Recombinant acid phosphatase engineering bacterium and application thereof in preparation of 5 '-cytidine monophosphate

Abstract

The invention discloses a recombinant acid phosphatase engineering bacterium and application of the recombinant acid phosphatase engineering bacterium in preparation of 5 '-cytidine monophosphate. The recombinant acid phosphatase engineering bacterium is obtained by constructing an acid phospatase gene as shown in SEQ ID NO.1 into a plasmid pET28a and transferring the plasmid pET28a into escherichia coli BL21 (DE3). According to the application in preparation of the 5 '-cytidine monophosphate, recombinant acid phosphatase engineering bacteria are subjected to fermentation culture to prepare recombinant acid phosphatase, and cytidine and sodium pyrophosphate are catalyzed in a water phase to synthesize the 5'-cytidine monophosphate, the method overcomes the problems that in the prior art, steps are complex, the yield is not ideal, the cost is high, environmental pollution is serious, and potential safety hazards exist, and the method is suitable for industrial production. And a good process route is provided for green production of 5 '-cytidine monophosphate.

Description

Technical Field

[0001] The invention belongs to the technical field of biopharmaceuticals and biochemical engineering, and specifically relates to recombinant acid phosphatase engineering bacteria and application thereof in preparing 5'-cytidylic acid. Background Art

[0002] 5'-Cytidylic acid is an important nucleotide raw material and intermediate, which can be used as a food additive, medicine and drug intermediate in different fields. 5'-Cytidylic acid plays an important role in the immune system of adults, infants and mammals. Infant formula containing 5'-Cytidylic acid can significantly improve the immunity of infants and its efficacy is closer to that of breast milk. 5'-Cytidylic acid is an important intermediate for the preparation of nucleotide drugs and nucleotide derivatives, and is mainly used for the preparation of cytidine triphosphate, sodium diphosphate choline, arabinocytidylic acid and polyinosinic acid.

[0003] At present, there are two main methods for producing 5'-cytidylic acid. One is to obtain 5'-cytidylic acid by hydrolyzing ribonucleic acid extracted from yeast with nuclease. In this method, ribonucleosides extracted from yeast are hydrolyzed by nuclease to obtain a mixture of four 5'-nucleotides, namely 5'-adenylic acid, 5'-guanylic acid, 5'-cytidylic acid and 5'-uridylic acid, which is then separated by multiple ion exchange resins to obtain crude 5'-cytidylic acid, and then refined to obtain finished 5'-cytidylic acid.

[0004] This approach has the following disadvantages:

[0005] 1. This process has a long production cycle and complex separation and purification procedures.

[0006] 2. The yield is not high, resulting in high production costs.

[0007] 3. The production process generates a large amount of wastewater, which puts great pressure on the environmental protection and affects production capacity.

[0008] Another method is to obtain 5'-cytidylic acid by chemical phosphorylation of cytidine. The process is as follows:

[0009]

[0010] This approach has the following disadvantages:

[0011] 1. The phosphorylation reagent in this method is usually a hazardous chemical such as phosphorus oxychloride, which brings many safety hazards in the production process;

[0012] 2. This method produces more three wastes during the production process, which puts greater pressure on the company's environmental protection;

[0013] 3. The 5'-cytidylic acid product produced by this method cannot be applied in the field of food additives such as infant formula.

[0014] In recent years, biochemists have been exploring a mild, efficient, economical and environmentally friendly method for synthesizing 5'-cytidylic acid to replace the existing production process. Biologists have made some attempts on this compound (Chinese Journal of Biotechnology; ISSN 1000-3061, CN 11-1998 / Q), using uridine-cytidine kinase and polyphosphate kinase to couple catalyze cytidine to prepare 5'-cytidylic acid. The reaction formula is as follows:

[0015]

[0016] Currently, this method still has the disadvantages of low substrate concentration, incomplete conversion, expensive auxiliary material ATP, etc., and is still a long way from industrialization. Therefore, the present invention proposes a recombinant acid phosphatase engineering bacterium and its application in the preparation of 5'-cytidylic acid. Summary of the invention

[0017] The object of the present invention is to provide a recombinant acid phosphatase engineered bacterium and its application in the preparation of 5'-cytidylic acid. The acid phosphatase prepared by the recombinant acid phosphatase engineered bacterium through fermentation can efficiently catalyze cytidine and sodium pyrophosphate to synthesize 5'-cytidylic acid, thereby solving the problems of complex steps, unsatisfactory yield, high cost, serious environmental pollution and potential safety hazards encountered in the current production process of 5'-cytidylic acid.

[0018] To this end, the present invention provides a recombinant acid phosphatase engineered bacterium, wherein the recombinant acid phosphatase engineered bacterium is obtained by constructing the acid phosphatase gene shown in SEQ ID NO.1 into plasmid pET28a and transferring it into Escherichia coli BL21 (DE3). The strain was submitted to Guangdong Provincial Microbiological Culture Collection Center (GDMCC) for preservation on May 9, 2024, with the preservation number: GDMCC NO: 64595, and the preservation address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the strain name is Escherichia coli HM-ap.

[0019] Preferably, the acid phosphatase gene shown in SEQ ID NO.1 (NCBI accession number DAFYEB010000010.1) of the recombinant acid phosphatase engineering bacteria is from the microorganism Enterobacter Aerogenes (strain number ATCC13048).

[0020] Wherein, the sequence structure shown in SEQ ID NO.1 is as follows:

[0021] atgaaaaagc gcgttctcgc cctctgcctc gccagcctgt tttccgttaa cgctttcgcg

[0022] ctggtccctg ccggcaacga ggcgaccacc aaaccagatc tctattatct gaaaaatgca

[0023] caggccatcg atagcctggc gctgttgccg ccgccgccgg aagttggcag catcgcattt

[0024] ttaaacgatc aggcgatgta tgagaaagga cggctgttgc gcaataccga acgtggcaag

[0025] ctggcggctg aagatgctaa cctgagcgcc ggcggcgtcg cgaatgcctt ctccagcgct

[0026] tttggttcgc ccatcaccga aaaagacgcg ccgcagttac ataagctgct gacaaatatg

[0027] attgaggatg ccggcgatct ggccacccgc agcgcgaaag agaaatatat gcgcattcgc

[0028] ccgtttgcgt tctacggcgt ttcaacctgt aacactaccg agcaggacaa gctgtcgaaa

[0029] aacggatctt acccttccgg ccatacctct atcggttggg caaccgcgct ggtactggcg

[0030] gagatcaatc cgcagcggca aaacgaaatt ctcaaacgcg gctatgagtt gggcgaaagc

[0031] cgggttatct gcggctatca ttggcagagc gatgtcgatg cggcgcggat agtcggctcg

[0032] gcggtggtgg cgaccctgca taccaacccg gccttccaac agcagttgca gaaagcaaag

[0033] gatgaattcg ccaaaacgca gaagtaa

[0034] Among them, the microorganism Enterobacter Aerogenes (strain number ATCC 13048) is a commercially available strain.

[0035] Preferably, the recombinant acid phosphatase engineering bacteria recombinant plasmid pET28a-acid phosphatase is constructed by the following steps: the acid phosphatase gene shown in SEQ ID NO.1 is constructed into the plasmid pET28a and obtained by the following steps: using acid phosphatase_NdeI_F having the sequence structure shown in SEQ ID NO.2 and acid phosphatase_XhoI_R having the sequence structure shown in SEQ ID NO.3 as primers, and the Enterobacter Aerogenes genome as a template, the acid phosphatase gene is cloned, and NdeI / XhoI double enzyme digestion is performed, and the recovered gene fragment is connected with the NdeI / XhoI double enzyme digested plasmid pET28a by T4 DNA ligase to obtain the recombinant plasmid pET28a-acidphosphatase.

[0036] Wherein, the sequence structure shown in SEQ ID NO.2 is as follows:

[0037] GGGAATTCCATATGAAAAAGCGCGTT.

[0038] Wherein, the sequence structure shown in SEQ ID NO.3 is as follows:

[0039] CCGCTCGAGTTACTTCTGCGTTTTGG.

[0040] Among them, NdeI enzyme, XhoI enzyme, and pET28a plasmid are all commercially available products.

[0041] Preferably, the recombinant acid phosphatase engineered bacteria pET28a-acid phosphatase-BL21 (DE3) is obtained by the following steps: taking 1ul of the recombinant plasmid pET28a-acid phosphatase and adding it to the competent Escherichia coli BL21 (DE3) cells thawed on ice, mixing, ice bathing for 30min, heat shocking in a 42°C water bath for 90s, and then quickly placing it in an ice bath for 5min; adding 800ul of LB liquid culture medium and shaking and culturing in a shaker at 37°C and 200rpm / min for 1h; taking 100ul of the culture solution and applying it on a solid LB culture medium containing kanamycin, culturing at 37°C for 10 to 20h, and the grown colonies are the recombinant engineered bacteria pET28a-acidphosphatase-BL21 (DE3).

[0042] Among them, BL21 (DE3) competent cells are commercially available strains.

[0043] Preferably, the enzyme solution obtained by fermentation culture of the recombinant acid phosphatase engineered bacteria is as follows: a single colony of the recombinant acid phosphatase engineered bacteria pET28a-acid phosphatase-BL21 (DE3) is inoculated into an LB liquid culture medium containing kanamycin, and cultured at 37°C with shaking for 8 to 16 hours, and transferred to a TB culture medium with a 1% inoculation amount, and cultured at 37°C with shaking fermentation until the OD600 value reaches 0.8 to 1.0, and an inducer IPTG is added to make the final concentration of IPTG 0.5 mmol / L, and the temperature is lowered to 30°C, and induced for 12 to 20 hours; after the fermentation culture is completed, the cells are collected by centrifugation, the cells are resuspended in tap water, and then ultrasonically disrupted in an ice bath, the disrupted liquid is centrifuged, and the supernatant is collected to obtain the recombinant acid phosphatase enzyme solution.

[0044] The LB medium contains: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride (NaCl); sterilized at 121° C. for 20 min.

[0045] The TB culture medium comprises: 12 g / L tryptone, 24 g / L yeast extract, 4 g / L glycerol, 2.31 g / L potassium dihydrogen phosphate, and 12.54 g / L potassium hydrogen phosphate; sterilized at 121°C for 20 min.

[0046] The present invention provides a recombinant acid phosphatase engineering bacterium and its application in preparing 5'-cytidylic acid, wherein the structural formula of the 5'-cytidylic acid is as follows:

[0047]

[0048] The steps of preparing 5'-cytidylic acid are as follows: using an enzyme solution obtained by fermentation culture of recombinant acid phosphatase engineering bacteria as a catalyst, catalyzing cytidine and sodium pyrophosphate to synthesize 5'-cytidylic acid in water at 35°C to 40°C and pH 4.0 to 5.0, heating to 80 to 90°C after the reaction, stirring at this temperature for 30min to 1h, filtering, stirring the filtrate and cooling it to 4 to 10°C, adjusting the pH to 8.0 with sodium hydroxide solution, and then precipitating salt for 16 to 20h, filtering and separating, and concentrating the clear liquid by vacuum distillation to a cytidylic acid concentration of 200 to 300g / L, adding anhydrous ethanol, stirring and crystallizing at 0 to 4°C for 10 to 20h, filtering and separating to obtain a solid crude 5'-cytidylic acid, and further refining and drying the crude product to obtain a finished 5'-cytidylic acid product.

[0049] Among them, the concentration of cytidine is 50-100 g / L, and the concentration of sodium pyrophosphate is 100-200 g / L.

[0050] The amount of anhydrous ethanol added is 2 to 3 times the volume of the concentrated solution.

[0051] Preferably, the step of further refining the crude product of the present invention is as follows: adding the crude 5'-cytidylic acid into pure water, adding activated carbon for decolorization after dissolving, filtering, adjusting the pH value to 3.0-4.0 with dilute hydrochloric acid solution, adding 2-3 times the volume of anhydrous ethanol to the solution, crystallizing at 0°C-4°C for 10-20h, separating the solid from the liquid, and drying the solid to obtain the finished 5'-cytidylic acid.

[0052] The reaction formula for preparing 5'-cytidylic acid of the present invention is as follows:

[0053]

[0054] Compared with the prior art, the present invention has the following beneficial effects:

[0055] 1. The acid phosphorylase obtained by fermentation culture of the recombinant acid phosphatase engineering bacteria constructed by the present invention has a strong catalytic ability for cytidine and can efficiently prepare 5'-cytidylic acid, providing a new green enzyme catalysis process for preparing 5'-cytidylic acid.

[0056] 2. The process for preparing 5'-cytidylic acid by using recombinant acid phosphatase of the present invention has simple reaction steps and a mild green synthesis process in aqueous phase, which is conducive to industrial application.

[0057] 3. The process for preparing 5'-cytidylic acid by recombinant acid phosphatase of the present invention can achieve a substrate cytidine concentration of 100 g / L in bioconversion, and the reaction has a high conversion rate and a high yield, which is conducive to realizing industrial production.

[0058] 4. The process for preparing 5'-cytidylic acid by recombinant acid phosphatase of the present invention uses low-cost sodium pyrophosphate as a phosphorus source donor, which greatly reduces the production cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 is the HPLC spectrum of the crude 5'-cytidylic acid of the present invention;

[0060] Figure 2 is the HPLC spectrum of the 5'-cytidylic acid product of the present invention; DETAILED DESCRIPTION

[0061] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0062] Example 1: Construction of recombinant acid phosphatase engineering bacteria

[0063] The recombinant acid phosphatase engineering bacteria acid phosphatase gene of this embodiment has the sequence structure shown in SEQ ID NO.1, and the sequence structure shown in SEQ ID NO.1 is as follows:

[0064] atgaaaaagc gcgttctcgc cctctgcctc gccagcctgt tttccgttaa cgctttcgcg

[0065] ctggtccctg ccggcaacga ggcgaccacc aaaccagatc tctattatct gaaaaatgca

[0066] caggccatcg atagcctggc gctgttgccg ccgccgccgg aagttggcag catcgcattt

[0067] ttaaacgatc aggcgatgta tgagaaagga cggctgttgc gcaataccga acgtggcaag

[0068] ctggcggctg aagatgctaa cctgagcgcc ggcggcgtcg cgaatgcctt ctccagcgct

[0069] tttggttcgc ccatcaccga aaaagacgcg ccgcagttac ataagctgct gacaaatatg

[0070] attgaggatg ccggcgatct ggccacccgc agcgcgaaag agaaatat gcgcattcgc

[0071] ccgtttgcgt tctacggcgt ttcaacctgt aacactaccg agcaggacaa gctgtcgaaa

[0072] aacggatctt acccttccgg ccatacctct atcggttggg caaccgcgct ggtactggcg

[0073] gagatcaatc cgcagcggca aaacgaaatt ctcaaacgcg gctatgagtt gggcgaaagc

[0074] cgggttatct gcggctatca ttggcagagc gatgtcgatg cggcgcggat agtcggctcg

[0075] gcggtggtgg cgaccctgca taccaacccg gccttccaac agcagttgca gaaagcaaag

[0076] gatgaattcg ccaaaacgca gaagtaa

[0077] The construction method of the recombinant acid phosphatase engineering bacteria of this embodiment is as follows:

[0078] Primers were designed, acid phosphatase_NdeI_F having the sequence structure shown in SEQ ID NO.2 and acid phosphatase_XhoI_R having the sequence structure shown in SEQ ID NO.3 were used as primers, Enterobacter Aerogenes genome was used as a template, acid phosphatase gene was cloned, and NdeI / XhoI double restriction digestion was performed.

[0079] Among them, the sequence structure shown in SEQ ID NO.2 is as follows: GGGAATTCCATATGAAAAAGCGCGTT Among them, the sequence structure shown in SEQ ID NO.3 is as follows: CCGCTCGAGTTACTTCTGCGTTTTGG

[0080] The gene fragment recovered after double restriction digestion was ligated with the plasmid pET28a double-digested with NdeI / XhoI by T4 DNA ligase to obtain the recombinant plasmid pET28a-acid phosphatase.

[0081] Take 1ul of recombinant plasmid pET28a-acid phosphatase and add it to the competent Escherichia coli BL21 (DE3) thawed on ice, mix well, ice bath for 30min, heat shock in a 42℃ water bath for 90s, and then quickly put it in an ice bath for 5min; add 800ul LB liquid culture medium and shake and culture in a shaker at 37℃, 200rpm / min for 1h; take 100ul culture solution and spread it on solid LB culture medium containing kanamycin, culture at 37℃ for 12h, and the grown colonies are the recombinant acid phosphatase engineered bacteria pET28a-acidphosphatase-BL21 (DE3).

[0082] It should be noted that the culturing time of 12 h may also be replaced by any value between 10 and 20 h.

[0083] Example 2: Preparation of recombinant acid phosphatase

[0084] The preparation method of the recombinant acid phosphatase of this embodiment is as follows:

[0085] A single colony of the recombinant acid phosphatase engineering bacteria pET28a-acid phosphatase-BL21 (DE3) was inoculated into 5 ml of LB liquid culture medium containing kanamycin, and cultured at 37° C. for 16 hours with shaking, and then transferred to 500 ml of TB culture medium with a 1% inoculum, and cultured at 37° C. with shaking fermentation until the OD600 value reached 0.8, and then an inducer IPTG was added to make the final concentration of IPTG 0.5 mmol / L, and then the temperature was lowered to 30° C. and induced for 12 hours; after the fermentation culture was completed, the cells were collected by centrifugation, and the cells were resuspended in 50 ml of tap water and then ultrasonically disrupted in an ice bath, and the disrupted liquid was centrifuged (9000 rpm / min, 10 min), and the supernatant was collected to obtain the recombinant acid phosphatase enzyme solution.

[0086] It should be noted that, in order, the shaking culture for 16 hours can be replaced by any value between 8 and 16 hours; the OD600 value of 0.8 can be replaced by any value between 0.8 and 1.0; and the induction for 12 hours can be replaced by any value between 12 and 20 hours.

[0087] Example 3: Preparation of 5'-cytidylic acid

[0088] The specific steps of the method for preparing 5'-cytidylic acid in this embodiment are as follows:

[0089] (1) 950 ml of tap water was placed in a 2000 ml three-necked flask, 100 g of cytidine and 185 g of sodium pyrophosphate were added, the temperature was raised to 35° C., the pH value was adjusted to 5.0 with hydrochloric acid, and 50 ml of the recombinant acid phosphatase solution prepared in Example 2 was added, and the reaction was stirred at 35° C. During the reaction, samples were taken for high performance liquid chromatography (HPLC) detection to monitor the reaction progress.

[0090] It should be noted that, in order, pH 5.0 can also be replaced by any value between 4.0 and 5.0; 35°C can also be replaced by any value between 35 and 40°C.

[0091] Among them, the high performance liquid chromatography (HPLC) detection method is as follows:

[0092] Chromatographic column: Hypersil ODS C184.6mm*250mm, 5um

[0093] Mobile phase: 100% 0.5% KH2PO4

[0094] Column temperature: 35°C

[0095] Flow rate: 1ml / min

[0096] Detection wavelength: 270nm

[0097] Time: 20 minutes

[0098] Sample preparation: Take 0.2 ml of the reaction solution and add pure water to make up to 10 ml, and filter through a 0.22 um filter membrane to prepare the sample.

[0099] Injection volume: 3ul

[0100] Peak time:

[0101] Cytidine: 3.193min

[0102] Cytidine: 5.811 min

[0103] (2) When the cytidine conversion rate is greater than 98%, the reaction is completed, the reaction solution is heated to 80°C, stirred for 1 hour, filtered to remove solid insolubles, the filtrate is stirred and cooled to 4°C, the pH is adjusted to 8.0 with sodium hydroxide solution, and salt is precipitated for 20 hours. After filtration and separation, the clear liquid is concentrated by vacuum distillation;

[0104] It should be noted that, in order, 80°C can be replaced by any value between 80 and 90°C; 1h can be replaced by any value between 30min and 1h; 4°C can be replaced by any value between 4 and 10°C; and salt precipitation 20h can be replaced by any value between 16 and 20h.

[0105] (3) Concentrate the solution to 500 ml by distillation under reduced pressure, i.e., the concentration of cytidine is 260 g / L. Adjust the pH to 3.0 with dilute hydrochloric acid solution and add anhydrous ethanol in an amount of 3 times the volume of the concentrate. Cool the solution to 0°C, keep stirring for 10 h, and filter and separate. The solid is the crude 5'-cytidine, with a total of 138 g of wet product. The HPLC purity of the crude 5'-cytidine is 99.1%.

[0106] The temperature of the reduced pressure distillation is 65°C and the vacuum degree is -0.09 to -0.1 MPa.

[0107] Among them, the HPLC spectrum of crude 5'-cytidylic acid is as follows Figure 1 As shown;

[0108] It should be noted that, in order, 500 ml can also be replaced by any value between 430 and 640 ml, that is, the cytidine concentration is between 200 and 300 g / L, 3 times the volume of anhydrous ethanol can also be replaced by any value between 2 and 3; cooling to 0°C can also be replaced by any value between 0 and 4°C; stirring for 10 hours can also be replaced by any value between 10 and 20 hours.

[0109] (4) The steps of further refining the crude 5'-cytidylic acid are as follows: 138 g of the obtained crude 5'-cytidylic acid is added to 400 ml of pure water, and after dissolving, 1.5 g of activated carbon is added for decolorization for 30 min, filtered, and the pH value of the filtrate is adjusted to 3.0 with a dilute hydrochloric acid solution, and 2 volumes of anhydrous ethanol are added to the filtrate, stirred at 0°C for crystallization for 10 h, solid-liquid separation, and the solid is dried at 65°C for 5 h to obtain the finished 5'-cytidylic acid, totaling 120 g. The HPLC purity of the finished 5'-cytidylic acid is 99.5%, and the total yield is 90.2%.

[0110] The HPLC spectrum of the finished 5'-cytidylic acid is as follows Figure 2 As shown;

[0111] It should be noted that, in order, pH 3.0 can also be replaced by any value between 3.0 and 4.0; 2 times the volume of anhydrous ethanol can also be replaced by any value between 2 and 3; 0°C can also be replaced by any value between 0 and 4°C; 10h can also be replaced by any value between 10 and 20h.

[0112] In summary, the recombinant acid phosphatase of the present invention has simple reaction steps for preparing 5'-cytidylic acid, and the green synthesis process with mild aqueous phase is conducive to industrial application. The concentration of substrate cytidine for bioconversion can reach 100 g / L, the conversion rate of the reaction is >98%, and the total yield is >90%, which is conducive to realizing industrial production; and the cheap sodium pyrophosphate used as the phosphorus source donor greatly reduces the production cost.

[0113] Although embodiments of the present invention have been shown and described (see the above detailed description for details), it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant acid phosphatase engineering bacterium, characterized in that: The recombinant acid phosphatase engineering bacteria is obtained by constructing the acid phosphatase gene shown in SEQ ID NO.1 into a vector pET28a and then transferring it into Escherichia coli BL21 (DE3).

2. The recombinant acid phosphatase engineering bacteria according to claim 1, characterized in that: The acidphosphatase gene shown in SEQ ID NO.1 (NCBI accession number: DAFYEB010000010.1) is derived from the microorganism Enterobacter Aerogenes (strain number: ATCC 13048).

3. The recombinant acid phosphatase engineering bacteria according to claim 1, characterized in that: The acid phosphatase gene shown in SEQ ID NO.1 was constructed into plasmid pET28a by the following steps: using acid phosphatase_NdeI_F having the sequence structure shown in SEQ ID NO.2 and acidphosphatase_XhoI_R having the sequence structure shown in SEQ ID NO.3 as primers, using Enterobacter Aerogenes genome as a template, cloning the acidphosphatase gene, performing NdeI / XhoI double enzyme digestion, and connecting the recovered gene fragment with the NdeI / XhoI double enzyme digested plasmid pET28a by T4 DNA ligase to obtain the recombinant plasmid pET28a-acid phosphatase.

4. The recombinant acid phosphatase engineering bacteria according to claim 1, characterized in that: The recombinant plasmid pET28a-acid phosphatase was transferred into Escherichia coli BL21 (DE3) by the following steps: 1ul of the recombinant plasmid pET28a-acid phosphatase was added to the competent cells of Escherichia coli BL21 (DE3) thawed on ice and mixed evenly, and then heat-shocked in a 42°C water bath for 90s and then quickly placed in an ice bath for 5min; 800ul of LB liquid culture medium was added and shaken and cultured in a shaker at 37°C and 200rpm / min for 1h; 100ul of the culture solution was spread on a solid LB culture medium containing kanamycin, and cultured at 37°C for 10 to 20h, and the grown colonies were the recombinant engineered bacteria pET28a-acid phosphatase-BL21 (DE3).

5. Use of the recombinant acid phosphatase engineering bacteria according to any one of claims 1 to 4 in the preparation of 5'-cytidylic acid, characterized in that: The enzyme solution obtained by fermentation and cultivation of recombinant acid phosphatase engineering bacteria is used as a catalyst to catalyze cytidine and sodium pyrophosphate to synthesize 5'-cytidylic acid in water at 35°C to 40°C and pH 4.0 to 5.

0. After the reaction is completed, the reaction is heated to 80 to 90°C, stirred for 30 minutes to 1 hour, and filtered. The filtrate is stirred and cooled to 4 to 10°C. The pH value is adjusted to 8.0 with sodium hydroxide solution, and then salt is precipitated for 16 to 20 hours. After filtration and separation, the clear liquid is concentrated by vacuum distillation to a cytidylic acid concentration of 200 to 300 g / L. Anhydrous ethanol is added, and the mixture is stirred and crystallized at 0 to 4°C for 10 to 20 hours. The solid obtained by filtration and separation is the crude 5'-cytidylic acid. The crude product is further refined and dried to obtain the finished 5'-cytidylic acid.

6. The use according to claim 5, characterized in that: The enzyme solution obtained by fermentation culture of recombinant acid phosphatase engineering bacteria is as follows: a single colony of the recombinant acid phosphatase engineering bacteria pET28a-acid phosphatase-BL21 (DE3) is inoculated into an LB liquid culture medium containing kanamycin, and cultured at 37°C for 8 to 16 hours with shaking, and transferred to a TB culture medium with a 1% inoculation amount, and cultured at 37°C with shaking fermentation until the OD600 value reaches 0.8 to 1.0, and an inducer IPTG is added to make the final concentration of IPTG 0.5 mmol / L, and the temperature is lowered to 30°C, and the induction is carried out for 12 to 20 hours; after the fermentation culture is completed, the cells are collected by centrifugation, and the cells are resuspended in tap water and ultrasonically broken in an ice bath, and the broken liquid is centrifuged, and the supernatant is collected to obtain the recombinant acid phosphatase enzyme solution; The LB medium contains: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride (NaCl); sterilized at 121° C. for 20 min. The TB culture medium comprises: 12 g / L tryptone, 24 g / L yeast extract, 4 g / L glycerol, 2.31 g / L potassium dihydrogen phosphate, and 12.54 g / L potassium hydrogen phosphate; sterilized at 121° C. for 20 min.

7. The use according to claim 5, characterized in that: The concentration of the cytidine is 50-100 g / L, and the concentration of the sodium pyrophosphate is 100-200 g / L.

8. The use according to claim 5, characterized in that: The amount of anhydrous ethanol added is 2 to 3 times the volume of the concentrated solution.

9. The use according to claim 5, characterized in that: The steps of further refining the crude product are as follows: add the crude 5'-cytidylic acid into pure water, add activated carbon for decolorization after dissolution, filter, adjust the pH value to 3.0-4.0 with dilute hydrochloric acid solution, add 2-3 times the volume of anhydrous ethanol to the solution, crystallize at 0°C-4°C for 10-20h, separate the solid and liquid, and dry the solid to obtain the finished 5'-cytidylic acid.

Images