Establishment and application of method for detecting aspirin resistance related SNP based on LCR technology
Aspirin-related SNP was detected through chain reaction technology, and DNA ligase and fluorescence melting curve analysis was used to solve the problems of insufficient detection sensitivity and false results in the existing technology, and the rapid and accurate detection of aspirin-related SNP was achieved, making it an individualized Drug use provides scientific basis.
Patent Information
- Application Number
- CN202411387535.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-04
- Publication Date
- 2024-12-31
AI Technical Summary
The existing single nucleotide polymorphism (SNP) detection methods for aspirin-related genes have the risk of insufficient sensitivity and pseudo-results, making it difficult to achieve individualized medication, especially DNA polymerases are insufficient for SNP site recognition.
Aspirin resistance-related SNPs were detected by strand reaction (LCR) technology, and specific melting peaks were analyzed by DNA ligase-mediated detection, and fluorescence melting curves were used to achieve accurate detection of ASP-related SNP sites.
It realizes rapid and accurate detection of aspirin-related SNPs, reduces the occurrence of false results, and provides a scientific basis for individualized medication use.
Smart Images
Figure CN119220654A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of pharmacogenomics, and in particular to the establishment and application of a method for detecting aspirin resistance-related SNPs using LCR technology. Background Art
[0002] Aspirin (ASP), as a salicylic acid derivative, is mainly used in cardiovascular and cerebrovascular obstructive diseases to play an antiplatelet aggregation role. However, some patients develop resistance after aspirin treatment, and severe cardiovascular events inevitably occur again, leading to poor prognosis. Genetic variation is one of the main causes of aspirin resistance (AR), but there are currently few studies on the correlation between single nucleotide polymorphisms (SNPs) and AR. Therefore, this is one of the key difficulties in studying the personalized medication of ASP and has research value. So far, the detection methods of ASP-related gene SNPs available for clinical diagnosis are relatively limited. The main detection methods include PCR and sequencing, but they all have certain defects. Therefore, it is urgent to establish an accurate method to achieve the purpose of highly sensitive and specific screening of ASP-related gene SNPs.
[0003] With the development and deepening of pharmacogenomics research, more accurate basis is provided for personalized drug therapy. Sequencing method is used to detect the difference of functional polymorphic sites, but the detection time is long; PCR method is currently a more sensitive detection method, but DNA polymerase is not as specific as DNA ligase in recognizing SNP sites, and false results are prone to occur. LCR is a detection technology mediated by DNA ligase, which is more sensitive and accurate in identifying base mutations. Based on this, we established an LCR method to achieve accurate detection of ASP-related SNP sites. By analyzing the melting curve of the LCR ligation product, the amplified double-stranded DNA nucleic acid signal is converted into a signal of a specific melting peak. The judgment is simple and fast, which has opened up a new way for the detection of SNPs and has great application value in the future. Summary of the invention
[0004] The purpose of the present invention is to provide a method for detecting aspirin resistance-related SNPs using LCR technology, which has the advantages of accuracy, rapidity, and easy judgment. The purpose of the present invention is achieved by the following technical solutions:
[0005] A method for detecting aspirin resistance-related SNPs using LCR technology, comprising the following steps:
[0006] 1) DNA extraction: Use blood / cell / tissue genomic DNA extraction kit to extract genomic DNA;
[0007] 2) Plasmid preparation: The plasmid is prepared using molecular cloning technology and sent to the company for Sanger sequencing to determine the type of bases at specific sites and obtain wild-type and mutant plasmid standards;
[0008] 3) System establishment: Use the plasmid in 2) as a template to establish an LCR reaction system. The LCR reaction system includes: 2.5 μL 10XLigaseBuffer, 0.5 μL 1ng·μL-1 template DNA, 1 μL 110 μmol·L-1 primer PE-P1, 0.25 μL 10 μmol·L-1 primer PE-P2, 1 μL 10 μmol·L-1 primer PE-P3, 0.25 μL 10 μmol·L-1 primer PE-4, 1 μL Taq DNA ligase, 18.5 μL double distilled water;
[0009] 3) Reaction conditions: The configured LCR reaction system was pre-denatured at 95°C for 3 min, followed by 30 cycles of 95°C for 3 min and 60°C for 2 min, and stored at 4°C.
[0010] 4) Fluorescence melting curve detection: Take 19 μL of LCR product and add 1 μL of fluorescent dye 20X Eva Green to mix thoroughly, place in a fluorescent quantitative PCR instrument, set the melting curve parameters to: 4-95°C, increase from 4°C to 95°C at a rate of 0.1°C / 0.2s, collect, and finally drop to 20°C and continue for 10s to analyze the melting curve.
[0011] 5) Result identification: Observe the generation of specific melting peaks to determine the results. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 Fluorescence melting curve identification diagram of wild-type and mutant LCR amplification products;
[0013] Figure 2 Identification diagram of PEAR1-rs12041331 of clinical samples to be tested, (A): Melting curve results of PEAR1-rs12041331 of clinical samples detected by LCR; Figure (B): Corresponding sequencing results. DETAILED DESCRIPTION
[0014] The present invention will be further described below in conjunction with examples. The following examples are only used to illustrate the present invention but not to limit the present invention.
[0015] Example 1
[0016] 1. DNA Extraction
[0017] 2 mL of human anticoagulated venous blood was collected and genomic DNA was extracted using a blood genomic DNA extraction kit.
[0018] 2. Plasmid Preparation
[0019] The plasmid was prepared using molecular cloning technology and sent to the company for Sanger sequencing to determine the type of bases at specific sites and obtain wild-type and mutant plasmid standards.
[0020] 3.LCR Identification SNP Detection
[0021] The LCR reaction system is: 2.5 μL 10X Ligase Buffer, 0.5 μL 1 ng·μL -1 Template DNA, 1 μL 110 μmol·L -1 Primer PE-P1, 0.25 μL 10 μmol·L -1 Primer PE-P2, 1 μL 10 μmol·L -1 Primer PE-P3, 0.25 μL 10 μmol·L -1 Primer PE-4, 1 μL Taq DNA ligase, 18.5 μL double distilled water;
[0022] The reaction procedure was as follows: denaturation at 95°C for 3 min, 30 cycles of 95°C for 3 min and 60°C for 2 min, storage at 4°C, and storage at 4°C.
[0023] Fluorescence melting curve detection: Take 19 μL of LCR product and add 1 μL of fluorescent dye 20X Eva Green to mix thoroughly, place in fluorescent quantitative PCR instrument, set the melting curve parameters to: 4-95℃, increase from 4℃ to 95℃ at a rate of 0.1℃ / 0.2s for collection, and finally drop to 20℃ and continue for 10s to analyze the melting curve; observe the generation of specific melting peaks to judge the results.
[0024] Example 2
[0025] Table 1. Sample grouping and quantity table
[0026]
[0027] The present invention is used for identification of clinical samples.
[0028] Assume that there is a group of anticoagulated venous blood samples from patients who need long-term aspirin treatment. It is not certain whether there is any genomic SNP factor affecting the treatment. Therefore, it is detected and identified according to the following method.
[0029] First, the genomic DNA of the sample was extracted using a blood genomic DNA extraction kit. The extracted DNA was used as a template for LCR amplification, and after amplification, a fluorescent melting curve analysis was performed.
[0030] Identification result: If the sample to be tested shows a 77°C specific melting peak, the sample can be judged to be wild type; if the sample to be tested does not show a 77°C specific melting peak, it can be judged that a SNP occurs at this site in the sample and it is a mutant type.
Claims
1. A method for identifying aspirin resistance-related SNPs using LCR technology, characterized in that Two pairs of complementary oligonucleotide primers are designed and hybridized with the perfectly matched target sequence. The new fragment obtained by the action of DNA ligase is denatured again and used as a template to continue the reaction. The other two primers are hybridized to the second template chain in a similar way. After the cycle, a large number of connection products are formed, achieving the purpose of exponential amplification. Therefore, the specific peak can be seen at 77°C through the melting curve detection. If a SNP base mutation occurs at a specific site, the two adjacent primers cannot be connected and no further amplification will occur. The primers designed to detect the SNP site rs12041331 of the PEAR1 gene are: PE-P1: G GAAGTGAGACAGCAGAAGG; PE-P2: CCTTCTGCTGTCTCACTTCC; PE-P3:AAGCAGAGAGTAAGGGTGAC; PE-P4: G TCACCCTTACTCTCTGCTT。 Note: The underlined bases in the primer sequence are phosphorylated; the bases marked in red in the primer sequence are the sites for SNP recognition by Taq DNA ligase. P1 is complementary to P3, P2 is complementary to P4, and the ligation products of P1 and P3 and P2 and P4 are both complementary to the wild-type DNA template sequence.
2. The method for identifying aspirin resistance-associated SNPs using LCR technology as claimed in claim 1, comprising the following steps: 1) DNA extraction: Genomic DNA was extracted using a blood genomic DNA extraction kit; 2) Plasmid preparation: The plasmid is prepared using molecular cloning technology and sent to the company for Sanger sequencing to determine the type of bases at specific sites and obtain wild-type and mutant plasmid standards; 3) System establishment: Use the plasmid in 2) as a template to establish an LCR reaction system. The LCR reaction system includes: 2.5μL10XLigase Buffer, 0.5μL 1ng·μL -1 Template DNA, 1 μL 110 μmol·L -1 Primer PE-P1, 0.25 μL 10 μmol·L -1 Primer PE-P2, 1 μL 10 μmol·L -1 Primer PE-P3, 0.25 μL 10 μmol·L -1 Primer PE-4, 1 μL Taq DNA ligase, 18.5 μL double distilled water; 3) Reaction conditions: The configured LCR reaction system was pre-denatured at 95°C for 3 min, followed by 30 cycles of 95°C for 3 min and 60°C for 2 min, and stored at 4°C. 4) Fluorescence melting curve detection: Take 19 μL of LCR product and add 1 μL of fluorescent dye 20X Eva Green to mix thoroughly, place in a fluorescent quantitative PCR instrument, set the melting curve parameters to: 4-95°C, increase from 4°C to 95°C at a rate of 0.1°C / 0.2s, collect, and finally drop to 20°C and continue for 10s to analyze the melting curve. 5) Result identification: Observe the generation of specific melting peaks to determine the results.
3. The method for identifying aspirin resistance-associated SNPs according to claim 2, wherein Two pairs of LCR phosphorylation-modified primers were designed. After multiple cycles of LCR reaction, the amplified products were subjected to fluorescent melting curve detection. If a specific melting peak at 77°C appeared, the sample could be judged to be wild type.
4. The method for identifying aspirin resistance-associated SNPs according to claim 2, wherein Two pairs of LCR phosphorylation-modified primers were designed. After multiple cycles of LCR reaction, the amplified products were tested by fluorescence melting curve. If no 77°C specific melting peak appeared, it could be determined that a SNP occurred at that site in the sample and that it was a mutant.