Tomato late blight resistant gene SlPin4 as well as cloning method and application thereof

Abstract

The invention provides a tomato late blight resistant gene SlPin4. The nucleotide sequence of the tomato late blight resistant gene SlPin4 is as shown in SEQ ID NO. 1; the invention provides a cloning method and application of the SlPin4 gene. The cloning method of the SlPin4 gene comprises the following steps: amplifying by using a PCR (Polymerase Chain Reaction) technology by taking a genome of a wild tomato early pollen No.2 as a template; the method comprises the following steps: connecting an amplified and purified PCR (Polymerase Chain Reaction) product with a pMD-19T cloning vector, transforming the constructed pMD-19T-SlPin4 into escherichia coli DH5alpha, selecting a single colony, shaking bacteria, extracting plasmids, sequencing, and indicating that a recombinant expression vector pBI121-SlPin4 is successfully constructed if the sequencing is correct; the invention also provides an application method of the gene, and overexpression of the SlPin4 can positively regulate and control disease-resistant related genes in tomatoes, so that the disease resistance of tomato plants is improved. The resistance of tomatoes to late blight is enhanced through transient overexpression of the SlPin4 gene, and the SlPin4 gene is of great significance to cultivation of disease-resistant tomatoes and increase of both production and income.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more specifically to a tomato late blight resistance gene SlPin4 and a cloning method and application thereof. Background Art

[0002] Tomato (Solanum lycopersicum), a common herbaceous plant in the Solanaceae family, contains a variety of nutrients. It can be eaten as both a vegetable and a fruit and is widely grown around the world. Late blight caused by Phytophthora infestans (P. infestans) is considered a devastating disease in tomato agricultural production. Once it occurs, it will cause huge economic losses. At present, late blight is commonly controlled by spraying pesticides, but this method has certain disadvantages, which will lead to problems such as pesticide abuse and environmental pollution, and has a serious impact on tomato agricultural production. Therefore, through the study of the molecular mechanism of the interaction between tomatoes and Phytophthora infestans, the key disease-resistant genes are discovered using molecular biological methods, and resistant varieties are cultivated through genetic engineering, which has become an important means of late blight control and can effectively prevent and control the occurrence of tomato late blight.

[0003] Plants display a variety of coping strategies when faced with pathogens (such as viruses, fungi, or bacteria). The interactions that occur during this process can be divided into three main categories: one is non-interaction, in which the pathogen cannot replicate and the plant does not show obvious signs of disease; the second is compatible interaction, in which the pathogen successfully invades the plant and establishes an initial infection in the plant, then reproduces and spreads, which is usually accompanied by the accumulation of a large number of pathogens and causes symptoms that vary in severity, ranging from mild to unnoticeable to very severe; the third is incompatible interaction, in which the pathogen establishes an initial infection in a local area of ​​the plant, but due to the lack of systematic transmission, the plant itself actively resists the invasion of the pathogen, thereby limiting the pathogen to the area around the initial infection site. In the third interaction, plants synthesize and release a large number of different types of proteins, among which pathogenesis-related proteins (PRs) are a particularly critical group that play a pivotal role in plant defense responses.

[0004] PR proteins were originally named "b" proteins because they may be involved in plant resistance to pathogens, which has attracted widespread attention from researchers. Since the discovery of PR proteins in tobacco, researchers have also found their presence in many different genera of monocots and dicots, indicating that PR proteins are widely distributed in plants. Normally, PR proteins are expressed at low levels or difficult to detect in healthy plants, but they are highly expressed under stress conditions.

[0005] Plant responses to biotic and abiotic stresses are complex and involve cellular, molecular, and genetic changes. When plants recognize pathogens, signaling pathways are activated, leading to the formation of reactive oxygen species (ROS), protein kinases, phytohormones, phytoalexins, phenolic compounds, and pathogenesis-related proteins, as well as hypersensitivity responses. During pathogen attack, it is critical for plants to produce and accumulate PR proteins, which can directly affect the integrity of pathogens or produce signaling molecules through their enzymatic behavior, which stimulates other pathways associated with plant defense. Among them, protease inhibitors (PIs) are considered to be the PR6 family, which is a larger family. PIs have been identified in about 104 plant species, such as Leguminosae, Poaceae, and Solanaceae. In order to better study the functions of protease inhibitors, researchers have divided them into serine, cysteine, aspartate, and metalloproteinase inhibitors according to the types of proteases they inhibit. Existing reports show that more than 6,700 plant PIs have been studied. SPI is a large class of complex plant proteins that can specifically act on serine proteases and is one of the most widely studied PIs. According to the characteristics of amino acid composition and arrangement order, topoisomerism and protease binding properties, SPIs are divided into four families: potato proteinase inhibitor I (PinI), potato proteinase inhibitor II (PinII), Kunitz trypsin inhibitor (KTI) and Bowman-Birk trypsin inhibitor (BBTI). The PinⅡ family is one of the earliest identified plant PIs, mainly found in Solanaceae plants such as potato, tomato, tobacco and pepper. The PinⅡ family contains multiple members and has conserved sequences, but its research is relatively weak.

[0006] Protease inhibitors play an important role in both biotic and abiotic stresses. Studies have shown that overexpression of the wheat WRSI5 gene of the BBI (Bowman-Birk Inhibitors) inhibitor family in Arabidopsis can significantly improve its salt resistance; in terms of insect resistance, since most of the digestive proteases in the intestine of insects are chymotrypsin and trypsin, these two types of proteases are affected by serine protease inhibitors, which inhibit the growth and development of insects, thereby protecting the plants; a trypsin inhibitor APIP4 was found in rice, and the transgenic strains significantly enhanced the resistance to rice blast fungus, while the knockout strains of APIP4 significantly weakened the resistance to rice blast fungus. It is proved that the rice trypsin inhibitor APIP4 plays an important role in rice immunity; studies have shown that the transcription factor APIP5 transcriptionally inhibits the expression of trypsin inhibitor genes OsBBTI5 and APIP4. Genetic analysis shows that OsBBTI5 and APIP4 positively regulate resistance to rice blast and bacterial blight. OsBBTI5 and APIP4 mainly improve rice disease resistance by promoting the accumulation of pathogenesis-related protein OsPR1aL; in Arabidopsis, CYS6 can be significantly induced by Botrytis cinerea. In the resting state, phosphorylated and ubiquitinated RBOHD proteins are transported to the vacuole through vesicles and degraded by XCP1 to limit the production of ROS; when infected by pathogens, CYS6 can inhibit the degradation of RBOHD by XCP1, resulting in the accumulation of RBOHD proteins to promote ROS burst and plant resistance. At present, the research on protease inhibitors is mainly focused on Arabidopsis and potato, and less research is done on tomatoes. The role of SlPinⅡs in tomato resistance to late blight has not been reported, and its specific mechanism in tomato resistance to late blight is still unclear. Summary of the invention

[0007] The present invention provides a tomato late blight resistance gene SlPin4 gene and a cloning method thereof, and provides an application method of the gene in tomato late blight resistance. By constructing a transient expression vector, the role of SlPin4 in tomato disease resistance is understood, and the molecular regulatory mechanism of tomato late blight resistance is revealed, which is of great significance to the cultivation of late blight resistant tomato varieties and the protection of the tomato industry.

[0008] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0009] In a first aspect of the present invention, a tomato late blight resistance gene SlPin4 is provided, the nucleotide sequence of which is shown as SEQ ID NO.1.

[0010] Specifically, the present invention uses a bioinformatics prediction method and combines laboratory preliminary transcriptome data to preliminarily determine the target SlPin4 gene, and detects the changes in the expression level of the SlPinⅡ gene at various time points after the late blight pathogen infects the tomato plant, thereby determining the PinⅡ gene that may improve the resistance of tomatoes to the late blight pathogen, and its nucleotide sequence is shown in SEQ ID NO.1.

[0011] The second aspect of the present invention provides a method for cloning the tomato late blight resistance gene SlPin4, comprising the following steps:

[0012] S1, using the wild-type Zaofen 2 genome as a template, PCR amplification was performed using specific primers;

[0013] The specific primers are:

[0014] SlPin4-FP: CGCGGATCCAAGCATATCTACAATGGCTG

[0015] SlPin4-RP:CGAGCTCAACTTCCTTATGCTGTGGAA

[0016] S2, connecting the PCR product obtained in step S1 with the pMD-19T cloning vector to obtain a connection product pMD-19T-SlPin4;

[0017] S3. The ligation product pMD-19T-SlPin4 was transformed into Escherichia coli DH5α competent cells, and the positive monoclonal colonies were picked after overnight culture in LB solid medium containing ampicillin, and the plasmids were extracted by shaking. PCR verification was performed using the specific primers and then sent for sequencing. The sequencing result was a plasmid such as SEQ ID NO.1, which indicated that the sequencing was correct.

[0018] In a preferred embodiment, the wild-type tomato variety Zaofen 2 is susceptible to late blight.

[0019] The third aspect of the present invention provides an application of the tomato late blight resistance gene SlPin4 prepared by the above cloning method, which is used to improve the resistance of tomato plants to late blight pathogens.

[0020] In the preferred embodiment, the above application is implemented through the following steps:

[0021] (1) The pMD-19T-SlPin4 recombinant plasmid was connected to the high-efficiency expression vector pBI121 containing the 35S promoter to construct a recombinant expression vector of the tomato late blight resistance gene SlPin4;

[0022] (2) The recombinant expression vector of the tomato late blight resistance gene SlPin4 described in step (1) was transformed into Agrobacterium GV3101 competent cells, and after shaking culture at 28° C. and 180 rpm for 2 to 3 hours, the bacterial solution was evenly spread on a YEB solid medium containing kanamycin, streptomycin and rifampicin. After 48 hours of dark culture, a single colony was picked for bacterial solution PCR verification. If the verification was correct, a positive engineering bacterial solution was obtained;

[0023] (3) Five-leaf tomatoes were selected as treatment objects, and the prepared positive engineered bacterial solution was introduced into the leaves of the five-leaf tomatoes by injection, thereby achieving overexpression of the tomato late blight resistance gene SlPin4.

[0024] In a preferred embodiment, the preparation method of the pMD-19T-SlPin4 recombinant plasmid in the above application comprises the following steps: using the wild-type early pink 2 genome as a template, performing PCR amplification using specific primers, and connecting the obtained PCR product with the pMD-19T cloning vector to obtain the pMD-19T-SlPin4 recombinant plasmid;

[0025] The specific primers are:

[0026] SlPin4-FP: CGCGGATCCAAGCATATCTACAATGGCTG

[0027] SlPin4-RP:CGAGCTCAACTTCCTTATGCTGTGGAA.

[0028] The beneficial effects of the present invention are as follows:

[0029] At present, there are no reports on the role of SlPin4 in tomato resistance to late blight. The present invention uses bioinformatics prediction methods to preliminarily analyze PinⅡ family members in tomatoes, uses real-time fluorescence quantitative PCR to measure the changes in gene expression levels of each member at different time points, and further combines laboratory preliminary transcriptome data to screen out PinⅡ genes that may improve tomato resistance to late blight.

[0030] The present invention cloned a tomato late blight resistance gene SlPin4 from the tomato genome, constructed a recombinant expression vector containing the tomato late blight resistance gene SlPin4, and regulated the tomato late blight resistance gene by overexpressing the gene SlPin4.

[0031] Specifically, SlPin4, as a type of PRs, can regulate immune-related responses in plants. The expression level of SlPin4 in the transient overexpression plants obtained by the method of the present invention is higher than that in the empty-loaded plants, and the late blight resistance effect is better. The present invention achieves positive regulation of tomato late blight-related resistance genes by overexpressing the SlPin4 gene, thereby enhancing the resistance of tomato plants to late blight pathogens, which is of great significance for the cultivation of late blight-resistant tomato varieties and the protection of the tomato industry.

[0032] At the same time, SlPin4 can synergistically increase the transcriptional accumulation of other disease resistance proteins PR in the plant, which can be used as a widely useful crop immune stimulant for tomato against a variety of pathogens. Therefore, our research will provide new ideas for crop protection and pesticide development. In addition, these advances may provide a reference point for crop disease resistance breeding and lay a theoretical foundation for effective and broad-spectrum disease management in modern agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is the expression level of SlPin4 gene at each time point of infection by late blight pathogen;

[0034] Figure 2 is the expression level of overexpressed SlPin4;

[0035] Figure 3 The lesion area and disease resistance phenotype of detached leaves;

[0036] Figure 4 is the PRs gene expression level in leaves of empty vector and SlPin4 overexpression cells. DETAILED DESCRIPTION

[0037] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0038] The present invention uses a bioinformatics prediction method to preliminarily analyze the PinⅡ family members in tomatoes, uses real-time fluorescence quantitative PCR to measure the changes in the gene expression levels of each member at different time points, and further combines the laboratory's previous transcriptome data to screen out PinⅡ genes that may improve tomato's resistance to late blight. A tomato late blight resistance gene SlPin4 was cloned from the tomato genome, and its sequence is shown in SEQ ID NO.1.

[0039] The method for cloning the tomato late blight resistance gene SlPin4 comprises the following steps:

[0040] S1. Using the wild-type tomato Zaofen 2 genome as a template, specific primers were used to perform PCR amplification. The sequences of the specific primers are:

[0041] SlPin4-FP:GCGGATCCGAAGATAACGCACCGATCA

[0042] SlPin4-RP: CGGAGCTCGCACCACTGTCACTTTATTTG

[0043] S2. The PCR product was purified and recovered and then connected with the pMD-19T cloning vector to obtain the connection product pMD-19T-SlPin4.

[0044] S3. The above ligation product is transformed into Escherichia coli DH5α competent cells, and the positive monoclonal colonies are picked after overnight culture in LB solid medium containing ampicillin, and the plasmid is extracted by shaking the bacteria. The PCR verification is performed using the above specific primers and then sent for sequencing. The plasmid with sequencing results such as SEQ ID NO.1 is the desired ligation product.

[0045] The present invention also provides an application method of the tomato late blight resistance gene SlPin4, which is used to improve the resistance of tomatoes to late blight pathogens, indicating that it plays an important role in tomato response to biological stress.

[0046] The application method of the tomato late blight resistance gene S1Pin4 comprises the following steps:

[0047] (1) The successfully connected pMD-19T-SlPin4 product was connected to the high-efficiency expression vector pBI121 containing the 35S promoter to construct a recombinant expression vector of the tomato late blight resistance gene SlPin4;

[0048] (2) The recombinant expression vector was transformed into Agrobacterium GV3101 competent cells, and after shaking culture at 28°C and 180 rpm for 2-3 hours, the bacterial solution was evenly spread on YEB solid medium containing kanamycin, streptomycin and rifampicin. After 48 hours of dark culture, a single colony was picked for bacterial solution PCR verification. If the verification was correct, the positive engineering bacterial solution was obtained;

[0049] (3) Tomato leaves at the five-leaf stage with consistent growth were selected as the treatment objects, and the positive engineered bacterial solution was injected into the back of the leaves using a disposable syringe, thereby achieving overexpression of the tomato late blight resistance gene SlPin4.

[0050] Specifically, the preparation method of the successfully connected pMD-19T-SlPin4 product is the same as S1 to S2 above. The method for constructing a recombinant expression vector of the tomato late blight resistance gene SlPin4 includes double digesting the pMD-19T-SlPin4 plasmid with a correct sequencing result with restriction endonucleases BamH I and Sac I, purifying the target fragment, connecting the target fragment with the pBI121 expression vector from which the GUS gene has been removed, inserting the target fragment into the 35S promoter site of the pBI121 expression vector, transforming the connection product into Escherichia coli DH5α and evenly coating it on an LB solid culture medium containing kanamycin, picking a single colony after overnight culture, shaking the bacteria to extract the plasmid, and sending the plasmid for sequencing after PCR identification. If the sequencing is correct, the recombinant expression vector pBI121-SlPin4 is successfully constructed.

[0051] Example 1: Determination of the target tomato late blight resistance gene SlPin4

[0052] 1. Cultivation of tomato plants: Soak the Zaofen No. 2 tomato seeds in pure water for 24 hours, place them evenly on moist filter paper in a 28°C incubator, transfer them to soil after 5 days, and cultivate them at 28°C, 16 hours of light and 8 hours of darkness until the five-leaf stage.

[0053] 2. Cultivation and inoculation of late blight: Inoculate the late blight strain on a fresh rye solid culture medium, invert and culture in a dark environment at 20°C for about three weeks, gently scrape off the mycelium, rinse with sterile water, and filter with gauze. After sealing the bottle mouth, place it at 4°C for 1 hour to release spores, and adjust the final concentration of the late blight spore suspension to 1×10 6 / mL, and obtain the spore suspension of late blight fungus. The formula of rye culture medium is as follows:

[0054]

[0055] 3. Treatment and sampling of tomato seedlings: Take five-leaf tomato plants with good and consistent growth conditions as the treatment objects, spray the leaves and stems with the above-mentioned late blight fungus spore suspension until water drips, cover with plastic film to keep moisture, and culture in the dark for one night, then place in an environment of 20±2℃ with 16h light and 8h dark. After inoculation and culture for 0d, 1d, 2d, 3d, 4d, and 5d, cut the tomato leaves respectively, freeze them with liquid nitrogen, and then grind them for sampling.

[0056] 4. RNA extraction, reverse transcription and real-time fluorescence quantitative PCR reaction: Take an appropriate amount of fully ground powder and add it to 1mL pre-cooled Trizol, shake well, and let it stand at room temperature for 5 minutes. Take the supernatant and add 200μL chloroform, shake and mix, and centrifuge at 4℃, 12000r / min for 10min. Transfer the supernatant to a new centrifuge tube and add an equal volume of pre-cooled isopropanol, repeatedly invert 8 to 10 times to mix, and centrifuge at 4℃, 12000r / min for 10min. Discard the supernatant, add 1mL of freshly prepared 75% ethanol, wash the precipitate, and centrifuge at 4℃, 12000r / min for 5min. Discard the supernatant, open the lid and let it stand until the remaining ethanol is completely evaporated, then add 25μL RNase Free dH2O to fully dissolve the precipitate. Take 3μL RNA and use 1% agarose gel electrophoresis to detect the purity and quality of the extracted RNA. The extracted RNA was reverse transcribed with the mRNA reagent PrimeScript TM RT Master Mix (purchased from TaKaRa) was reverse transcribed into cDNA template, and the real-time fluorescence quantitative reagent SYBR Green qPCR MasterMixⅡ (purchased from Seven) was used to detect the expression of SlPin4 gene at the above time points. The data obtained by real-time fluorescence quantitative PCR reaction were calculated using the 2-ΔΔCt method using relative expression. The results showed that after 24 hours of infection with late blight, the expression level of SlPin4 was significantly upregulated, proving that the expression of SlPin4 gene was strongly induced by late blight ( Figure 1 ); Based on the degree of expression change and the preliminary laboratory data, the SlPin4 gene that may improve the resistance of tomatoes to late blight was preliminarily determined, and the nucleotide sequence is shown in SEQ ID NO.1.

[0057] The above reverse transcription system is:

[0058]

[0059] The reaction conditions were 37°C, 15 min, 85°C, 5 sec.

[0060] The above-mentioned real-time fluorescence quantitative PCR reaction system is:

[0061]

[0062] The reaction conditions are as follows:

[0063]

[0064] Example 2: Cloning of the tomato late blight resistance gene SlPin4

[0065] 1. Extraction of Tomato Genome

[0066] Referring to the instructions of the genome extraction kit (purchased from Vazyme), 100 mg of fresh wild-type Zaofen No. 2 tomato leaves were taken to extract tomato genomic DNA. The specific operation method is as follows:

[0067] (1) Place the cut tomato leaves in a sterilized mortar, pour liquid nitrogen into the mortar, freeze and grind into powder, add 400 μL Buffer A1 and 4 μL RNase A (10 mg / mL), vortex and shake, mix thoroughly, and place in a 65°C water bath for 10 min;

[0068] (2) Add 130 μL of Buffer A2 to the centrifuge tube, vortex and mix thoroughly, place on ice for 5 min, centrifuge at 12,000 rpm for 10 min, and carefully transfer the supernatant to a new 1.5 ml sterile centrifuge tube;

[0069] (3) Use a pipette to calculate the amount of supernatant, add 1.5 times the volume of Buffer A3 (with anhydrous ethanol added) to the supernatant, and immediately mix by pipetting;

[0070] (4) Transfer the above mixture to FastPure gDNA Columns IV, centrifuge at 12000 r / min for 60 seconds, and discard the filtrate;

[0071] (5) Add 600 μL of Buffer AW (with anhydrous ethanol added) around the filter column, vortex to mix thoroughly, centrifuge at 12,000 rpm for 30 seconds, discard the filtrate, and repeat this step again;

[0072] (6) Place the adsorption column back into the collection tube, spin at 12,000 r / min for 2 min, remove the rinse solution, and place it on sterile filter paper with the lid open and inverted for 5 min at room temperature until the remaining ethanol evaporates completely;

[0073] (7) Transfer the adsorption column to a new 1.5 mL sterile centrifuge tube, preheat the Elution Buffer to 65-70 °C, and use a pipette to drop 50 μL onto the center of the membrane of the adsorption column. Let it stand at room temperature for 5 min, and centrifuge it at 12,000 rpm for 1 min. The collected liquid is the tomato genomic DNA.

[0074] 2. PCR Amplification of SlPin4 Gene

[0075] The tomato genomic DNA extracted as above was used as a template and specific primers were used to perform PCR amplification.

[0076] The specific primers used for cloning are as follows:

[0077] SlPin4-FP: CGCGGATCCAAGCATATCTACAATGGCTG

[0078] SlPin4-RP:CGAGCTCAACTTCCTTATGCTGTGGAA

[0079] The reaction conditions are as follows:

[0080] 94℃5min

[0081]

[0082] 3. Recovery and purification of PCR amplification products

[0083] After the PCR product was detected by 1% agarose gel electrophoresis, the target band was determined in the gel illuminator, cut off and added to a centrifuge tube. Weigh the cut gel block, convert it according to the instructions of the product purification kit (purchased from vazyme), add the sol solution, and place it in a 55°C water bath and turn it upside down until the gel block is completely dissolved. Transfer the sol solution to the adsorption column and centrifuge it at 12000r / min for 60s, and pour out the liquid in the centrifuge tube. Add PW rinse solution to the adsorption column, centrifuge for 30-60s, pour out the liquid, repeat this process twice and centrifuge for 2min. Open the lid and let it stand to wait for the rinse solution to dry, then place the adsorption column on a new centrifuge tube, draw 50μL ddH2O and drop it in the middle of the adsorption membrane, place it at room temperature for 2min, then 12000r / min for 2min to recover the target fragment.

[0084] 4. Connect the target fragment to the cloning vector

[0085] The target fragment recovered above was connected to the cloning vector pMD-19T (purchased from TaKaRa), and the reaction system was as follows:

[0086]

[0087] The ligation product pMD-19T-SlPin4 was obtained by ligation at 16°C for 8 h.

[0088] 5. Transformation of E. coli with ligation products

[0089] (1) Take the frozen E. coli DH5α bacteria and resuscitate them. Pick a single clone and culture it in LB liquid medium overnight. Pipette 500 μL of the activated E. coli into 15 mL of LB liquid medium and shake and culture it. Wait until the OD value of the bacterial solution reaches 0. 600 When the value reaches about 0.6, ice-bathe the bacterial solution for 30 minutes, centrifuge and collect the bacteria, and resuspend them in pre-cooled 0.1M CaCl2. Ice-bathe again for 30 minutes, centrifuge and collect the bacteria, and resuspend them in 0.1M CaCl2 to obtain competent E. coli;

[0090] (2) Add 10 μL of the ligation product to the above 200 μL of E. coli competent cells, gently pipette to mix, place on ice for 30 min, immediately transfer to a 42°C water bath for heat shock for 90 s, take out and place on ice again for 2 min;

[0091] (3) Add 1000 μL of fresh LB liquid culture medium without antibiotics, and incubate at 37°C with shaking at 180 rpm for 1 h.

[0092] (4) After 1 hour, centrifuge the bacterial solution at 12,000 rpm for 30 seconds, discard the culture medium, use the remaining small amount of liquid to resuspend the bacteria at the bottom of the centrifuge tube, spread it on a LB solid culture medium plate containing 50 mg / L ampicillin using a sterile glass spreading rod, and place it in a 37°C incubator for overnight culture;

[0093] (5) Pick a white single colony with a regular shape and inoculate it into a fresh LB liquid medium containing 50 mg / L ampicillin. Incubate overnight in a 37°C constant temperature shaker at 180 rpm. The LB medium is as follows:

[0094]

[0095] 6. Extraction of pMD-19T-SlPin4 plasmid

[0096] According to the instructions of the plasmid mini-extraction kit (purchased from TIANGEN), the pMD-19T-SlPin4 plasmid contained in the above bacterial solution was extracted. 5 μL of the plasmid sample was taken for 1% agarose gel electrophoresis detection.

[0097] 7. Plasmid PCR Detection

[0098] The extracted pMD-19T-SlPin4 plasmid was used as a template and SlPin4-FP and SlPin4-RP were used as primers for PCR verification. The verified plasmid was sent for sequencing. Correct sequencing indicated that pMD-19T-SlPin4 was successfully constructed.

[0099] Example 3: Construction of a recombinant expression vector for the tomato late blight resistance gene SlPin4

[0100] 1. Enzyme digestion of pMD-19T-SlPin4 plasmid

[0101] The pMD-19T-SlPin4 plasmid was double-digested with BamH I and Sac I (purchased from Takara), and the target fragment was recovered by gel. The enzyme digestion reaction system and method are as follows:

[0102]

[0103] The enzyme digestion was carried out in a constant temperature metal bath at 37°C for 2 h, and the digestion products were detected by 1% agarose gel electrophoresis.

[0104] 2. Double restriction enzyme digestion of pBI121 plasmid

[0105] The extracted pBI121 plasmid was double-digested with restriction endonucleases BamHI and Sac I to remove the GUS gene portion, and the large fragment recovered by gel was the pBI121 fragment used for subsequent ligation. The reaction system is as follows:

[0106]

[0107] The enzyme digestion was carried out at 37°C in a metal bath for 2 h, and the digestion products were detected by 1% agarose gel electrophoresis.

[0108] 3. Connect the target fragment to the pBI121 vector

[0109] The target fragment recovered from the gel excision and the pBI121 vector with the GUS gene removed were ligated at a ratio of 3:1 using T4 DNA ligase (purchased from TaKaRa). The reaction system is as follows:

[0110]

[0111] The cells were connected in a 16°C constant temperature metal bath for 5 h. The ligation product was transformed into Escherichia coli according to the method of "Example 2, 5". The cells were then evenly spread on LB solid culture medium containing kanamycin. Single colonies were picked and the plasmids were extracted by shaking. After plasmid PCR verification, the plasmids were sent for sequencing. The recombinant expression vector pBI121-SlPin4 was the one with the correct sequencing result.

[0112] Example 4: Application of the tomato late blight resistance gene SlPin4

[0113] 1. Preparation of pBI121-SlPin4 Agrobacterium engineering bacteria

[0114] (1) Add 1 mL of activated Agrobacterium GV3101 bacterial suspension to fresh YEB liquid culture medium, shake at 180 rpm for 6-7 h at 28°C, ice bath for 30 min, centrifuge at low temperature for 10 min, discard the supernatant, gently pipette and resuspend the bacteria with pre-cooled 20 mM CaCl2, centrifuge at low temperature for 10 min, discard the supernatant and resuspend with CaCl2 again to obtain Agrobacterium competent state.

[0115] (2) Pipette 5 μL of pBI121-SlPin4 plasmid into 200 μL of Agrobacterium competent cells, gently pipette to mix, and then place in an ice water bath for 30 min. Then quickly transfer to liquid nitrogen and freeze for 5 min.

[0116] (3) The frozen mixture was placed in a 37°C water bath for 5 min, 1 mL of fresh YEB medium was added, and cultured at 28°C with shaking at 180 rpm for 3 h;

[0117] (4) The obtained bacterial solution was centrifuged at 4000 rpm for 10 min, 1 mL of supernatant was discarded, and the bacteria were resuspended with the remaining bacterial solution. The bacteria were evenly spread on YEB solid medium containing streptomycin, rifampicin and kanamycin using a sterilized spreading rod and incubated at 28°C for 36 h.

[0118] (5) PCR detection of Agrobacterium engineering bacteria

[0119] Pick the colonies on the antibiotic-containing solid medium, place them in 1 mL of fresh YEB liquid medium, and culture them at 28°C, 180 rpm with shaking for 16-17 hours. Use SlPin4 specific primers for PCR verification, and the reaction conditions and reaction system are the same as those in "Example 2, 2". The YEB medium is shown in the following table:

[0120]

[0121] 2. Identification of positive clones

[0122] After inverted culture at 28°C for 48 hours, single colonies on the plate were picked and cultured in YEB liquid medium containing antibiotics with shaking, and then PCR verification of bacterial solution was performed using specific primers. An equal volume of 50% glycerol was added to the positive clone bacterial solution and cryopreserved.

[0123] 3. Establishment of transient infection system and related tests

[0124] (1) Preparation of transient infection fluid

[0125] ① Inoculate the activated Agrobacterium containing pBI121 empty vector (EV) and pBI121-SlPin4 into 15 mL of YEB liquid medium containing 100 mg / L Str, 100 mg / L Rif and 50 mg / L Kana, and culture at 28°C with shaking at 180 rpm for 12 to 16 hours;

[0126] ② Take 1 mL of activated bacterial solution and add it to fresh YEP medium containing 100 mg / L Str, 100 mg / L Rif, 50 mg / L Kana, 10 mmol / L MES (morpholineethanesulfonic acid monohydrate), 20 μmol / L AS (acetosyringone) and 2 mmol / L MgSO4, and culture at 28°C, 180 rpm shaking for 12-16 hours;

[0127] ③ After low-temperature centrifugation, discard the supernatant and collect the cells. Resuspend the cells with MMA solution (containing 10mmol / L MgCl2, 10mmol / LMES, 20μmol / L AS, pH 5.6) and adjust the OD 600 The value is about 1.0, 28°C, shaking at 180 rpm for 3 h;

[0128] (2) Transient transformation of tomato plants

[0129] ① Before transformation, five-leaf tomato leaves with consistent growth and good growth conditions were selected as experimental materials. After 1-2 hours of weak light treatment, the above-mentioned instant infection solution was injected into the back of the leaves with a disposable syringe without a needle; the treated tomatoes were placed in the dark at 25°C overnight and cultured under a 16h / 8h photoperiod for 3 days. Three biological replicates were performed for each group of experiments.

[0130] ② Take the tomato leaves after overexpression for 3 days, grind them into powder in a mortar with liquid nitrogen, and extract RNA as described above in "Example 1, 4". Take 3 μL of the extracted RNA and use 1% agarose gel electrophoresis to detect purity and quality.

[0131] ③Use the extracted RNA for reverse transcription using the mRNA reverse transcription reagent PrimeScript TM RT Master Mix (purchased from TaKaRa) was reverse transcribed into cDNA template, and the qPCR reaction was completed using the real-time fluorescence quantitative reagent SYBR Green qPCR MasterMixⅡ (purchased from Seven). The real-time fluorescence quantitative primers of the SlPin4 gene used in the real-time fluorescence quantitative experiment are shown in Table 1. The results showed that the expression level of SlPin4 in the plants transiently overexpressing SlPin4 increased by about 7.6 times compared with the EV group ( Figure 2 ).

[0132] (3) Inoculation of late blight on detached leaves

[0133] ① Inoculate the late blight fungus on fresh rye culture medium, invert and culture in a dark environment at 20℃ for three weeks, scrape off the mycelium, rinse with sterile water, and filter with gauze. After sealing the bottle mouth, place it at 4℃ for 1 to 3 hours to release spores, and adjust the final concentration of the late blight fungus spore suspension to 1×10 6 Pieces / mL.

[0134] ② Pick the EV and pBI121-SlPin4 tomato leaves after 2 days of treatment, poke a small wound in the middle of the leaf with a sterile toothpick and place it on a sterile moist filter paper in a culture dish;

[0135] ③ Take 25 μL of the above spore suspension and drip it on the wound of the leaf, seal it with plastic wrap, and incubate it in the dark at 20℃ for 5 days. Take photos to observe the area of ​​the lesions, and then perform trypan blue staining. It was found that the lesions on the leaves with transient overexpression of SlPin4 were significantly smaller than those on the leaves with transient overexpression of the empty vector ( Figure 3 ). qPCR was used to measure the expression level of the pathogenesis-related protein SlPRs after overexpression of SlPin4 ( Figure 4 ), in the real-time fluorescence quantitative PCR experiment, the real-time fluorescence quantitative primers of the PR gene used are shown in Table 1, and the reaction system and conditions are shown in Example 1, 4. The results showed that the tomato leaves of the SlPin4 overexpression group (TOESlPin4) had a lower incidence than EV, and the lesion diameter was significantly smaller. And the expression level of SlPRs in TOESlPin4 was significantly higher than that in EV. After statistical analysis, it was found that the relative lesion area on the leaves transiently overexpressing SlPin4 was significantly smaller than the relative lesion area on the leaves transiently overexpressing empty load ( Figure 3 ).

[0136] Table 1 Primers used for real-time quantitative PCR

[0137]

[0138]

[0139] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0140]

Claims

1. A tomato late blight resistance gene SlPin4, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for cloning the tomato late blight resistance gene SlPin4 according to claim 1, characterized in that: The steps include: S1, using the wild-type Zaofen 2 genome as a template, PCR amplification was performed using specific primers; The specific primers are: SlPin4-FP: CGCGGATCCAAGCATATCTACAATGGCTG SlPin4-RP:CGAGCTCAACTTCCTTATGCTGTGGAA S2, connecting the PCR product obtained in step S1 with the pMD-19T cloning vector to obtain a connection product pMD-19T-SlPin4; S3. The ligation product pMD-19T-SlPin4 was transformed into Escherichia coli DH5α competent cells, and the positive monoclonal colonies were picked after being cultured in LB solid medium containing ampicillin, and the plasmids were extracted by shaking. PCR verification was performed using the specific primers and then sent for sequencing. If the sequencing result was the plasmid of SEQ ID NO.1, the plasmid was correct.

3. The method for cloning the tomato late blight resistance gene SLPin4 according to claim 2, characterized in that: The wild type tomato Zaofen 2 is susceptible to late blight.

4. An application of the tomato late blight resistance gene SlPin4 prepared by the cloning method according to any one of claims 2 to 3, characterized in that: Used to improve the resistance of tomato plants to late blight.

5. The use according to claim 4, characterized in that: This is accomplished by the following steps: (1) The pMD-19T-SlPin4 recombinant plasmid was connected to the high-efficiency expression vector pBI121 containing the 35S promoter to construct a recombinant expression vector of the tomato late blight resistance gene SlPin4; (2) The recombinant expression vector of the tomato late blight resistance gene SlPin4 described in step (1) was transformed into Agrobacterium GV3101 competent cells, and after shaking culture at 28° C. and 180 rpm for 2 to 3 hours, the bacterial solution was evenly spread on a YEB solid medium containing kanamycin, streptomycin and rifampicin. After 48 hours of dark culture, a single colony was picked for bacterial solution PCR verification. If the verification was correct, a positive engineering bacterial solution was obtained; (3) Five-leaf tomatoes were selected as treatment objects, and the prepared positive engineered bacterial solution was introduced into the leaves of the five-leaf tomatoes by injection, thereby achieving transient overexpression of the tomato late blight resistance gene SlPin4.

6. The use according to claim 4, characterized in that: The preparation method of the pMD-19T-SlPin4 recombinant plasmid comprises the following steps: using the wild-type early pink 2 genome as a template, performing PCR amplification using specific primers, and connecting the obtained PCR product with the pMD-19T cloning vector to obtain the pMD-19T-SlPin4 recombinant plasmid; The specific primers are: SlPin4-FP: CGCGGATCCAAGCATATCTACAATGGCTG SlPin4-RP: CGAGCTCAACTTCCTTATGCTGTGGAA.

Images