Aspergillus niger, microbial inoculum, solid-state fermentation liquor, and preparation method and application of solid-state fermentation liquor

Abstract

The invention belongs to the field of microorganisms, and particularly relates to aspergillus niger, a microbial agent, solid-state fermentation liquor as well as a preparation method and application of the solid-state fermentation liquor. The Aspergillus niger is Aspergillus niger AGM01, the Aspergillus niger is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the Aspergillus niger is CCTCC NO: M2024768. The aspergillus niger AGM01 provided by the invention has relatively high enzyme activity of beta-glucosidase. The aspergillus niger AGM01 is subjected to fermentation culture through the solid-state fermentation culture medium containing the small molecule inducer to obtain the aspergillus niger solid-state fermentation liquid, and the enzyme activity of beta-glucosidase in the aspergillus niger solid-state fermentation liquid can be improved.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to an Aspergillus niger, a bacterial agent, a solid-state fermentation liquid, and a preparation method and application thereof. Background Art

[0002] With the continuous development of the bio-industry, more and more products are prepared by microbial fermentation. The carbon source in the microbial fermentation process, especially glucose, is an important energy source for microbial growth and metabolism, which also means that a large amount of glucose is consumed in the microbial fermentation process. At present, the glucose used in microbial fermentation mainly comes from starch hydrolyzate, which indicates that with the continuous development of the bio-industry, the demand for glucose will continue to increase, which may lead to an increase in demand for starch crops, which may lead to rising food prices or tight food supply.

[0003] Lignocellulose in agricultural waste and forestry waste is a potential source of glucose. Agricultural waste includes bagasse, straw, rice straw, fruit shells, etc.; forestry waste includes treetops, branches, tree crowns, wood chips, dead branches, etc. By hydrolyzing lignocellulose in agricultural waste and forestry waste into glucose, xylose, etc., it can not only reduce dependence on starch crops, but also realize the resource utilization of waste, which is environmentally friendly and economically sustainable. Therefore, the efficient production of lignocellulose hydrolyzate is an engineering problem that needs to be solved in the field of bioindustry.

[0004] After nearly 20 years of research and development of key enzymes in the hydrolysis process of lignocellulose, namely cellulase and β-glucosidase, the enzymatic activity of cellulase has met the needs of industrialization to a certain extent. However, the enzymatic activity of β-glucosidase cannot meet the needs of industrialization so far, and no major breakthrough has been made in the screening and cultivation of high-yield β-glucosidase strains. The enzymatic activity of β-glucosidase reported in the literature is not high, mostly below 20U / mL, especially the activity of cellobiase is even lower. Summary of the invention

[0005] The problem existing in the prior art is that in the prior art, corn cobs are usually used as the main carbon source to induce strains to produce β-glucosidase, and the strains are cultured by semi-solid fermentation. However, this method of the prior art often results in low enzyme activity of the produced β-glucosidase, which is difficult to meet the needs of industrial production.

[0006] In view of the problems existing in the above-mentioned prior art, the present invention provides an Aspergillus niger, a bacterial agent, a solid-state fermentation liquid and a preparation method and application thereof.

[0007] Specifically, the present invention provides the following technical solutions: In a first aspect, the present invention provides an Aspergillus niger, wherein the Aspergillus niger is Aspergillus niger ( Aspergillus niger )AGM01, which is deposited in China Center for Type Culture Collection (CCTCC) with the deposit number: CCTCC NO: M 2024768.

[0008] Preferably, the ITS gene sequence of Aspergillus niger AGM01 is shown as SEQ ID NO.3.

[0009] Preferably, the Aspergillus niger AGM01 has the property of producing β-glucosidase.

[0010] Preferably, the enzyme activity of the β-glucosidase of Aspergillus niger AGM01 is: 20-30U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per minute of enzymatic hydrolysis of cellobiose in each mL of crude enzyme solution of Aspergillus niger AGM01 is defined as one enzyme activity unit of β-glucosidase; The crude enzyme solution of Aspergillus niger AGM01 is prepared by the following method: amplifying and culturing Aspergillus niger to obtain an Aspergillus niger spore suspension, fermenting and culturing the Aspergillus niger spore suspension to obtain a fermentation liquid, and then performing solid-liquid separation to obtain a supernatant, namely the crude enzyme solution of Aspergillus niger AGM01.

[0011] Preferably, the fermentation culture time is 5-7 days.

[0012] In a second aspect, the present invention provides a fermentation preparation method of an Aspergillus niger agent, the fermentation preparation method comprising the following steps: (a) amplifying and culturing the Aspergillus niger according to any one of claims 1 to 5 to obtain an Aspergillus niger spore suspension; (b) fermenting the Aspergillus niger spore suspension obtained in step (a).

[0013] Preferably, in step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of claims 1 to 5.

[0014] Preferably, the culturing temperature in step (a) is 26-30°C; and / or the culturing temperature in step (b) is 26-32°C.

[0015] Preferably, the culturing time in step (a) is 24-48 hours.

[0016] In a third aspect, the present invention provides an Aspergillus niger agent comprising the Aspergillus niger according to any one of claims 1 to 5.

[0017] In a fourth aspect, the present invention provides an Aspergillus niger agent, which is prepared by the fermentation preparation method according to any one of claims 6 to 9.

[0018] In a fifth aspect, the present invention provides an Aspergillus niger solid-state fermentation broth, containing the Aspergillus niger described in any one of claims 1-5, wherein the enzyme activity of β-glucosidase in the Aspergillus niger solid-state fermentation broth is: 110-170U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per min of enzymatic hydrolysis of cellobiose in each mL of the Aspergillus niger solid-state fermentation broth is defined as one enzyme activity unit of β-glucosidase.

[0019] Preferably, the seed culture medium comprises, by weight: 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of iron sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate and 0.001-0.01 parts of cobalt chloride.

[0020] More preferably, the seed culture medium comprises: 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of iron sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.

[0021] Most preferably, the yeast extract powder is yeast extract powder F902.

[0022] Preferably, the seed culture medium also includes: water.

[0023] Preferably, the seed culture medium comprises: glucose at a concentration of 1-30 g / L, yeast extract at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, iron sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water.

[0024] More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or iron sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.

[0025] Preferably, the solid-state fermentation medium comprises 1-20 parts of small molecule inducers by weight, wherein the small molecule inducer is one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and substances containing sophoroside.

[0026] More preferably, the small molecule inducer is xylose.

[0027] More preferably, the substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.

[0028] Preferably, the solid-state fermentation medium further comprises: a substance containing lignocellulose, ammonium sulfate, urea and calcium chloride.

[0029] Preferably, the solid-state fermentation medium comprises, by weight: 30-90 parts of a substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of a small molecule inducer.

[0030] More preferably, the solid-state fermentation medium comprises, by weight: 30-75 parts of lignocellulose-containing substances, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of small molecule inducers.

[0031] Preferably, the material containing lignocellulose includes: one or more of bran, straw and corn cob.

[0032] Preferably, the material containing lignocellulose is a combination of bran, straw and corn cobs.

[0033] Preferably, in parts by weight, the material containing lignocellulose is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corn cobs.

[0034] Preferably, the material containing lignocellulose is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corn cobs, in parts by weight.

[0035] Preferably, the solid-state fermentation medium further comprises: water.

[0036] Preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-90 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, and a small molecule inducer at a concentration of 1-20 g / L, and the rest is water.

[0037] Preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-75 g / L, and / or an ammonium sulfate concentration of 6-20 g / L, and / or a urea concentration of 2-12 g / L, and / or a calcium chloride concentration of 0.5-2 g / L, and / or a small molecule inducer concentration of 1-18 g / L, and the rest is water.

[0038] Preferably, the solid-state fermentation medium further comprises: water.

[0039] Preferably, the solid-state fermentation medium comprises: bran at a concentration of 10-30 g / L, straw at a concentration of 10-30 g / L, corn cob at a concentration of 10-30 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L and a small molecule inducer at a concentration of 1-20 g / L, and the rest is water.

[0040] Preferably, the solid-state fermentation medium comprises: a bran concentration of 10-25 g / L, and / or a straw concentration of 10-25 g / L, and / or a corn cob concentration of 10-25 g / L, and / or an ammonium sulfate concentration of 5-25 g / L, and / or a urea concentration of 1-15 g / L, and / or a calcium chloride concentration of 0.5-3 g / L, and / or a small molecule inducer concentration of 1-20 g / L, and the rest is water.

[0041] In a sixth aspect, the present invention provides a method for preparing an Aspergillus niger solid-state fermentation liquid, comprising the following steps: amplifying and culturing the Aspergillus niger to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium for culturing to obtain an Aspergillus niger seed liquid; and inoculating the Aspergillus niger seed liquid into a solid-state fermentation medium for culturing to obtain an Aspergillus niger solid-state fermentation liquid.

[0042] Preferably, the preparation method comprises the following steps: (a) amplifying and culturing the Aspergillus niger according to any one of claims 1 to 5 to obtain an Aspergillus niger spore suspension; (b) inoculating the Aspergillus niger spore suspension obtained in step (a) into a seed culture medium for culturing to obtain an Aspergillus niger seed solution; (c) inoculating the Aspergillus niger seed liquid obtained in step (b) into a solid-state fermentation medium for culturing to obtain an Aspergillus niger solid-state fermentation product; (d) mixing, soaking, stirring and filtering the Aspergillus niger solid fermentation product obtained in step (c) with a buffer solution to obtain a crude enzyme solution; (e) Concentrating the crude enzyme solution obtained in step (d) to obtain a concentrated solution, namely, the Aspergillus niger solid-state fermentation solution.

[0043] More preferably, in step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of claims 1 to 5.

[0044] More preferably, the culturing temperature in step (a) is 26-30°C; and / or the culturing temperature in step (b) is 26-30°C; and / or the culturing temperature in step (c) is 27-29°C.

[0045] More preferably, the culturing time in step (a) is 24-48 h; and / or the culturing time in step (b) is 24-48 h; and / or the culturing time in step (c) is 100-144 h.

[0046] More preferably, the culture rotation speed in step (b) is 150-300 rpm.

[0047] More preferably, the culture pH in step (c) is 4.5-5.5.

[0048] More preferably, the culture humidity in step (c) is 50-95%.

[0049] More preferably, in step (d), the volume ratio of the mixture of the Aspergillus niger solid-state fermentation product and the buffer solution is (0.8-1.2):(6-10).

[0050] More preferably, the soaking time in step (d) is 1-4 hours.

[0051] More preferably, the stirring speed in step (d) is 100-300 rpm.

[0052] More preferably, the stirring time in step (d) is 20-50 min.

[0053] More preferably, the filtration in step (d) is plate and frame filtration.

[0054] More preferably, in step (e), the concentration is ultrafiltration concentration.

[0055] Most preferably, the membrane used for ultrafiltration concentration has a pore size of 10-60 kD.

[0056] Most preferably, the ultrafiltration concentration time is 1-5 h.

[0057] In a seventh aspect, the present invention provides a solid-state fermentation liquid of Aspergillus niger prepared by the preparation method.

[0058] In an eighth aspect, the present invention provides a lignocellulose hydrolyzate sugar solution obtained by hydrolyzing in a system containing the Aspergillus niger, or the Aspergillus niger fungus agent, or the Aspergillus niger solid fermentation liquid.

[0059] Preferably, the lignocellulose is one or a combination of agricultural waste and forestry waste.

[0060] More preferably, the agricultural waste is one or a combination of sugarcane bagasse and straw.

[0061] Preferably, the reducing sugar mass ratio contained in the lignocellulose hydrolyzed sugar solution is greater than 90%, wherein the reducing sugar mass ratio refers to the percentage of the mass m2 of the lignocellulose raw material converted into reducing sugars after enzymatic hydrolysis relative to the total mass m1 of cellulose and hemicellulose contained in the lignocellulose raw material before hydrolysis.

[0062] Preferably, the Aspergillus niger, or the Aspergillus niger agent, or the Aspergillus niger solid-state fermentation liquid is used in the preparation of lignocellulose hydrolyzed sugar liquid. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 Shown is the colony morphology of Aspergillus niger AGM01; Figure 2 Shown is the phylogenetic tree result of Aspergillus niger AGM01 constructed based on the ITS gene sequence.

[0064] Strain deposit information Aspergillus niger provided by the present invention ( Aspergillus niger )AGM01, deposited in the China Center for Type Culture Collection on April 24, 2024, with the deposit number: CCTCC NO: M 2024768, deposit address: Wuhan University, Wuhan, China, postal code: 430072; telephone: 027-68754052.

[0065] Beneficial effects of the present invention: (1) The Aspergillus niger AGM01 provided by the present invention has a high β-glucosidase activity.

[0066] (2) In the present invention, after fermenting Aspergillus niger AGM01 in a solid fermentation medium containing a small molecule inducer, the Aspergillus niger solid fermentation liquid obtained can improve the enzyme activity of β-glucosidase in the Aspergillus niger solid fermentation liquid. DETAILED DESCRIPTION

[0067] In order to better understand the above technical solution, the technical solution of the present invention is clearly and completely explained in conjunction with the specific implementation method below. It should be noted that the content in the specific implementation method is only a specific implementation and explanation of the technical solution of the present invention, and should not be understood as limiting the scope of protection of the present invention.

[0068] In the prior art, corn cobs are usually used as the main carbon source to induce strains to produce β-glucosidase, and the strains are cultured by semi-solid fermentation. However, this method of the prior art often results in low enzyme activity of the produced β-glucosidase, which is difficult to meet the needs of industrial production.

[0069] In order to solve the problems existing in the prior art, the present invention specifically provides the following technical solutions: (1) An Aspergillus niger, characterized in that the Aspergillus niger is Aspergillus niger ( Aspergillus niger )AGM01, which is deposited in China Center for Type Culture Collection (CCTCC) with the deposit number: CCTCC NO: M 2024768.

[0070] (2) The Aspergillus niger according to technical solution (1), characterized in that the ITS gene sequence of the Aspergillus niger AGM01 is shown in SEQ ID NO.3.

[0071] (3) The Aspergillus niger according to technical solution (1) or (2), characterized in that the Aspergillus niger AGM01 has the characteristic of producing β-glucosidase; preferably, the enzyme activity of the β-glucosidase of the Aspergillus niger AGM01 is: 20-30U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per minute of enzymatic hydrolysis of cellobiose in each mL of crude enzyme solution of Aspergillus niger AGM01 is defined as one enzyme activity unit of β-glucosidase; The crude enzyme solution of Aspergillus niger AGM01 is prepared by the following method: amplifying and culturing Aspergillus niger to obtain an Aspergillus niger spore suspension, fermenting and culturing the Aspergillus niger spore suspension, preferably fermenting and culturing for 5-7 days to obtain a fermentation liquid, and then performing solid-liquid separation to obtain a supernatant, i.e., the crude enzyme solution of Aspergillus niger AGM01.

[0072] (4) A fermentation preparation method of an Aspergillus niger fungus agent, characterized in that the fermentation preparation method comprises the following steps: (a) amplifying and culturing the Aspergillus niger described in any one of technical solutions (1) to (3) to obtain an Aspergillus niger spore suspension; (b) fermenting the Aspergillus niger spore suspension obtained in step (a).

[0073] (5) The fermentation preparation method according to technical solution (4) is characterized in that in step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of the technical solutions (1) to (3); Preferably, the culture temperature in step (a) is 26-30°C, and / or the culture time is 24-48h; and / or in step (b), the fermentation culture temperature is 26-32°C.

[0074] (6) A niger Aspergillus niger agent, characterized in that it contains the niger Aspergillus niger described in any one of technical solutions (1) to (3).

[0075] (7) The Aspergillus niger agent according to technical solution (6), characterized in that the Aspergillus niger agent is obtained by the fermentation preparation method described in technical solution (4) or (5).

[0076] (8) An Aspergillus niger solid-state fermentation broth, characterized in that it contains the Aspergillus niger described in any one of technical solutions (1) to (3), wherein the enzyme activity of β-glucosidase in the Aspergillus niger solid-state fermentation broth is: 110-170U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per minute by enzymatic hydrolysis of cellobiose in each mL of the Aspergillus niger solid-state fermentation broth is defined as one enzyme activity unit of β-glucosidase.

[0077] (9) The Aspergillus niger solid-state fermentation liquid according to technical solution (8) is characterized in that the Aspergillus niger solid-state fermentation liquid is prepared by a method comprising the following steps: amplifying and culturing the Aspergillus niger described in any one of technical solutions (1) to (3) to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium for culturing to obtain an Aspergillus niger seed liquid; and inoculating the Aspergillus niger seed liquid into a solid-state fermentation culture medium for culturing to obtain an Aspergillus niger solid-state fermentation liquid.

[0078] (10) The Aspergillus niger solid-state fermentation broth according to technical solution (8) or (9), characterized in that, in parts by weight, the seed culture medium comprises: 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of iron sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate and 0.001-0.01 parts of cobalt chloride; Preferably, the seed culture medium comprises: 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of iron sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.

[0079] (11) The Aspergillus niger solid-state fermentation liquid according to any one of technical solutions (8) to (10), characterized in that the seed culture medium further comprises: water, Preferably, the seed culture medium comprises: glucose at a concentration of 1-30 g / L, yeast extract at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, iron sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water; More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or iron sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.

[0080] (12) The Aspergillus niger solid-state fermentation broth according to any one of technical solutions (8) to (11), characterized in that the yeast extract is yeast extract F902.

[0081] (13) The Aspergillus niger solid-state fermentation broth according to any one of technical solutions (8) to (12), characterized in that, in parts by weight, the solid-state fermentation medium comprises 1-20 parts of a small molecule inducer, wherein the small molecule inducer is one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and a substance containing sophoroside; Preferably, the small molecule inducer is xylose; Preferably, the substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.

[0082] (14) The Aspergillus niger solid-state fermentation liquid according to any one of technical solutions (8) to (13), characterized in that the solid-state fermentation medium further comprises: a substance containing lignocellulose, ammonium sulfate, urea and calcium chloride; Preferably, the solid-state fermentation medium comprises, by weight: 30-90 parts of a substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of a small molecule inducer; More preferably, the solid-state fermentation medium comprises, by weight: 30-75 parts of lignocellulose-containing substances, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of small molecule inducers.

[0083] (15) The Aspergillus niger solid-state fermentation liquid according to any one of technical solutions (8) to (14), characterized in that the material containing lignocellulose comprises: one or more of bran, straw and corn cob, Preferably, the material containing lignocellulose is a combination of bran, straw and corn cob; More preferably, the lignocellulose-containing material is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corn cobs in parts by weight; Most preferably, the material containing lignocellulose is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corn cobs, by weight.

[0084] (16) The Aspergillus niger solid-state fermentation liquid according to any one of technical solutions (8) to (15), characterized in that the solid-state fermentation medium further comprises: water, Preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-90 g / L, an ammonium sulfate concentration of 5-25 g / L, a urea concentration of 1-15 g / L, a calcium chloride concentration of 0.5-3 g / L, a small molecule inducer concentration of 1-20 g / L, and the rest is water; More preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-75 g / L, ammonium sulfate at a concentration of 6-20 g / L, urea at a concentration of 2-12 g / L, calcium chloride at a concentration of 0.5-2 g / L and a small molecule inducer at a concentration of 1-18 g / L, and the rest is water.

[0085] (17) The Aspergillus niger solid-state fermentation liquid according to any one of technical solutions (8) to (16), characterized in that the solid-state fermentation medium further comprises: water, Preferably, the solid-state fermentation medium comprises: a bran concentration of 10-30 g / L, a straw concentration of 10-30 g / L, a corn cob concentration of 10-30 g / L, an ammonium sulfate concentration of 5-25 g / L, a urea concentration of 1-15 g / L, a calcium chloride concentration of 0.5-3 g / L, a small molecule inducer concentration of 1-20 g / L, and the rest is water; More preferably, the solid-state fermentation medium comprises: a bran concentration of 10-25 g / L, and / or a straw concentration of 10-25 g / L, and / or a corn cob concentration of 10-25 g / L, and / or an ammonium sulfate concentration of 5-25 g / L, and / or a urea concentration of 1-15 g / L, and / or a calcium chloride concentration of 0.5-3 g / L, and / or a small molecule inducer concentration of 1-20 g / L, and the rest is water.

[0086] (18) A method for preparing the solid-state fermentation liquid of Aspergillus niger according to any one of technical solutions (8) to (17), characterized in that it comprises the following steps: amplifying and culturing the Aspergillus niger according to any one of technical solutions (1) to (3) to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium for culturing to obtain an Aspergillus niger seed liquid; and inoculating the Aspergillus niger seed liquid into a solid-state fermentation culture medium for culturing to obtain an Aspergillus niger solid-state fermentation liquid.

[0087] (19) The preparation method according to technical solution (18) is characterized in that it comprises the following steps: (a) amplifying and culturing the Aspergillus niger according to any one of the technical solutions (1) to (3) to obtain an Aspergillus niger spore suspension, preferably, each mL of the Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of the technical solutions (1) to (3), (b) inoculating the Aspergillus niger spore suspension obtained in step (a) into a seed culture medium for culturing to obtain an Aspergillus niger seed solution; (c) inoculating the Aspergillus niger seed liquid obtained in step (b) into a solid-state fermentation medium for culturing to obtain an Aspergillus niger solid-state fermentation product; (d) mixing, soaking, stirring and filtering the Aspergillus niger solid fermentation product obtained in step (c) with a buffer solution to obtain a crude enzyme solution; (e) Concentrating the crude enzyme solution obtained in step (d) to obtain a concentrated solution, namely, the Aspergillus niger solid-state fermentation solution.

[0088] (20) The preparation method according to technical solution (18) or (19), characterized in that in step (a), the amplification culture temperature is 26-30°C, and / or the amplification culture time is 24-48h; And / or in step (b), the culture temperature is 26-30°C, and / or the culture speed is 150-300 rpm, and / or the culture time is 24-48 h; And / or in step (c), the culture temperature is 27-29° C., and / or the culture pH is 4.5-5.5, and / or the culture humidity is 50-95%, and / or the culture time is 100-144 h.

[0089] (21) The preparation method according to any one of technical solutions (18) to (20), characterized in that in step (d), the volume ratio of the mixture of the Aspergillus niger solid fermentation product and the buffer solution is (0.8-1.2): (6-10); and / or soaking time is 1-4h; and / or the stirring speed is: 100-300rpm; and / or the stirring time is: 20-50min; And / or the filtration is plate and frame filtration.

[0090] (22) The preparation method according to any one of technical solutions (18) to (21), characterized in that in step (e), the concentration is ultrafiltration concentration; preferably, the ultrafiltration concentration membrane has a pore size of 10-60 kD, and / or the ultrafiltration concentration time is 1-5 h.

[0091] (23) A lignocellulose hydrolyzate, characterized in that it is obtained by hydrolysis in a system containing the Aspergillus niger described in any one of technical solutions (1) to (3), the Aspergillus niger fungus agent described in technical solutions (6) or (7), the Aspergillus niger solid fermentation liquid described in any one of technical solutions (8) to (17), or the Aspergillus niger solid fermentation liquid prepared by the preparation method described in any one of technical solutions (18) to (22); Preferably, the reducing sugar mass ratio contained in the lignocellulose hydrolyzed sugar solution is greater than 90%, wherein the reducing sugar mass ratio refers to the percentage of the mass m2 of the lignocellulose raw material converted into reducing sugars after enzymatic hydrolysis relative to the total mass m1 of cellulose and hemicellulose contained in the lignocellulose raw material before hydrolysis.

[0092] (24) Use of the Aspergillus niger described in any one of technical solutions (1) to (3), the Aspergillus niger fungal agent described in technical solution (6) or (7), the Aspergillus niger solid-state fermentation liquid described in any one of technical solutions (8) to (17), or the Aspergillus niger solid-state fermentation liquid prepared by the preparation method described in any one of technical solutions (18) to (22) in the preparation of lignocellulose hydrolyzate sugar liquid.

[0093] (25) The lignocellulose hydrolyzate according to technical solution (23) or the use according to technical solution (24), characterized in that the lignocellulose is one or a combination of agricultural waste and forestry waste; preferably, the agricultural waste is one or a combination of sugarcane bagasse and straw.

[0094] (26) A seed culture medium, characterized in that, in parts by weight, the seed culture medium comprises: 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of iron sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate and 0.001-0.01 parts of cobalt chloride.

[0095] (27) A solid-state fermentation medium, characterized in that, in parts by weight, the solid-state fermentation medium comprises 1-20 parts of a small molecule inducer, wherein the small molecule inducer is one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and a substance containing sophoroside.

[0096] In order to solve the above technical problems, the present invention also provides a first set of technical solutions for the culture medium: 1.1. A seed culture medium, characterized in that, in parts by weight, the seed culture medium comprises: 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of iron sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate and 0.001-0.01 parts of cobalt chloride; Preferably, the seed culture medium comprises: 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of iron sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride. 1.2. The seed culture medium according to technical solution 1.1 is characterized in that the seed culture medium further comprises: water, Preferably, the seed culture medium comprises: glucose at a concentration of 1-30 g / L, yeast extract at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, iron sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water; More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or iron sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.

[0097] 1.3. The seed culture medium according to technical solution 1.1 or 1.2 is characterized in that the yeast extract powder is yeast extract powder F902.

[0098] 1.4 The method for preparing the seed culture medium described in any one of technical solutions 1.1-1.3 is characterized in that it is prepared by a method comprising the following steps: mixing glucose, yeast extract powder, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, iron sulfate, manganese sulfate, zinc sulfate and cobalt chloride to obtain a seed culture medium.

[0099] 1.5. The preparation method according to technical solution 1.4 is characterized in that it is prepared by a method comprising the following steps: mixing glucose, yeast extract, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, iron sulfate, manganese sulfate, zinc sulfate, cobalt chloride and water to obtain a seed culture medium.

[0100] 1.6. The seed culture medium described in any one of technical solutions 1.1-1.3 or the seed culture medium prepared by the preparation method described in technical solution 1.4 or 1.5 is characterized in that the seed culture medium is used to culture fungi to obtain fungal seed liquid; preferably, the fungus is Aspergillus niger; more preferably, the Aspergillus niger is Aspergillus niger AGM01, with the deposit number: CCTCCNO: M 2024768.

[0101] In order to solve the above technical problems, the present invention also provides a second set of technical solutions for the culture medium: 2.1. A solid-state fermentation medium, characterized in that, in parts by weight, the solid-state fermentation medium comprises 1-20 parts of a small molecule inducer, wherein the small molecule inducer is one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and a substance containing sophoroside; Preferably, the small molecule inducer is xylose; Preferably, the substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.

[0102] 2.2. The solid-state fermentation medium according to technical solution 2.1, characterized in that the solid-state fermentation medium further comprises: a substance containing lignocellulose, ammonium sulfate, urea and calcium chloride; Preferably, the solid-state fermentation medium comprises, by weight: 30-90 parts of a substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of a small molecule inducer; More preferably, the solid-state fermentation medium comprises, by weight: 30-75 parts of lignocellulose-containing substances, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of small molecule inducers.

[0103] 2.3. The solid-state fermentation medium according to technical solution 2.1 or 2.2, characterized in that the material containing lignocellulose comprises: one or more of bran, straw and corn cob, Preferably, the material containing lignocellulose is a combination of bran, straw and corn cob; More preferably, the lignocellulose-containing material is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corn cobs in parts by weight; Most preferably, the material containing lignocellulose is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corn cobs, by weight. 2.4. The solid-state fermentation medium according to any one of technical solutions 2.1-2.3, characterized in that the solid-state fermentation medium further comprises: water, Preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-90 g / L, an ammonium sulfate concentration of 5-25 g / L, a urea concentration of 1-15 g / L, a calcium chloride concentration of 0.5-3 g / L, a small molecule inducer concentration of 1-20 g / L, and the rest is water; More preferably, the solid-state fermentation medium comprises: a lignocellulose-containing substance at a concentration of 30-75 g / L, and / or an ammonium sulfate concentration of 6-20 g / L, and / or a urea concentration of 2-12 g / L, and / or a calcium chloride concentration of 0.5-2 g / L, and / or a small molecule inducer concentration of 1-18 g / L, and the rest is water.

[0104] 2.5. The solid-state fermentation medium according to any one of technical solutions 2.1-2.4, characterized in that the solid-state fermentation medium comprises: a bran concentration of 10-30 g / L, a straw concentration of 10-30 g / L, a corn cob concentration of 10-30 g / L, an ammonium sulfate concentration of 5-25 g / L, a urea concentration of 1-15 g / L, a calcium chloride concentration of 0.5-3 g / L, and a small molecule inducer concentration of 1-20 g / L, and the rest is water; Preferably, the solid-state fermentation medium comprises: a bran concentration of 10-25 g / L, and / or a straw concentration of 10-25 g / L, and / or a corn cob concentration of 10-25 g / L, and / or an ammonium sulfate concentration of 5-25 g / L, and / or a urea concentration of 1-15 g / L, and / or a calcium chloride concentration of 0.5-3 g / L, and / or a small molecule inducer concentration of 1-20 g / L, and the rest is water.

[0105] 2.6. The method for preparing a solid-state fermentation medium described in any one of technical solutions 2.1-2.5 is characterized in that it includes: mixing a substance containing lignocellulose, ammonium sulfate, urea, calcium chloride and a small molecule inducer to obtain a solid-state fermentation medium.

[0106] 2.7. The method for preparing a solid-state fermentation medium according to technical solution 2.6 is characterized in that it includes: mixing a substance containing lignocellulose, ammonium sulfate, urea, calcium chloride, a small molecule inducer and water to obtain a solid-state fermentation medium.

[0107] 2.8. The solid-state fermentation medium described in any one of technical solutions 2.1-2.5 or the solid-state fermentation medium prepared by the preparation method described in technical solution 2.6 or 2.7 is characterized in that the solid-state fermentation medium is used to cultivate fungi to obtain fungal solid-state fermentation liquid. Preferably, the fungus is Aspergillus niger; more preferably, the Aspergillus niger is Aspergillus niger AGM01, with the preservation number: CCTCC NO: M 2024768.

[0108] Aspergillus niger provided by the present invention ( Aspergillus niger)AGM01, deposited in the China Center for Type Culture Collection on April 24, 2024, with the deposit number: CCTCC NO: M 2024768, deposit address: Wuhan University, Wuhan, China, postal code: 430072; telephone: 027-68754052.

[0109] In order to better understand the technical solution of the present invention, the technical solution of the present invention is described in detail below in conjunction with specific embodiments.

[0110] The preparation of the culture medium and reagents involved in the examples is as follows: 1. Aesculin solid culture medium (g / L): Mix 1 g aesculin, 2.5 g ammonium ferric citrate, 2.8 g ammonium sulfate, 4.0 g potassium dihydrogen phosphate, 0.9 g magnesium sulfate heptahydrate, 0.9 g calcium chloride dihydrate, 40 g corncob juice, 20 g agar and sterile water, make up to 1 L with sterile water, and sterilize at 115°C for 30 min to obtain aesculin solid culture medium.

[0111] 2. The preparation method of PDA solid culture medium is as follows: (1) Cut 200 g of potatoes into small pieces, mix with 1 L of water, heat to boiling and maintain for 20-30 min, filter with 2 layers of gauze while hot and retain the filtrate, mix the filtrate with water to obtain 1 L of mixed solution.

[0112] (2) Mix 1 L of the mixed solution obtained in step (1), 20 g of glucose, and 15-20 g of agar (crushed in advance), and heat. After the agar is completely dissolved, add water to 1 L to complete the preparation of the PDA solid culture medium.

[0113] 3. 10 mmol / L cellobiose solution: Mix 3.42 g of cellobiose with distilled water and dilute to 1 L with distilled water to obtain a 10 mmol / L cellobiose solution.

[0114] 4. 5.55 mmol / L glucose standard solution: Mix 0.999 g of glucose with distilled water and dilute to 1 L with distilled water to obtain 5.55 mmol / L cellobiose solution.

[0115] Unless otherwise specified, the various reagents / instruments used in the examples of the present invention are conventional commercially available products. The sources of the experimental reagents used in the present invention are shown in Table 1 below, and the sources of the experimental instruments used in the present invention are shown in Table 2 below: Example 1 Isolation and Identification of Strain 10 g of soil containing Jilin chicken and goose feces collected in Zuojia Town, Changyi District, Jilin City, Jilin Province was dissolved in 50 mL of sterile water to obtain a mixed solution, and the mixed solution was gradient diluted, and then the gradient concentration was 10 -2 and 10 -3 The mixture was spread on a plate of aesculin solid culture medium, and after incubation at 28°C for 36 hours, a single colony with obvious black color on the plate was selected as the dominant strain. The texture of the single colony of the dominant strain was as follows: Figure 1 As shown. Then, the single colony is purified once according to the purification method, wherein the purification method is: pick the single colony and culture it in PDA liquid culture medium at 28°C and 250rpm for 36 hours to obtain a first purified spore suspension, then divide the purified spore suspension into sections and streak it on a plate of aesculin solid culture medium and culture it at 29°C for 24 hours, pick the single colony and perform secondary purification according to the above purification method to obtain a secondary purified spore suspension, inoculate the secondary purified spore suspension on PDA solid culture medium and culture it at 28°C for 24 hours, and observe the colony morphology.

[0116] A strain was obtained, the colony of which was dark brown, and the conidia were spherical, black or dark brown, smooth or rough. ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ (SEQ ID NO.1), ITS4: 5′-TCCTCCGCTTATTGATATGC-3′ (SEQ ID NO.2 ) was used as a primer to extract the genome sequence of the bacteria, and was used to amplify the gene sequence. After 1% gel electrophoresis detection and sequencing, the sequence was compared with the sequence on GenBank by Blast analysis. The sequence similarity was greater than 99% and was the same species. The ITS gene sequence of the strain was measured as shown in SEQ ID NO.3. The PCR reaction system is shown in Table 3 below, and the PCR reaction procedure is shown in Table 4 below: SEQ ID NO.3: TCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGA ACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCA GAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGGTCGCCGTCCCCCTCT CCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTCTTTCCAGGT Based on the ITS gene sequence shown in SEQ ID NO.3, a phylogenetic tree was constructed using MEGA11.0. Figure 2 As shown, from Figure 2 It can be seen from the phylogenetic tree that the strain is most closely related to Aspergillus niger. At the same time, further morphological analysis and molecular identification confirmed that the strain is Aspergillus niger ( Aspergillus niger )AGM01, which was deposited in the China Center for Type Culture Collection on April 24, 2024, with the deposit number: CCTCC NO: M2024768. Figure 2 Shown is the phylogenetic tree result constructed for Aspergillus niger AGM01 based on the ITS gene sequence.

[0117] Example 2 Ability of Aspergillus niger AGM01 to produce β-glucosidase and protein (1) Preparation of crude enzyme solution of Aspergillus niger AGM01: Take 1 mL of the secondary purified spore suspension and dilute to 10 -2 , 10 -3 , using a blood cell counting plate and a microscope at 40×10 magnification to observe and count. 7The spore suspension of Aspergillus niger AGM01 spores was inoculated into a shaking flask and fermented at 28°C and 200rpm to obtain a fermentation liquid. The fermentation liquid cultured to the 7th day was centrifuged at 8000rpm for 10 min to retain the supernatant, i.e., the crude enzyme liquid of Aspergillus niger AGM01.

[0118] (2) Determination of the enzyme activity of β-glucosidase in the crude enzyme solution of Aspergillus niger AGM01 using cellobiose as substrate: It should be noted that, with cellobiose as a substrate, β-glucosidase and cellobiose react to generate two molecules of glucose, which are then acted upon by glucose oxidase to generate gluconic acid and hydrogen peroxide, and hydrogen peroxide, under the action of peroxidase, couples and condenses the reduced 4-aminoantipyrine with phenol to form quinone compounds that can be measured by a spectrophotometer.

[0119] (2.1) Determine the absorbance value of the crude enzyme solution of Aspergillus niger AGM01 at a wavelength of 505 nm: The crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was centrifuged at 10000 rpm for 5 min, 100 mL of the supernatant was added to 100 mL of 10 mmol / L cellobiose solution, and maintained for 10 min under the condition of heating in a water bath at 60°C to obtain a reaction system. Then, 2.5 mL of the reaction system was mixed with 250 mL of the reagent in the glucose determination kit and incubated at 37°C for 10 min. The absorbance value was determined at a wavelength of 505 nm to obtain the absorbance value of the crude enzyme solution of Aspergillus niger AGM01 at a wavelength of 505 nm.

[0120] (2.2) Determine the absorbance of the crude enzyme solution of Asperillium niger Q270-C6 at a wavelength of 505 nm: The determination method is the same as step (2.1), wherein the Asperillium niger Q270-C6 has been disclosed in the Chinese patent application with patent number CN117143739A, and the preservation number of the strain is: CCTCCNO: M20231261.

[0121] (2.3) Blank group: The absorbance value of the crude enzyme solution of Aspergillus niger AGM01 after inactivation was measured at a wavelength of 505 nm. The specific process is as follows: the crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was centrifuged at 10000 rpm for 5 min, 100 mL of the supernatant was added to 100 mL of 10 mmol / L cellobiose solution, and inactivated at a temperature of 80°C for 30 min to obtain a reaction system. Then, 2.5 mL of the reaction system was mixed with 250 mL of the reagent in the glucose determination kit and incubated at 37°C for 10 min. The absorbance value was measured at a wavelength of 505 nm to obtain the absorbance value of the crude enzyme solution of Aspergillus niger AGM01 after inactivation at a wavelength of 505 nm.

[0122] (3) Method for calculating the enzyme activity of β-glucosidase: The absorbance values ​​of the crude enzyme solution of Aspergillus niger obtained in steps (2.1) and (2.2) are compared with the 5.55 mmol / L glucose standard solution, respectively, and the glucose concentration is calculated, wherein the glucose concentration = ((absorbance value of the crude enzyme solution of Aspergillus niger - absorbance value of the blank group) / (absorbance value of the standard sample - absorbance value of the blank group)) × 5.55, wherein 5.55 is the concentration of glucose in the glucose standard solution. Then, the enzyme activity of β-glucosidase is calculated according to the enzyme activity formula of β-glucosidase, wherein the enzyme activity formula of β-glucosidase is as follows: Wherein, U represents the enzyme activity of β-glucosidase; A represents the glucose concentration, in μmol / mL; N represents the dilution factor, wherein the dilution factor in this embodiment is 200 times; t represents the reaction time, in min; V1 represents the volume of the reaction system, in mL; V2 represents the volume of the crude enzyme solution of Aspergillus niger AGM01, in mL.

[0123] Definition of one unit of β-glucosidase activity: Under the conditions of 60°C and pH 5, the amount of enzyme required to produce 1 μmol of glucose per minute by enzymatic hydrolysis of cellobiose in each mL of crude enzyme solution of Aspergillus niger AGM01 is defined as one unit of β-glucosidase activity (U).

[0124] According to the method for calculating the enzyme activity of β-glucosidase in step (3), the comparison results of the enzyme activity of β-glucosidase in Aspergillus niger are shown in Table 5: (3) Determination of protein content in crude enzyme solution of Aspergillus niger AGM01 1 mL of the crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was diluted to 10 mL in a volumetric flask to obtain a diluted crude enzyme solution, and the crude enzyme solution was centrifuged at 10000 rpm for 5 min to obtain a supernatant. 5 uL of the supernatant was mixed with 250 uL of Coomassie brilliant blue dye and allowed to stand for 5 min to obtain a mixed solution. The absorbance of the mixed solution at 595 nm was measured using an ELISA instrument, and the absorbance was compared with the protein standard curve to obtain a protein content of 1.5 mg / mL in the crude enzyme solution.

[0125] The process of drawing the protein standard curve is as follows: prepare a gradient protein standard (bovine serum albumin) solution of 0-60 μg / mL, use the measured absorbance value of the mixed solution of each protein standard and Coomassie brilliant blue dye at 595 nm as the ordinate, and the corresponding protein standard concentration as the abscissa to obtain the protein standard curve: y=0.5716x+0.5075, R 2 =0.9968.

[0126] Example 3 1. Example 3.1 provides a method for preparing Aspergillus niger solid-state fermentation broth, as shown below: (1) Preparation of seed culture medium: Mix glucose, yeast extract powder F902, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, iron sulfate, manganese sulfate, zinc sulfate, cobalt chloride and sterile water and sterilize at 115°C for 30 min to obtain a seed culture medium. The concentration of glucose in the seed culture medium is 20 g / L, the concentration of yeast extract powder F902 is 15 g / L, the concentration of magnesium sulfate is 0.3 g / L, the concentration of potassium dihydrogen phosphate is 2.5 g / L, the concentration of calcium chloride is 1.2 g / L, the concentration of iron sulfate is 7 mg / L, the concentration of manganese sulfate is 6 mg / L, the concentration of zinc sulfate is 4 mg / L, the concentration of cobalt chloride is 6 mg / L, and the rest is water.

[0127] (2) Inoculate 10% by volume of the spore suspension of Aspergillus niger AGM01 into the seed culture medium obtained in step (1), and culture at 28° C. and 200 rpm for 36 h to obtain a seed solution.

[0128] (3) Preparation of xylose-induced solid fermentation medium: powdered bran, powdered straw, powdered corncob, ammonium sulfate, urea, calcium chloride, xylose and sterile water were mixed and sterilized at 115°C for 30 min to obtain a solid fermentation medium. The concentration of bran in the solid fermentation medium was 20 g / L, the concentration of straw was 25 g / L, the concentration of corncob was 22 g / L, the concentration of ammonium sulfate was 15 g / L, the concentration of urea was 10 g / L, the concentration of calcium chloride was 2.2 g / L and the concentration of xylose was 2.5 g / L, and the rest was water.

[0129] (4) Preparation of xylose-induced crude enzyme solution: The seed solution obtained in step (2) was inoculated into the xylose-induced solid fermentation medium obtained in step (3) at an inoculum rate of 5% by volume, and fermented for 120 h at 28°C, pH=5, and humidity of 80% to obtain a solid fermentation product. The solid fermentation product was then mixed with a phosphate buffer solution at pH=5 in a volume ratio of 1:8 and then soaked for 2 h. The mixture was then stirred at a rotation speed of 120 rpm for 20 min and then plate-and-frame filtered to obtain a xylose-induced crude enzyme solution.

[0130] (5) Preparation of xylose-induced concentrated solution: The xylose-induced crude enzyme solution obtained in step (4) and steps in a membrane with a pore size of 30 kD and a water flux of 80 L / m 2 ∙h, ultrafiltration and concentration were performed for 2 h to obtain the xylose-induced concentrate.

[0131] 2. Comparative Example 3.1 provides a method for preparing Aspergillus niger solid-state fermentation liquid, which is specifically as follows: Step (1) to step (2) are the same as in Example 3.1. (3) Preparation of solid fermentation medium without xylose induction: powdered bran, powdered straw, powdered corncob, ammonium sulfate, urea, calcium chloride, xylose and sterile water were mixed and sterilized at 115°C for 30 min to obtain a solid fermentation medium without xylose induction. The concentration of bran in the solid fermentation medium without xylose induction was 20 g / L, the concentration of straw was 25 g / L, the concentration of corncob was 22 g / L, the concentration of ammonium sulfate was 15 g / L, the concentration of urea was 10 g / L, the concentration of calcium chloride was 2.2 g / L, and the rest was water.

[0132] (4) Preparation of crude enzyme solution without xylose induction: The seed solution obtained in step (2) was inoculated into the solid fermentation medium without xylose induction obtained in step (3) at an inoculum amount of 5% by volume, and fermented for 120 hours at 28°C, pH=5, and humidity of 80% to obtain a solid fermentation product. Then, the solid fermentation product was mixed with a phosphate buffer solution with a pH of 5 in a volume ratio of 1:8 and then soaked for 2 hours, and then stirred at a speed of 120 rpm for 20 minutes and then filtered by plate and frame to obtain a crude enzyme solution without xylose induction.

[0133] (5) Preparation of xylose-free concentrated solution: The crude enzyme obtained in step (4) without xylose induction is The liquid and step is on a membrane with a pore size of 30 kD and a water flux of 80 L / m 2 ∙h, ultrafiltration and concentration were performed for 2 h to obtain a concentrate without xylose induction.

[0134] Evaluation of technical effect: The xylose-induced crude enzyme solution obtained in Example 3.1, the xylose-induced concentrated solution obtained in Example 3.1, and the concentrated solution without xylose induction obtained in Comparative Example 3.1 were subjected to the determination of the enzyme activity of β-glucosidase. The specific method for determining the enzyme activity of β-glucosidase was the same as the determination method of step (2) in Example 2.

[0135] The results showed that the enzyme activity of β-glucosidase in the crude enzyme solution induced by xylose was 16.8 U, and the enzyme activity of β-glucosidase in the concentrated solution induced by xylose was 134.4 U. The enzyme activity of β-glucosidase in the concentrated solution without xylose induction was 95.6 U. It can be seen that the enzyme activity of β-glucosidase in the crude enzyme solution induced by xylose was increased by 40.6%.

[0136] Application example (application in the preparation of lignocellulose hydrolyzate sugar solution) (1) 540 kg of bagasse with a water content of 50 wt% (the dry matter mass of bagasse is 270 kg) and 300 L of phosphate buffer solution with a pH of 4.8 are mixed to obtain a mixed liquid, and then a mixed enzyme solution is added to the mixed liquid three times to obtain an enzymatic reaction system. Based on the dry matter mass of bagasse, the enzymatic reaction system contains 4350 U of cellulase, 69600 U of xylanase, and 1740 U of β-glucosidase, and then hydrolyzes at 50°C for 144 hours to obtain a lignocellulose hydrolyzed sugar solution; The mixed enzyme solution was prepared by uniformly mixing 0.435 g of cellulase, 0.696 g of xylanase, 12.95 mL of the xylose-induced concentrate obtained in step (5.1) of Example 3, and 37.5 L of phosphate buffer solution to obtain the mixed enzyme solution.

[0137] (2) The NY-T3494-2019 method was used to detect the cellulose and hemicellulose contents in the enzymatic hydrolysis reaction substrate. The cellulose content was 35.4 wt%, the hemicellulose content was 20.6 wt%, and the total amount of cellulose and hemicellulose in the bagasse enzymatic hydrolysis reaction substrate was 151.2 g (based on the dry matter mass of bagasse). The reducing sugar content in the lignocellulose hydrolyzate was detected by GB 5009.7-2016 method, which was 158 g / L. The mass of reducing sugar in the lignocellulose hydrolyzate was 138.65 g. The saccharification rate of the lignocellulose hydrolyzate was detected by the saccharification rate calculation formula, and the saccharification rate of the lignocellulose hydrolyzate was 91.7%.

[0138] The saccharification rate calculation formula is: (m2 / m1) × 100%, where m1 represents the mass of cellulose and hemicellulose in the enzymatic hydrolysis reaction substrate of sugarcane bagasse; m2 represents the mass of reducing sugar obtained in the lignocellulose hydrolysis sugar solution.

[0139] The above embodiments are only for further explanation and understanding of the technical solution of the present invention, and are not limitations of the present invention. Any non-prominent substantial features and non-significant improvements made by those skilled in the art on this basis should fall within the scope of protection of the present invention.

Claims

1. An Aspergillus niger, characterized in that The Aspergillus niger is Aspergillus niger AGM01, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 2024768.

2. Aspergillus niger according to claim 1, characterized in that The ITS gene sequence of Aspergillus niger AGM01 is shown in SEQ ID NO.

3.

3. Aspergillus niger according to claim 1 or 2, characterized in that The Aspergillus niger AGM01 has the characteristic of producing β-glucosidase.

4. Aspergillus niger according to claim 3, characterized in that The enzyme activity of the β-glucosidase of Aspergillus niger AGM01 is: 20-30U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per minute of enzymatic hydrolysis of cellobiose in each mL of crude enzyme solution of Aspergillus niger AGM01 is defined as one enzyme activity unit of β-glucosidase; The crude enzyme solution of Aspergillus niger AGM01 is prepared by the following method: amplifying and culturing Aspergillus niger to obtain an Aspergillus niger spore suspension, fermenting and culturing the Aspergillus niger spore suspension to obtain a fermentation liquid, and then performing solid-liquid separation to obtain a supernatant, i.e., the crude enzyme solution of Aspergillus niger AGM01.

5. Aspergillus niger according to claim 4, characterized in that The fermentation culture time is 5-7 days.

6. A fermentation method for preparing a niger fungus agent, characterized in that: The fermentation preparation method comprises the following steps: (a) amplifying and culturing the Aspergillus niger according to any one of claims 1 to 5 to obtain an Aspergillus niger spore suspension; (b) fermenting the Aspergillus niger spore suspension obtained in step (a).

7. The fermentation preparation method according to claim 6, characterized in that: In step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of claims 1 to 5.

8. The fermentation preparation method according to claim 6, characterized in that: The culturing temperature in step (a) is 26-30°C; and / or the culturing temperature in step (b) is 26-32°C.

9. The fermentation preparation method according to claim 6, characterized in that: The culture time in step (a) is 24-48 hours.

10. A niger Aspergillus fungus agent, characterized in that Contains the Aspergillus niger according to any one of claims 1 to 5.

11. A niger Aspergillus agent, characterized in that The Aspergillus niger agent is prepared by the fermentation preparation method according to any one of claims 6 to 9.

12. A solid-state fermentation liquid of Aspergillus niger, characterized in that: The invention comprises the Aspergillus niger according to any one of claims 1 to 5, wherein the enzyme activity of β-glucosidase in the Aspergillus niger solid-state fermentation broth is 110-170U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein the amount of enzyme required to produce 1 μmol of glucose per min of enzymatic hydrolysis of cellobiose in each mL of the Aspergillus niger solid-state fermentation broth is defined as one enzyme activity unit of β-glucosidase.

13. The Aspergillus niger solid-state fermentation liquid according to claim 12, characterized in that The seed culture medium comprises, by weight: 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of iron sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate and 0.001-0.01 parts of cobalt chloride.

14. The Aspergillus niger solid-state fermentation liquid according to claim 13, characterized in that The seed culture medium comprises: 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of iron sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.

15. The Aspergillus niger solid-state fermentation liquid according to claim 13, characterized in that The yeast extract powder is yeast extract powder F902.

16. The Aspergillus niger solid-state fermentation liquid according to claim 14, characterized in that The yeast extract powder is yeast extract powder F902.

17. The Aspergillus niger solid-state fermentation liquid according to any one of claims 12 to 16, characterized in that: The seed culture medium also includes: water.

18. The Aspergillus niger solid-state fermentation liquid according to claim 17, characterized in that The seed culture medium comprises: glucose with a concentration of 1-30 g / L, yeast extract with a concentration of 5-20 g / L, magnesium sulfate with a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate with a concentration of 1-4 g / L, calcium chloride with a concentration of 0.2-2 g / L, iron sulfate with a concentration of 1-10 mg / L, manganese sulfate with a concentration of 1-10 mg / L, zinc sulfate with a concentration of 1-10 mg / L and cobalt chloride with a concentration of 1-10 mg / L, and the rest is water.

19. The Aspergillus niger solid-state fermentation liquid according to claim 18, characterized in that The seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or iron sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.

20. The Aspergillus niger solid-state fermentation liquid according to claim 12, characterized in that: In parts by weight, the solid-state fermentation medium comprises 1-20 parts of small molecule inducers, wherein the small molecule inducers are one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and substances containing sophoroside.

21. The Aspergillus niger solid-state fermentation liquid according to claim 20, characterized in that The small molecule inducer is xylose.

22. The Aspergillus niger solid-state fermentation liquid according to claim 20, characterized in that The substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.

23. The Aspergillus niger solid-state fermentation liquid according to claim 20, characterized in that The solid-state fermentation medium also includes: substances containing lignocellulose, ammonium sulfate, urea and calcium chloride.

24. The Aspergillus niger solid-state fermentation liquid according to claim 23, characterized in that In parts by weight, the solid-state fermentation medium comprises: 30-90 parts of a substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of a small molecule inducer.

25. The Aspergillus niger solid-state fermentation liquid according to claim 24, characterized in that In parts by weight, the solid-state fermentation medium comprises: 30-75 parts of a substance containing lignocellulose, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of a small molecule inducer.

26. The Aspergillus niger solid-state fermentation liquid according to claim 23, characterized in that The material containing lignocellulose includes: one or more of bran, straw and corn cob.

27. The Aspergillus niger solid-state fermentation liquid according to claim 26, characterized in that The material containing lignocellulose is a combination of bran, straw and corn cob.

28. The Aspergillus niger solid-state fermentation liquid according to claim 27, characterized in that In parts by weight, the material containing lignocellulose is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corn cobs.

29. The Aspergillus niger solid-state fermentation liquid according to claim 28, characterized in that In parts by weight, the material containing lignocellulose is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corn cobs.

30. The Aspergillus niger solid-state fermentation liquid according to any one of claims 20 to 25, characterized in that The solid-state fermentation medium also includes: water.

31. The Aspergillus niger solid-state fermentation liquid according to claim 30, characterized in that The solid fermentation medium comprises: a substance containing lignocellulose at a concentration of 30-90 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, a small molecule inducer at a concentration of 1-20 g / L, and the rest is water.

32. The Aspergillus niger solid-state fermentation liquid according to claim 31, characterized in that The solid-state fermentation medium comprises: a substance containing lignocellulose at a concentration of 30-75 g / L, and / or an ammonium sulfate at a concentration of 6-20 g / L, and / or a urea at a concentration of 2-12 g / L, and / or a calcium chloride at a concentration of 0.5-2 g / L, and / or a small molecule inducer at a concentration of 1-18 g / L, and the rest is water.

33. The Aspergillus niger solid-state fermentation broth according to any one of claims 26 to 29, characterized in that: The solid-state fermentation medium also includes: water.

34. The Aspergillus niger solid-state fermentation liquid according to claim 33, characterized in that The solid fermentation medium comprises: bran with a concentration of 10-30 g / L, straw with a concentration of 10-30 g / L, corn cob with a concentration of 10-30 g / L, ammonium sulfate with a concentration of 5-25 g / L, urea with a concentration of 1-15 g / L, calcium chloride with a concentration of 0.5-3 g / L, and a small molecule inducer with a concentration of 1-20 g / L, and the rest is water.

35. The Aspergillus niger solid-state fermentation liquid according to claim 34, characterized in that The solid-state fermentation medium comprises: a bran concentration of 10-25 g / L, and / or a straw concentration of 10-25 g / L, and / or a corn cob concentration of 10-25 g / L, and / or an ammonium sulfate concentration of 5-25 g / L, and / or a urea concentration of 1-15 g / L, and / or a calcium chloride concentration of 0.5-3 g / L, and / or a small molecule inducer concentration of 1-20 g / L, and the rest is water.

36. A method for preparing the Aspergillus niger solid-state fermentation liquid according to any one of claims 12 to 35, characterized in that: The method comprises the following steps: amplifying and culturing the Aspergillus niger according to any one of claims 1 to 5 to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium for culturing to obtain an Aspergillus niger seed liquid; and inoculating the Aspergillus niger seed liquid into a solid fermentation culture medium for culturing to obtain an Aspergillus niger solid fermentation liquid.

37. The preparation method according to claim 36, characterized in that: The steps include: (a) amplifying and culturing the Aspergillus niger according to any one of claims 1 to 5 to obtain an Aspergillus niger spore suspension; (b) inoculating the Aspergillus niger spore suspension obtained in step (a) into a seed culture medium for culturing to obtain an Aspergillus niger seed liquid; (c) inoculating the Aspergillus niger seed liquid obtained in step (b) into a solid-state fermentation medium for culturing to obtain an Aspergillus niger solid-state fermentation product; (d) mixing, soaking, stirring and filtering the Aspergillus niger solid fermentation product obtained in step (c) with a buffer solution to obtain a crude enzyme solution; (e) concentrating the crude enzyme solution obtained in step (d) to obtain a concentrated solution, i.e., Aspergillus niger solid-state fermentation solution.

38. The preparation method according to claim 37, characterized in that: In step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger according to any one of claims 1 to 5.

39. The preparation method according to claim 37, characterized in that: The culturing temperature in step (a) is 26-30°C; and / or the culturing temperature in step (b) is 26-30°C; and / or the culturing temperature in step (c) is 27-29°C.

40. The preparation method according to claim 37, characterized in that: The culturing time in step (a) is 24-48 hours; and / or the culturing time in step (b) is 24-48 hours; and / or the culturing time in step (c) is 100-144 hours.

41. The preparation method according to claim 37, characterized in that: The culture rotation speed in step (b) is 150-300 rpm.

42. The preparation method according to claim 37, characterized in that: The culture pH in step (c) is 4.5-5.

5.

43. The preparation method according to claim 37, characterized in that: The culture humidity in step (c) is 50-95%.

44. The preparation method according to claim 37, characterized in that: In step (d), the volume ratio of the mixture of the Aspergillus niger solid-state fermentation product and the buffer solution is (0.8-1.2):(6-10).

45. The preparation method according to claim 37, characterized in that: The soaking time in step (d) is 1-4h.

46. ​​The preparation method according to claim 37, characterized in that: The stirring speed in step (d) is 100-300 rpm.

47. The preparation method according to claim 37, characterized in that: The stirring time in step (d) is 20-50 min.

48. The preparation method according to claim 37, characterized in that: The filtration in step (d) is plate and frame filtration.

49. The preparation method according to claim 37, characterized in that: In step (e), the concentration is ultrafiltration concentration.

50. The preparation method according to claim 49, characterized in that The membrane used for ultrafiltration concentration has a pore size of 10-60 kD.

51. The preparation method according to claim 49, characterized in that The ultrafiltration concentration time is 1-5h.

52. An Aspergillus niger solid-state fermentation liquid prepared by the preparation method according to any one of claims 36 to 51.

53. A lignocellulose hydrolyzate sugar solution, characterized in that: The method is obtained by hydrolyzing the Aspergillus niger according to any one of claims 1 to 5, or the Aspergillus niger agent according to claim 10 or 11, or the Aspergillus niger solid-state fermentation liquid according to any one of claims 12 to 35 or claim 52.

54. The lignocellulose hydrolyzed sugar solution according to claim 53, characterized in that Lignocellulose is either agricultural waste or forestry waste, or a combination of both.

55. The lignocellulose hydrolyzed sugar solution according to claim 54, characterized in that The agricultural waste is one or a combination of bagasse and straw.

56. The lignocellulose hydrolyzed sugar solution according to any one of claims 53 to 55, wherein the weight ratio of reducing sugars contained in the lignocellulose hydrolyzed sugar solution is 90% or more, wherein: The reducing sugar mass ratio refers to the percentage of the mass m2 of the lignocellulosic raw material converted into reducing sugars after enzymatic hydrolysis relative to the total mass m1 of cellulose and hemicellulose contained in the lignocellulosic raw material before hydrolysis.

57. Use of the Aspergillus niger according to any one of claims 1-5, or the Aspergillus niger agent according to claim 10 or 11, or the Aspergillus niger solid-state fermentation liquid according to any one of claims 12-35 or claim 52 in preparing lignocellulose hydrolyzed sugar liquid.

Images