Application of Desi1 protein in rice sheath blight resistance

Abstract

The invention provides application of Desi1 protein in rice sheath blight resistance, and belongs to the technical field of biology. The invention provides application of Desi1 protein in regulation and control of rice sheath blight resistance. The amino acid sequence of the Desi1 protein is as shown in SEQ ID No. 1. According to the invention, a Desi1 overexpression transgenic plant Desi1-OX is obtained through an overexpression transgenic technology, and compared with wild type rice, the Desi1-OX is more resistant to rice sheath blight disease. The encoding gene of the Desi1 protein in the receptor rice is subjected to gene editing through CRISPR / Cas9 gene editing, and the obtained Desi1 mutant transgenic plant desi1 is more susceptible to the rice sheath blight disease. The invention proves that Desi1 protein is related to the resistance of rice to sheath blight disease, the resistance of rice to sheath blight disease is enhanced by over-expression of Desi1, and the Desi1 protein can be used for creating new germplasm with resistance to rice sheath blight disease.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of Desi1 protein in rice resistance to sheath blight. Background Art

[0002] As the main staple food crop in my country, rice occupies a pivotal position in the country's grain production. Rice sheath blight is a worldwide disease caused by Rhizoctonia solani Kühn. Under suitable environmental conditions, sheath blight can cause rice production to decrease by up to 50%, posing a serious threat to production. At present, the main means of disease prevention and control is chemical control, but chemical control is costly, pollutes the environment, and is prone to drug resistance. Therefore, it is particularly urgent to adopt economical and environmentally friendly prevention and control measures. Breeding and cultivating disease-resistant varieties is the most economical, safe and effective prevention and control strategy for rice sheath blight.

[0003] Protein SUMOylation is a post-translational modification widely found in eukaryotic cells. SUMOylation regulates protein-protein interactions, subcellular localization, activity or stability of substrate proteins, etc. SUMOylation is always in a dynamic equilibrium, and its level is regulated by SUMO proteases. It has been reported that there are two types of SUMO proteases in plants, namely ubiquitin-like protease (ULP) and deSUMOylating isopeptidase (Desi). Compared with ULP SUMO proteases, Desi SUMO proteases have little reported on their intracellular functions and substrates. SUMO proteases can interact with SUMO-modified substrate proteins to cleave the modified SUMO molecules, causing the protein to be deSUMOylated (deSUMOylation). The cleaved SUMO molecules can still participate in SUMOylation in a cycle (Morrell and Sadanandom, 2019). SUMO modification is involved in the regulation of numerous biological processes, including stress response, signal transduction, cell cycle, protein transport, transcription, translation, DNA damage response, chromatin integrity and nuclear transport (Hannoun et al., 2016; Seeler et al., 2003; van den Burg et al., 2010; Wohlschlegel et al., 2004). In plants and animals, SUMO modification is mainly involved in the regulation of immune response (Hannoun et al., 2016; van den Burg et al., 2010). In recent years, a large number of studies have shown that SUMOylation plays a vital role in regulating plant immune response. However, whether SUMOylation is involved in regulating the interaction between rice and Rhizoctonia solani has not been reported. Summary of the invention

[0004] The present invention provides an application of Desi1 protein in rice resistance to sheath blight. SUMO protease Desi1 positively regulates the defense response of rice to sheath blight. Desi1 knockout makes rice more sensitive to sheath blight. Desi1 overexpression enhances rice resistance to sheath blight, which is of great significance to the creation of rice germplasm resources resistant to sheath blight and the effective prevention and control of sheath blight.

[0005] The present invention provides application of Desi1 protein in regulating resistance to rice sheath blight. The amino acid sequence of the Desi1 protein is shown in SEQ ID No.1.

[0006] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the Desi1 protein is shown as SEQ ID No.2.

[0007] In a specific embodiment of the present invention, the regulation includes: enhancing the sensitivity of rice to sheath blight after knocking out the gene encoding the Desi1 protein; enhancing the resistance of rice to sheath blight after overexpressing the gene encoding the Desi1 protein.

[0008] The present invention provides application of Desi1 gene in creating rice germplasm related to resistance to rice sheath blight. The nucleotide sequence of the Desi1 gene is shown in SEQ ID No.2.

[0009] The present invention provides a method for creating rice germplasm related to rice sheath blight resistance, comprising knocking out or overexpressing a Desi1 gene in a rice genome, wherein the nucleotide sequence of the Desi1 gene is shown in SEQ ID No.2.

[0010] In a specific embodiment of the present invention, the knockout method includes a CRISPR / Cas9 gene editing method, and the nucleotide sequence of the sgRNA used is shown in SEQ ID No. 3: CGACATCTCGCCGCGGTACA.

[0011] In a specific embodiment of the present invention, the sgRNA is inserted into a CRISPR-Cas9 vector to obtain a gene knockout vector.

[0012] In a specific embodiment of the present invention, the overexpression comprises cloning the Desi1 gene into a plant expression vector PGA1611 vector to obtain an overexpression vector, and using the overexpression vector to transfect a target rice variety to obtain an overexpression germplasm.

[0013] The invention provides application of rice germplasm obtained by the creation method in research on resistance to rice sheath blight.

[0014] Beneficial effects: The present invention provides an application of Desi1 protein in regulating rice resistance to sheath blight, and the amino acid sequence of the Desi1 protein is shown in SEQ ID No. 1. The present invention obtains Desi1-OX, a Desi1-overexpressing transgenic plant, by overexpression transgenic technology. It is found through sheath blight resistance identification that Desi1-OX is more resistant to the disease than the wild-type rice control. The present invention also performs gene editing on the coding gene of the Desi1 protein in the recipient rice by CRISPR / Cas9 gene editing to obtain a Desi1 mutant transgenic plant desi1. It is found through sheath blight resistance identification that desi1 is more susceptible to the disease than the wild-type rice control. The present invention confirms that the Desi1 protein is related to the resistance of rice to sheath blight, and the overexpression of Desi1 enhances the resistance of rice to sheath blight, which can be used to create new germplasm resistant to rice sheath blight, proving that the application of the present invention is of great significance to the creation of rice germplasm resources resistant to sheath blight and the effective prevention and control of sheath blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a diagram of sequencing analysis of the desi1 transgenic line;

[0016] Figure 2 It is a partial structural diagram of the Desi1-OX overexpression recombinant vector and a molecular detection diagram;

[0017] Figure 3 Phenotypic diagram of desi1 transgenic rice and Desi1-OX transgenic rice after inoculation with sheath blight. DETAILED DESCRIPTION

[0018] The present invention provides an application of a Desi1 protein in regulating resistance to rice sheath blight. The amino acid sequence of the Desi1 protein is shown in SEQ ID No. 1: MAEEGYKVVLNVYDLSNGLARQLSTSFLGKPIEAIWHTGVVVYGNEYFFGGGIQSLAAGRTPYGRPVRVVEMGETHIPREVFEDYLRDISPRYTAETYRLLSHNCNNFSNEVAQFLVGAGIPDYILNLPAEVMSSPMGPLIMPMIQNLESTLRTNAAPQATQFVPSSVPPPPPPQNKPGEGSSSSKQEDKAAKAKQGSAADPLGGARGKVQEEVMREFAAIMASGTLRASEAAALAMRRVMERHGNATMQQS*.

[0019] The amino acid sequence of the Desi1 protein of the present invention contains 252 AA in total, which is 759 bp in the nucleotide sequence of the Desi1 (LOC_Os02g56900) gene. The nucleotide sequence of the Desi1 gene is shown in SEQ ID Shown in No.2: ATGGCGGAGGAAGGGTACAAGGTTGTTCTTAACGTGTACGACCTCAGCAACGGCCTCGCGCGGCAGCTCTCCACCTCCTTCCTCGGCAAGCCAATCGAGGCCATCTGGCATACGGGCGTGGTGGTGTACGGGAACGAGTACTTCTTCGGCGGCGGGATCCAGTCGCTGGCGGCGGGGAGGA CGCCGTACGGGCGGCCGGTGCGGGTGGTGGAGATGGGCGAGACGCACATCCCGCGGGAGGTGTTCGAGGACTACCTCCGCGACATCTCGCCGCGGTACACGGCGGAGACGTACCGGCTGCTCAGCCACAACTGCAACAACTTCAGCAACGAGGTGGCGCAATTCCTCGTCGGCGCCGGCATCCCGACT ACATCCTCAACCTCCCCGCCGAGGTCATGTCCAGCCCCATGGGCCCCCTCATGCCCATGATTCAGAACCTCGAGTCCACGCTCCGGACCAACGCCGCGCCGCAGGCCACGCAGTTCGTCCCCTCGTCCGTGCCGCCGCCGCCGCCGCCGCAGAACAAGCCCGGCGAGGGCTCGTCTTCCTCGAAGC AAGAAGACAAGGCGGCCAAAGCGAAGCAGGGCTCGGCGGCTGACCCGCTCGGCGGCGCGAGGGGGAAGGTGCAGGAGGAGGTGATGCGGGAGTTCGCGGCGATCATGGCGAGCGGGACGCTGCGGGCGAGCGAGGCGGCGGCGCTGGCGATGCGGCGGGTCATGGAGCGGCACGGCAACGCCACCATGC AGCAGAGCTAG.

[0020] In a specific embodiment of the present invention, the regulation includes: enhancing the sensitivity of rice to sheath blight after knocking out the gene encoding the Desi1 protein; enhancing the resistance of rice to sheath blight after overexpressing the gene encoding the Desi1 protein.

[0021] The present invention provides application of Desi1 gene in creating rice germplasm related to resistance to rice sheath blight. The nucleotide sequence of the Desi1 gene is shown in SEQ ID No.2.

[0022] In a specific embodiment of the present invention, genes in the rice genome can be knocked out by gene editing methods to obtain germplasm that is more sensitive to rice sheath blight; the Desi1 gene in the rice genome can also be overexpressed by overexpression methods to obtain germplasm with high resistance to rice sheath blight.

[0023] The present invention provides a method for creating rice germplasm related to rice sheath blight resistance, comprising knocking out or overexpressing a Desi1 gene in a rice genome, wherein the nucleotide sequence of the Desi1 gene is shown in SEQ ID No.2.

[0024] In a specific embodiment of the present invention, the knockout method includes the CRISPR / Cas9 gene editing method, and the nucleotide sequence of the sgRNA used is shown in SEQ ID No. 3: CGACATCTCGCCGCGGTACA.

[0025] In a specific embodiment of the present invention, the sgRNA is inserted into a CRISPR-Cas9 vector to obtain a gene knockout vector. The CRISPR-Cas9 vector construction kit used in the present invention is purchased from Hangzhou Biotech Biotechnology Co., Ltd. (Cat#BGK01).

[0026] In a specific embodiment of the present invention, the overexpression comprises cloning the Desi1 gene into a plant expression vector PGA1611 vector to obtain an overexpression vector, and using the overexpression vector to transfect a target rice variety to obtain an overexpression germplasm.

[0027] The present invention provides application of rice germplasm obtained by the creation method in resistance to rice sheath blight.

[0028] In order to further illustrate the present invention, the application of the Desi1 protein provided by the present invention in rice resistance to sheath blight is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1

[0030] Obtaining the transgenic rice plant desi1 by CRISPR / Cas9 gene editing

[0031] 1. Obtaining genetically modified rice

[0032] The Desi1 gene sequence shown in SEQ ID No. 2 was provided to the company, and Wuhan Boyuan Biotechnology Co., Ltd. performed target site sequence design, primer design, vector construction and transformation to transform rice variety ZH11. Finally, T0 generation transgenic rice was obtained.

[0033] 2. Identification of genetically modified rice

[0034] The obtained transgenic plants were further verified by sequencing analysis. Figure 1 As shown. Through sequencing analysis of positive plants, it was found that the base T was inserted between the 263rd and 264th bases of the Desi1 coding gene sequence in plant 5#, and the base C was missing at the 264th base of the Desi1 coding gene sequence in plant 19#, causing the amino acid sequence encoded by the OsDesi1 gene to shift, resulting in the loss of the function of the OsDesi1 gene ( Figure 1 ), and the gene-edited plants were named desi1-5 and desi1-19 respectively.

[0035] Example 2

[0036] Obtaining transgenic rice plants overexpressing Desi1

[0037] 1) Construction of recombinant vector for overexpression of Desi1 gene

[0038] The nucleotide sequence of the Desi1 (LOC_Os02g56900) gene is shown in SEQ ID No.2, the encoded protein is OsDesi1, and the amino acid sequence is shown in SEQ ID No.1.

[0039] The amplified sequence fragment was cloned into the plant expression vector PGA1611 vector (Piao HL, Xuan YH, Park SH, Je BI, Park SJ, Park SH, Kim CM, Huang J, Wang GK, Kim MJ, Kang SM, Lee IJ, Kwon TR, Kim YH, Yeo US, Yi G, Son D, Han CD. OsCIPK31, a CBL-interacting protein kinase is involved in germination and seedling growth under abiotic stress conditions in rice plants. Mol Cells. 2010, 30: 19-27; publicly available from Gyeongsang National University, South Korea) and connected to the backbone to obtain the OsDesi1 gene overexpression vector ( Figure 2 (A).

[0040] 2) Obtaining transgenic rice overexpressing the OsDesi1 gene

[0041] The PGA1611-OsDesi1 overexpression vector obtained above was transferred into Agrobacterium LBA4404, and then transformed into rice variety ZH11, and screened with hygromycin to obtain T0 generation PGA1611-OsDesi1 rice, which is the OsDesi1-OX overexpression transgenic line, named Desi1-OX. The specific operation was completed by Wuhan Boyuan Biotechnology Co., Ltd.

[0042] 3) Molecular identification of Desi1-OX transgenic rice plants

[0043] The T0 generation Desi1-OX transgenic rice and wild-type rice ZH11 obtained above were molecularly identified. Total RNA from various rice roots was extracted and reverse transcribed, and then identified by qRT-PCR using the following primers:

[0044] OsDesi1-F(SEQ ID No.4):ACCACCATACATTCGACGCG;

[0045] OsDesi1-R (SEQ ID No. 5):GGGTTATCGTTATCCATCCATCGG;

[0046] The internal reference gene is Ubiquitin, and the internal reference primers are:

[0047] Ubiquitin-F (SEQ ID No. 6):CACGGTTCAACAACATCCAG;

[0048] Ubiquitin-R (SEQ ID No. 7):TGAAGACCCTGACTGGGAAG;

[0049] The results are as follows Figure 2 As shown in B, the average relative expression level of Desi1 in the T0 generation Desi1-OX transgenic rice was significantly higher than that in the wild-type rice ZH11.

[0050] Example 3

[0051] Phenotypic observation of desi1 transgenic rice and Desi1-OX transgenic rice after inoculation with sheath blight

[0052] The resistance identification was carried out by inoculating the pathogen with live sheath blight.

[0053] In vivo inoculation: Use a spray bottle to wet the rice leaf sheath to be inoculated. Use sterile tweezers to take the bark covered with hyphae of Rhizoctonia solani and insert it into the leaf sheath of the third leaf from the bottom of the rice plant. Use a spray bottle to wet the leaf sheath with the bark again, wrap the inoculated part with plastic wrap to keep it moist, and continue to culture under normal growth conditions. Remove the plastic wrap after 72 hours. Repeat each treatment 3 times. Survey and statistics 10 to 15 days after inoculation.

[0054] The results of inoculation of desi1 mutant plants showed that the lesions of desi1 mutant plants were significantly larger than those of wild-type plants, and these mutants were more susceptible to the disease ( Figure 3 The results of inoculation of Desi1-OX transgenic plants showed that the length of lesions in overexpressing plants was significantly shorter than that in wild type plants ( Figure 3 ), indicating that overexpressing plants are more disease-resistant.

[0055] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of Desi1 protein in regulating resistance to rice sheath blight, characterized in that: The amino acid sequence of the Desi1 protein is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the Desi1 protein is shown in SEQ ID No.

2.

3. The application according to claim 1, characterized in that: The regulation includes: after knocking out the gene encoding the Desi1 protein, enhancing the sensitivity of rice to sheath blight; after overexpressing the gene encoding the Desi1 protein, enhancing the resistance of rice to sheath blight.

4. Application of Desi1 gene in creating rice germplasm associated with resistance to rice sheath blight, characterized in that: The nucleotide sequence of the Desi1 gene is shown in SEQ ID No.

2.

5. A method for creating rice germplasm associated with resistance to rice sheath blight, characterized in that: The method comprises knocking out or over-expressing the Desi1 gene in the rice genome, wherein the nucleotide sequence of the Desi1 gene is shown as SEQ ID No.

2.

6. The method according to claim 5, characterized in that: The knockout method includes a CRISPR / Cas9 gene editing method, and the nucleotide sequence of the sgRNA used is shown in SEQ ID No.

3.

7. The method according to claim 6, characterized in that: The method comprises inserting the sgRNA into a CRISPR-Cas9 vector to obtain a gene knockout vector.

8. The method according to claim 5, characterized in that: The overexpression comprises cloning the Desi1 gene into a plant expression vector PGA1611 vector to obtain an overexpression vector, and using the overexpression vector to transfect a target rice variety to obtain an overexpression germplasm.

9. Use of rice germplasm obtained by the creation method according to any one of claims 5 to 8 in research on resistance to rice sheath blight.

Images