods are not enough to effectively inhibit the progression of gastric cancer.
Through clinical case sample analysis, the existence and type of Schwann cells in gastric cancer were determined, and the specific mechanism of Schwann cell VEGFA as a target inhibition of gastric cancer was explored in depth, providing a targeted treatment method, using Schwann cell conditioned culture medium to promote Effects of gastric cancer cell proliferation and migration, inhibiting VEGFA signaling pathway to inhibit gastric cancer progression.
New targets and dual inhibition methods are provided, which significantly promotes gastric cancer treatment. By inhibiting VEGFA secreted by Schwann cells, the treatment of the effects on the proliferation and migration of gastric cancer cells is achieved. The effect is gentle, the operation is simple, and the success rate is high.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the application of Schwann cell-targeted VEGFA in the preparation of drugs for treating gastric cancer and the research of treatment methods. Background Art
[0002] Gastric cancer is one of the most common malignant tumors of the digestive system in my country, and its mortality rate ranks third among malignant tumors in my country. In 2020, the number of new cases of gastric cancer in my country exceeded 470,000, with a standardized incidence rate of 20.6 / 100,000, and the number of deaths was more than 370,000, with a standardized mortality rate of 15.9 / 100,000. Gastric cancer originates from the gastric mucosal epithelium and gradually invades the entire layer of the stomach through the proliferation and migration of cancer cells. Due to the lack of specificity of symptoms and the absence of obvious signs and symptoms, early gastric cancer is prone to misdiagnosis, causing patients to miss the best treatment time, which directly affects the patient's prognosis and quality of life. In addition, although the inhibitory effects of chemotherapy, targeted therapy, immunotherapy and other treatment methods on gastric cancer have been continuously explored, surgical treatment is still the only possible method to cure gastric cancer clinically, and there is no gold standard treatment for gastric cancer. In addition, although the application of gastroscopy and pathological tissue biopsy has improved the screening accuracy of early gastric cancer, the early screening rate of gastric cancer is still low and the mortality rate is still high. Therefore, in order to improve the early screening rate and survival rate of gastric cancer patients, it is necessary to find new targets and molecular mechanisms to transform them into effective therapeutic drugs and treatment methods.
[0003] In recent years, the concept that glial cells are only passive supporting cells has been refuted, and there is evidence that glial cells are important homeostatic cells in the gastrointestinal tract. Schwann cells are the main glial cells in the peripheral nervous system, and they can play different roles by reversibly dedifferentiating and redifferentiating into subtypes of different phenotypes (such as myelinating Schwann cells and non-myelinating Schwann cells), showing high plasticity.
[0004] The role of Schwann cells in promoting cancer has also received widespread attention. It has been shown that it participates in the progression of solid cancers such as lung cancer, pancreatic cancer, colon cancer, and oral cancer by regulating cancer cell proliferation, migration, spread, neural invasion, and epithelial-mesenchymal transition. In lung cancer, Schwann cells promote epithelial-mesenchymal transition and movement of lung cancer cell lines through the CXCL5 / CXCR2 / PI3K / AKT / GSK-3β / Snail-Twist pathway. In colon cancer, the neurotrophic factor NGF secreted by Schwann cells activates the TrkA / ERK / ELK 1 / ZEB 1 signaling pathway in colon cancer cells, further enhancing the expression of miR-21-5p to promote the proliferation and migration of colon cancer cells. However, it is not clear whether Schwann cells have the effect of promoting gastric cancer.
[0005] Gastric cancer is a common digestive tract malignancy in my country. Currently, early screening is difficult, there is no gold standard therapy, the prognosis is poor in the late stage, and the incidence and recurrence rate of residual gastric cancer after surgery are high. Schwann cells, as highly plastic and multifunctional cells, play an important role in neural development, neural regeneration after injury, pathological neuralgia, immune regulation, tumor progression, etc., but whether they play a role in the progression of gastric cancer and their specific mechanism have not been reported. ① The present invention determines the presence and specific types of Schwann cells in gastric cancer samples at the clinical level, as well as the clinical pathological correlation between Schwann cells and gastric cancer through clinical case sample analysis. ② The present invention deeply explores the role of Schwann cells in promoting gastric cancer at the cellular level, and clarifies the specific mechanism of Schwann cell VEGFA as a target to inhibit gastric cancer at the molecular level, laying the foundation for clinical application. Starting from the perspective of the neural cancer network, the present invention clarifies the mechanism of action of Schwann cells in the occurrence and development of gastric cancer, providing a new direction for the treatment of gastric cancer. Summary of the invention
[0006] The first purpose of the present invention is to address the deficiencies of the prior art and provide the use of Schwann cells as targets for specific screening of early gastric cancer.
[0007] The second object of the present invention is to provide the use of Schwann cells as targets to specifically inhibit the progression of gastric cancer.
[0008] Preferably, Schwann cells promote the expression of VEGFR2 and EGFR in gastric cancer cells by secreting VEGFA.
[0009] The third object of the present invention is to provide a drug for treating or preventing gastric cancer, comprising a Schwann cell VEGFA target.
[0010] The invention determines the clinical correlation between Schwann cells and gastric cancer by analyzing clinical samples; the invention places Schwann cells and gastric cancer cells in an incubator for culture; collects the supernatant after culturing a fixed number of Schwann cells with a complete culture medium to prepare a Schwann cell conditioned medium (SCM), and adds the Schwann cell conditioned medium or a basal culture medium to a gastric cancer cell culture dish for culture for a certain period of time; uses CCK8, PH3 immunofluorescence and cell cloning to detect the effect of the Schwann cell conditioned medium on the proliferation of gastric cancer cells; and uses cell scratch and transwell experiments to detect the effect of the Schwann cell conditioned medium on the migration of gastric cancer cells.
[0011] The present invention studies the effect of Schwann cells on the growth of gastric cancer cells. It is found that Schwann cell conditioned medium can significantly promote the growth of gastric cancer by promoting the proliferation and migration of gastric cancer cells. In addition, it is found that Schwann cells promote the VEGFR2 signaling pathway and the EGFR signaling pathway in gastric cancer cells to participate in promoting the growth of gastric cancer by secreting VEGFA. Therefore, the present invention can provide a new target and a dual inhibition method for the treatment of gastric cancer, and can also provide a new idea for the development of anti-tumor drugs.
[0012] Preferably, the gastric cancer samples are classified into intestinal type and diffuse type according to the pathological Lauren classification;
[0013] Preferably, the Schwann cells are rat Schwann cell line RSC96, and the gastric cancer cell lines are human gastric adenocarcinoma cell line AGS and human undifferentiated gastric cancer cell line HGC;
[0014] Preferably, in step (1), the CO2 concentration in the incubator is 5%, the culture temperature is 37°C, the complete cell culture medium is DMEM containing 10% Fetal Bovine Serum (FBS) and 1% Penicillin-Streptomycin (PS), the basal culture medium is DMEM containing 2% FBS and 1% PS, and the Schwann cell conditioned medium is Schwann cell supernatant containing 2% FBS and 1% PS.
[0015] Therefore, the present invention has the following beneficial effects:
[0016] (1) It affects gastric cancer cells by inhibiting the secretion of VEGFA by Schwann cells. The treatment conditions are mild and the time required is short.
[0017] (2) Easy to operate, with high success rate and good effect;
[0018] (3) It not only provides a new target for the treatment of gastric cancer, but also provides new ideas for the development of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The following are the classification and specific types of Schwann cells in gastric cancer tissue sections of different malignant degrees.
[0020] Figure A is a representative image of immunohistochemistry of Schwann cell markers S100, ALDH1L1, and GFAP, and Figures B and C are representative images of co-staining immunofluorescence of Schwann cell marker S100 and non-myelinating Schwann cell markers GFAP and NCAM.
[0021] Figure 2The effect of Schwann cell conditioned medium on the proliferation of gastric cancer cells. Figures A and B are statistical graphs of cell proliferation detected by CCK8 reagent (classic cell proliferation detection reagent) after AGS and HGC cells were treated with basal medium or Schwann conditioned medium for 0 and 24 hours, respectively (n≥3); Figures C and D are statistical graphs of cell colony proliferation detected after AGS and HGC cells were treated with basal medium or Schwann conditioned medium for 7 days; Figure E is the statistical result of the number of cell clones in Figure G (n≥3); Figures F and H are cell immunofluorescence staining of PH3 (cell proliferation marker) after 24 hours of treatment with basal medium or Schwann conditioned medium; Figures G and I are statistical results of the proportion of PH3-positive cells in Figures F and H, respectively (n≥3). Data are mean ± standard error, *p<0.05, **P<0.01.
[0022] Figure 3 The effect of Schwann cell conditioned medium on gastric cancer cell migration. Figure A shows the transwell assay for cell migration after AGS and HGC cells were treated with basal medium or Schwann conditioned medium for 0 and 24 hours, respectively; Figures B and C are the statistical results of the relative fold change of AGS cells migrating in Figure A (n≥3); Figure D shows the scratch assay for cell migration after AGS and HGC cells were treated with basal medium or Schwann conditioned medium for 0 and 24 hours, respectively; Figures E and F are the statistical results of the scratch healing ratio in Figure D (n≥3). Data are mean ± standard error, **P<0.01.
[0023] Figure 4 The results of VEGFA release by Schwann cells are shown in Figures A, B, and C. Figures A, B, and C are the detection of cytokine release in Schwann cell conditioned culture system by rat cytokine antibody array (n≥3); Figure D is a typical diagram of the changes in VEGFA expression levels in the secretory supernatant of rat Schwann cells RSC96 and mouse primary Schwann cells detected by Western Blot; Figures E and F are the statistical results of Western Blot in Figure D (n≥3); Figure G is a representative immunofluorescence diagram of Schwann cell marker S100 and VEGFA co-stained in gastric cancer tissue. Data are mean ± standard error, *p<0.05, **p<0.01.
[0024] Figure 5Effect of VEGFA released by Schwann cells on the proliferation and migration of gastric cancer cells. Among them: Figures A and B are representative images and statistical graphs of colony proliferation of gastric cancer cells treated with control, Schwann cell conditioned medium, anti-VEGFA (neutralizing the effect of VEGFA) and Schwann cell conditioned medium + anti-VEGFA for 7 days (n≥3); Figure C is a statistical graph of gastric cancer cell viability measured by CCK 8 assay with control, SCM, anti-VEGFA and SCM + anti-VEGFA (n≥3); Figures D and E are representative images and statistical graphs of AGS cells treated with control, Schwann cell conditioned medium, anti-VEGFA and Schwann cell conditioned medium + anti-VEGFA for 24 hours in transwell migration assay (n≥3); Figures F and G are representative images and quantitative analysis of AGS cells treated with control, Schwann cell conditioned medium, anti-VEGFA and Schwann cell conditioned medium + anti-VEGFA in scratch assay (n≥3); Figures H and I are Western blotting to verify VEGFA knockdown in Schwann cells with shVEGFA Typical images and quantitative analysis of Blot (n≥3); Figure J is CCK 8 assay of AGS cells treated with basal medium, Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium for 0 and 24 hours (n≥3); Figures K and L are representative images and statistical graphs of PH 3 immunostaining in AGS cells treated with basal medium, Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium for 24 hours (n≥3); Figures M and N are typical images and statistical graphs of AGS cells treated with basal medium, Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium in the scratch assay (n≥3); Figure OP is a typical image and statistical graph of AGS cells treated with basal medium, Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium for 24 hours in the transwell migration assay (n≥3). Data are mean ± SEM. *P<0.05, **P<0.01.
[0025] Figure 6Figure 1 shows the effect of VEGFA released by Schwann cells on the proliferation and migration of gastric cancer cells by promoting VEGFR2 and EGFR in gastric cancer cells. Figures A and B are typical images and quantitative analysis of Western Blot for the verification of VEGFR2 knockdown in shVEGFR2 Schwann cells (n≥3); Figure C is the CCK 8 assay of control or shVEGFR2 AGS cells treated with basal medium for 24 hours (n≥3); Figures D and E are typical images and statistical graphs of control or shVEGFR2 AGS cells treated with basal medium for 24 hours in the scratch migration assay (n≥3); Figures F and G are typical images and statistical graphs of control or shVEGFR2 AGS cells treated with basal medium in the transwell experiment (n≥3); Figures H and I are representative images and statistical graphs of colony proliferation of gastric cancer cells treated with control, Schwann cell conditioned medium, anti-EGFR (neutralizing EGFR effect) and Schwann cell conditioned medium + anti-EGFR for 7 days (n≥3); Figure J is the CCK 8 assay of control or shVEGFR2 AGS cells treated with basal medium for 24 hours in the scratch migration assay (n≥3); Figures F and G are typical images and statistical graphs of control or shVEGFR2 AGS cells treated with basal medium in the transwell experiment (n≥3); Figures H and I are representative images and statistical graphs of colony proliferation of gastric cancer cells treated with control, Schwann cell conditioned medium, anti-EGFR (neutralizing EGFR effect) and Schwann cell conditioned medium + anti-EGFR for 7 days (n≥3); Figure J is the CCK Statistical graphs showing the viability of gastric cancer cells treated with control, Schwann cell conditioned medium, anti-EGFR, and Schwann cell conditioned medium + anti-EGFR as determined by 8 assays; Figures K and M are representative graphs and statistical graphs of AGS cells treated with control, Schwann cell conditioned medium, anti-EGFR, and Schwann cell conditioned medium + anti-EGFR for 24 hours in a transwell migration assay (n≥3), respectively; Figures L and N are representative graphs and statistical graphs of AGS cells treated with control, Schwann cell conditioned medium, anti-EGFR, and Schwann cell conditioned medium + anti-EGFR in a scratch assay (n≥3), respectively. DETAILED DESCRIPTION
[0026] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments of the specification. The following description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those familiar with the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without having to go through creative work. Therefore, the present invention is not limited to the following embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.
[0027] Example 1: Classification and specific types of Schwann cells in gastric cancer tissue sections of different malignancy
[0028] In order to detect whether Schwann cells are distributed in gastric cancer tissues and their clinical relevance, immunohistochemistry and immunofluorescence experiments were used to detect the abundance of Schwann cells in intestinal and diffuse gastric cancers. The specific operations are as follows:
[0029] 1) Immunohistochemistry to detect the distribution of Schwann cells in gastric cancer tissues: After paraffin sections were dewaxed with xylene and gradient alcohol, antigen retrieval procedures were performed in 10 mM sodium citrate buffer (pH 6.0) using a water bath for 30 min. After permeabilization with 0.3% Triton X-100 in PBS containing 5% bovine serum albumin (BSA) at room temperature for 1 h, the sections were incubated with primary antibodies for Schwann cell markers S100, GFAP, and ALDH1L1 prepared in 5% BSA at 4°C overnight. The REAL EnVision detection kit (HRP-linked, Dako) was used to visualize the location of the antigen, and the cell nuclei were counterstained with hematoxylin and then dehydrated and mounted. The distribution of Schwann cells was photographed and analyzed using an Olympus VS200.
[0030] 2) Immunofluorescence co-staining experiment to detect the types of Schwann cells distributed in gastric cancer tissues: After dewaxing, antigen retrieval, blocking, and permeabilization, the sections were incubated with primary antibodies for Schwann cell marker S100 and non-myelinating Schwann cell markers GFAP and NCAM at 4°C overnight, washed three times in PBS, and then incubated with secondary antibodies at room temperature for 1 hour. After washing three more times in PBS, they were mounted and images were acquired using a fluorescence microscope (Olympus VS200).
[0031] like Figure 1 The results showed that non-myelinating Schwann cells were widely distributed in human gastric cancer samples, and their number tended to increase with increasing malignancy.
[0032] Example 2: Effect of Schwann cells on gastric cancer cell proliferation
[0033] In order to detect whether Schwann cells have an effect on gastric cancer proliferation, CCK8, clone formation, and PH3 immunofluorescence staining were used to detect the effect of Schwann cell conditioned medium on gastric cancer migration. The specific operation is as follows:
[0034] 1) CCK8 experiment to determine the effect of Schwann cell conditioned medium on the viability of AGS and HGC cells: AGS and HGC cells were grown in a culture medium environment of DMEM, 10% FBS and double antibodies, and digested with trypsin when the density reached the appropriate density. The cells were resuspended in the culture medium and counted using a hemacytometer. The cells were plated in 96-well plates with 3000 cells per well. After the cells adhered for 24 hours, the basal medium or Schwann cell conditioned medium was replaced with 100 μl per well, and CCK8 was used to determine the cell viability at 0h and 24h after the addition of the drug. 10 μl of CCK8 was added to each well, and the plate was read at 450nm after two hours of reaction. Five replicate wells were set at each time point at each concentration, and the experiment was repeated 3 times. The growth curve was calculated based on the results and statistical analysis was performed. The results showed that Schwann cells promoted the cell viability of the two gastric cancer cell lines at 24h.
[0035] 2) Clone formation experiment to detect the effect of Schwann cell conditioned medium on the proliferation of gastric cancer: cell suspension (500 cells / well) was inoculated in a 6-well plate, basal medium or Schwann cell conditioned medium was added, and the plates were cultured in an incubator for 7 days (37°C, 5% CO2), fixed with PFA, stained with crystal violet, photographed, and counted.
[0036] 3) PH3 immunofluorescence staining to detect the effect of Schwann cell conditioned medium on gastric cancer proliferation: AGS and HGC cells were evenly spread on sterile and poly-lysine-coated cell slides at an appropriate density, and cell suspension (10,000 cells / well) was inoculated. After the cells adhered to the wall for 24 hours, basal medium or Schwann cell conditioned medium was added for 24 hours, fixed with 4% PFA for 15 minutes, and then washed with PBS 3 times, each time for 5 minutes. After permeabilization with 0.1% Triton X100 and blocking with 5% BSA, the primary antibody PH3 diluted in 5% BSA was incubated at 4°C overnight, washed with 1xPBS, incubated with fluorescent secondary antibody, and stained with DAPI for nuclei. The images were taken with Olympus VS200, and the ratio of PH3 positive signal cells to nuclear positive cells was counted. The experiment was repeated three times, and the proliferation of gastric cancer cells was statistically analyzed;
[0037] like Figure 2 As shown, through CCK8 experiment, cell cloning experiment and PH3 immunofluorescence, it can be found that Schwann cell conditioned medium can promote the proliferation of gastric cancer cells.
[0038] Example 3: Effect of Schwann cells on gastric cancer cell migration
[0039] In order to detect whether Schwann cells have an effect on gastric cancer migration, the effect of Schwann cell conditioned medium on gastric cancer migration was detected by scratch test and transwell. The specific operation is as follows:
[0040] 1) Scratch experiment: Use a 12-well plate, plate AGS and HGC cells at 150,000 cells per well, and use a 1mL pipette tip to evenly draw horizontal lines along the lid of the 6-well plate (upper and lower, left and right of the well center line) after the cells are fully grown. Try to make scratches perpendicular to the horizontal lines on the back. The pipette tip should be vertical and not tilted. After washing the fragmented cells with PBS, replace with basal culture medium or Schwann cell conditioned medium for culture, and take pictures of the scratch healing status at 0 and 24 hours. Repeat 3 wells for each control group and experimental group, and repeat the experiment 3 times. Use Image J to calculate the scratch healing rate and statistically analyze it;
[0041] 2) Transwell experiment: A transwell chamber adapted to a 24-well plate was used. Serum-free culture or serum-free Schwann cell conditioned medium (200 μl) was added to the upper chamber, containing 20,000 AGS or HGC cells, and 10% FBS was added to the lower chamber. After 24 hours, the cells were fixed with 4% PFA and stained with crystal violet. Three wells were repeated in each experimental group and control group. The experiment was repeated three times. The number of cells that passed through was counted and statistically analyzed.
[0042] like Figure 3 As shown, scratch assay and transwell assay showed that Schwann cell conditioned medium can promote the migration of gastric cancer cells.
[0043] Example 4: Effect of Schwann cell-released cytokine VEGFA on gastric cancer cell proliferation and migration
[0044] In order to detect what substances Schwann cells secrete to promote gastric cancer and its effects on gastric cancer cell proliferation and migration, cytokine antibody array, Western Blot and immunofluorescence staining were used to detect whether Schwann cells secrete, and anti-VEGFA or shRNA was used to inhibit VEGFA protein expression to detect the role of Schwann cells in secreting VEGFA. The specific operations are as follows:
[0045] 1) Schwann cell conditioned medium was analyzed using a rat cytokine antibody array (34 targets / ab 133992) (Abcam, Cambridge, MA). Each experiment was performed according to the manufacturer's instructions. Spot detection using chemiluminescence was acquired using a CCD camera. Array images were processed using Image J software;
[0046] 2) Western Blot was used to detect whether VEGFA in the supernatant of Schwann cells increased: After collecting the conditioned medium of RSC96 and primary Schwann cells, 5x protein loading buffer was added to prepare the sample, SDS-PAGE was run, PVDF membrane was transferred under 20% methanol conditions, 5% skim milk was blocked at room temperature for 1 hour, the membrane was cut according to the molecular weight, incubated with VEGFA primary antibody, incubated at 4°C overnight, washed with 1xTBST, incubated with HRP secondary antibody conjugated to the corresponding species, washed with 1x TBST, incubated with ECL luminescent solution, chemiluminescence signal was collected, the protein content was reflected according to the signal strength, and the grayscale of the bands was calculated using Image J, and the differences were statistically analyzed;
[0047] 3) Immunofluorescence detection of the correlation between Schwann cells and VEGFA on clinical sample tissue sections: After the sections were dewaxed, antigen retrieved, blocked, and permeabilized, they were incubated with Schwann cell marker S100 and VEGFA primary antibodies at 4°C overnight, washed with PBS, and incubated with secondary antibodies at room temperature for 1 hour. After washing three more times in PBS, they were mounted and images were acquired using a fluorescence microscope (Olympus VS200);
[0048] 4) Establishment of shVEGFA Schwann cells: Design and synthesize the corresponding VEGFA shRNA sequence according to the target gene sequence. Use restriction endonucleases EcoRI and AgeI to insert the VEGFA shRNA sequence into the PLKO.1 vector. When the cell density reaches 70% to 80%, 24 to 72 hours later, the successfully constructed recombinant expression vector is transferred into RSC96 cells using Lipofectamine 3000 transfection reagent and screened by Puro gradient until all cells emit fluorescence. The cell line that successfully knocked down the gene was used for subsequent experiments;
[0049] Sh VEGFA-1 GCGGATCAAACCTCACCAAAG Sh VEGFA-2 GCAGCTATTGCCGTCCAATTG
[0050] 5) Detect whether inhibition of Schwann cell secretion of VEGFA has an effect on gastric cancer proliferation: The effect of inhibition of Schwann cell secretion of VEGFA on AGS cell proliferation was determined by CCK8, clone formation, and PH3 immunofluorescence experiments: AGS cells were grown in a culture medium containing DMEM, 10% FBS, and double antibodies, and digested with trypsin when the density reached an appropriate density. After resuspending in the culture medium, the cells were counted using a hemocytometer and plated. After 24 hours of cell attachment, the cells were replaced with basal culture medium, Schwann cell conditioned medium, basal culture medium + anti-VEGFA, Schwann cell conditioned medium + anti-VEGFA, or basal culture medium, control Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium to culture gastric cancer cells, which were used for CCK8, clone formation, and PH3 immunofluorescence experiments, respectively;
[0051] 6) Detect whether inhibition of Schwann cell secretion of VEGFA has an effect on gastric cancer migration: The effect of inhibition of Schwann cell secretion of VEGFA on gastric cancer cell proliferation was determined by transwell and scratch experiments: AGS cells were grown in a culture medium containing DMEM, 10% FBS and double antibodies, and digested with trypsin, resuspended, counted, and plated when the cells reached an appropriate density. After 24 hours of cell attachment, the cells were replaced with basal medium, Schwann cell conditioned medium, basal medium + anti-VEGFA, Schwann cell conditioned medium + anti-VEGFA or basal medium, control Schwann cell conditioned medium, and shVEGFA Schwann cell conditioned medium to culture gastric cancer cells, which were used for transwell and scratch experiments, respectively;
[0052] like Figure 4 As shown in Figure 2, cytokine antibody array, Western Blot and immunofluorescence staining revealed that Schwann cells secreted increased VEGFA, which may be related to promoting the progression of gastric cancer; Figure 5 As shown, neutralizing the effect of VEGFA in Schwann cell conditioned medium by anti-VEGFA or inhibiting VEGFA in Schwann cells will inhibit the effect of Schwann cell conditioned medium in promoting the proliferation and migration of gastric cancer cells.
[0053] Example 5: Schwann cells release cytokine VEGFA to affect the proliferation and migration of gastric cancer cells by promoting VEGFR2 and EGFR
[0054] In order to detect the specific mechanism of Schwann cells secreting VEGFA to promote the proliferation and migration of gastric cancer cells, CCK8, clone formation, PH3 immunofluorescence, transwell, and scratch assays were used to detect the effects of inhibiting VEGFR2 or EGFR in gastric cancer cells in Schwann cell conditioned medium on promoting the proliferation and migration of AGS cells. The specific operations are as follows:
[0055] 1) Establishment of shVEGFR2 Schwann cells: Design shRNA: According to the target gene sequence, design and synthesize the corresponding VEGFR2 shRNA sequence. Use restriction endonucleases EcoRI and AgeI to insert the VEGFR2 shRNA sequence into the PLKO.1 vector. When the cell density reaches 70% to 80%, 24 to 72 hours later, the successfully constructed recombinant expression vector is transferred into AGS cells using Lipofectamine3000 transfection reagent and screened by Puro gradient until all cells emit fluorescence. The cell line that successfully knocked down the gene was used for subsequent experiments;
[0056] Sh-VEGFAR2-1 ACTGTGGTGATTCCATGTC Sh-VEGFAR2-2 ACTTGTAAACCGAGACCTA
[0057] 2) Detect whether the inhibition of Schwann cell secretion of VEGFA affects the progression of gastric cancer through gastric cancer cell VEGFR2: CCK8, clone formation, PH3 immunofluorescence experiments were used to determine the effect of knocking down gastric cancer cell VEGFR2 on Schwann cell conditioned medium to promote gastric cancer cell proliferation and migration: AGS cells were trypsinized, resuspended, counted, and plated when they reached an appropriate density. After 24 hours of cell attachment, the basal medium or Schwann cell conditioned medium was used to culture control or shVEGFR2 gastric cancer cells, which were used for CCK8, clone formation, PH3 immunofluorescence, transwell, and scratch experiments, respectively;
[0058] 6) Detect whether the inhibition of Schwann cell secretion of VEGFA affects the progression of gastric cancer through gastric cancer cell EGFR, and determine the effect of anti-EGFR neutralizing the gastric cancer cell EGFR on the Schwann cell conditioned medium promoting gastric cancer cell proliferation and migration through CCK8, clone formation, and PH3 immunofluorescence experiments: When AGS reaches an appropriate density, trypsin digestion, resuspending, counting, and plating. After 24 hours of cell attachment, the control or shVEGFR2 gastric cancer cells are cultured in basal medium or Schwann cell conditioned medium, and used for CCK8, clone formation, PH3 immunofluorescence, transwell, and scratch experiments, respectively;
[0059] like Figure 6 As shown, knocking down VEGFR2 in Schwann cells by shVEGFR2 inhibited the proliferation and migration of gastric cancer cells, or neutralizing the EGFR of gastric cancer cells by anti-EGFR inhibited the effect of Schwann cell conditioned medium in promoting the proliferation and migration of gastric cancer cells, indicating that targeting Schwann cell VEGFA can simultaneously inhibit gastric cancer EGFR and VEGFR2, thereby inhibiting the progression of gastric cancer.
[0060] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.
[0061] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiments based on the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention. In summary, the present invention discovered that Schwann cells promote the proliferation and migration of gastric cancer and its specific mechanism, providing a new possible target for the treatment of gastric cancer and providing new ideas for the treatment of gastric cancer.
Claims
1. The application of Schwann cells as targets in the preparation of drugs for the treatment of gastric cancer or in the research of treatment methods.
2. The use according to claim 1, characterized in that Schwann cells promote the growth of gastric cancer by releasing VEGFA.
3. The application of Schwann cells as targets in the preparation of drugs for the prevention and treatment of gastric cancer or in the research of treatment methods.
4. A drug or method for treating or preventing gastric cancer, characterized in that Including targeting Schwann cells.
5. A drug or method for treating or preventing gastric cancer according to claim 1, characterized in that The dosage form of the drug is any dosage form recognized medically.
6. A drug or method for treating or preventing gastric cancer according to claim 1, characterized in that Also included are pharmaceutically acceptable carriers.