InDel molecular marker for assisting in identifying drought resistance of sorghum and application of InDel molecular marker

Abstract

The invention relates to an InDel molecular marker for assisting in identifying drought resistance of sorghum and application of the InDel molecular marker, and belongs to the technical field of InDel molecular markers, the sequence of an upstream primer of the molecular marker is F: GACATGTCTTAATCGCACCGTAC, and the sequence of a downstream primer of the molecular marker is R: GGTTTTTGCGGCTGATAAAGTG; the InDel molecular marker for drought resistance of sorghum is used for identifying the drought resistance character of sorghum, and when a 304bp band pattern appears, the drought resistance of a material is strong. The InDel molecular marker disclosed by the invention can be used for rapidly and accurately identifying the drought resistance character of sorghum, and can be used for remarkably improving the selection efficiency of sorghum drought resistance breeding, so that the breeding process is accelerated, and the oriented genetic improvement of the sorghum drought resistance is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of InDel molecular markers, and relates to an InDel molecular marker for assisting identification of sorghum drought resistance and application thereof. Background Art

[0002] Sorghum (Sorghumbicolor (L.) Moench) is an annual herbaceous plant of the Poaceae family, usually grown in tropical, subtropical and temperate arid and semi-arid regions. Among the major food crops in the world, the planting area ranks fifth, second only to rice, corn, wheat and soybeans. As one of the main specialty crops in my country, sorghum has many uses in agriculture, such as winemaking, food, feed and making brooms. In addition, sorghum also has strong stress resistance, which is manifested in its certain / strong adaptability to harsh environments such as drought, waterlogging, saline-alkali land, poor soil and high temperature.

[0003] Drought is a common and serious abiotic stress in agricultural production, which is characterized by high frequency, wide range, and long duration. At present, more than one-third of the world's land area is in arid and semi-arid areas. In China, the total area of ​​arid, semi-arid and sub-humid arid areas is close to 3 million square kilometers, accounting for nearly 40% of the total land area. Drought stress is a key factor limiting crop yields. It is estimated that about 60% of the annual crop yield reduction is caused by drought. Therefore, it is very important to study the drought resistance of sorghum. The implementation of this project is of great significance.

[0004] In recent years, people have conducted extensive research on the drought resistance of sorghum, and the results show that different sorghum varieties have significantly different drought resistance. At present, the research on the drought resistance of sorghum in China mainly focuses on the identification of its morphological characteristics and research methods. Some scholars are committed to exploring the drought resistance performance of sorghum in the early stages of seed development or in farmland environments and its evaluation methods. In terms of molecules, Dugas et al. used osmotic pressure to affect sorghum growth and analyzed transcriptome data to reveal the drought resistance mechanism of sorghum and find the corresponding genes. Zhang et al. used transcriptome sequencing to analyze the transcriptome of leaves and roots of sorghum under drought conditions, thereby selecting many significantly changed genes, and then identified some transcription factors associated with drought resistance through enrichment (GO) analysis. Wang Zhiheng et al. used PEG-6000 to drought stress sweet sorghum and performed transcriptome sequencing analysis, and found two metabolic pathways related to drought stress response, which showed that sweet sorghum enhances osmotic regulation ability to cope with drought stress by activating the expression of proteins related to drought stress and the expression of genes related to carbohydrates. Abdelghany et al. studied the drought tolerance of sorghum. They selected four different sorghum materials and performed transcriptome analysis on them. The study found that in the drought-resistant genotype, about 180 genes were differentially regulated under drought stress, and most (more than 70%) were upregulated during drought. The functions of about 70 genes are unknown. Fracasso et al. studied the drought tolerance of sorghum. They selected the variety IS22330 with strong drought resistance and the variety IS20351 that is susceptible to drought, and observed their gene expression in photosynthetic response, water vapor loss and water use efficiency in dry environments to gain a deeper understanding of their differences. The results showed that when faced with drought pressure, the gene expression of drought-resistant types generally increased, while for types that are susceptible to drought damage, their gene expression showed a downward trend, thus identifying three genes as important candidate genes for evaluating sorghum drought tolerance.

[0005] At present, the research on sorghum drought resistance is mainly focused on the physiological level, such as the changes in physiological and biochemical indicators after drought stress, which are mostly limited to the exploration of a single omics level, such as genomics or transcriptomics, and there is less joint analysis of different omics data, lacking in-depth exploration of its molecular mechanism. Therefore, there are still many deficiencies in revealing the mechanism of sorghum drought resistance. At present, there is still no relevant research on sorghum drought resistance traits and molecular markers. Therefore, the development of sorghum drought resistance molecular markers has important practical significance for sorghum drought resistance assisted breeding. Summary of the invention

[0006] The present invention aims to provide an InDel molecular marker for assisting identification of sorghum drought resistance and application thereof.

[0007] The technical solution adopted by the present invention to achieve its purpose is as follows:

[0008] An InDel molecular marker for assisting identification of sorghum drought resistance, wherein the upstream primer sequence of the molecular marker is F:GACATGTCTTAATCGCACGTAC, and the downstream primer sequence is R:GGTTTTTGCGGCTGATAAAGTG;

[0009] The InDel molecular marker for sorghum drought resistance is used to identify the drought resistance trait of sorghum. The appearance of a 304 bp band indicates that the material has strong drought resistance, while a band located lower (larger band) indicates that the material is not drought-resistant.

[0010] A primer pair for amplifying sorghum InDel molecular markers comprises an upstream primer sequence F: GACATGTCTTAATCGCACGTAC and a downstream primer sequence R: GGTTTTTGCGGCTGATAAAGTG.

[0011] A method for identifying drought resistance of sorghum comprises the following steps:

[0012] (1) using the sorghum sample DNA as a template and amplifying the InDel molecular marker using a primer pair selected from claim 1;

[0013] (2) Electrophoresis pattern analysis: The band type is interpreted based on the polyacrylamide gel electrophoresis amplification results of the sample. The presence of a 304 bp band indicates that the material has strong drought resistance.

[0014] Furthermore, the amplification is PCR amplification:

[0015] The reaction system included: 2× TaqPCR MasterMix 5 μl, 10 μM upstream primer 0.5 μl, 10 μM downstream primer 0.5 μl, DNA template 0.5 μl, ddH2O 3.5 μl;

[0016] The reaction procedure was: 95°C for 2 min; 94°C for 40 s, 58°C for 45 s, 72°C for 1 min 30 s, 26 cycles; 72°C for 7 min.

[0017] Furthermore, the polyacrylamide gel is a non-denaturing polyacrylamide gel, and the formula is as follows:

[0018] 30% gel preparation solution 15ml, 5×TBE electrophoresis buffer 10ml, H2O 25ml, 10% AP 600μl, TEMD 40μl.

[0019] Furthermore, the electrophoresis conditions were 120 V, 400 mA, 30 min, and 180 V, 400 mA, 1 h 15 min.

[0020] Furthermore, after the electrophoresis is completed, the gel is taken out, marked with a punching gun tip, silver-stained with AgNO3 solution for 10-15 minutes, and developed with a color developing solution for 5-8 minutes. After rinsing with water twice, it is placed on a light box and photographed to obtain the results.

[0021] Use of the molecular marker detection reagent as claimed in claim 1 in assisting the identification of sorghum drought-resistant variety breeding.

[0022] Beneficial effects of the present invention:

[0023] The InDel molecular marker of the present invention can quickly and accurately identify the drought resistance trait of sorghum, and can significantly improve the selection efficiency of sorghum drought resistance breeding, thereby accelerating the breeding process and achieving directional genetic improvement of sorghum drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a polyacrylamide gel electrophoresis image.

[0025] Figure 2 It is the 304bp band pattern of polyacrylamide gel electrophoresis DETAILED DESCRIPTION

[0026] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of the present invention.

[0027] Example 1

[0028] 1. Sorghum samples

[0029] 52 different sorghum materials were selected. The sorghum seeds were first soaked in 75% alcohol for 10 minutes, then cleaned with distilled water and placed in a culture dish in an incubator (28℃±2℃) for germination. After the seeds germinated, the seedlings with consistent growth and health were selected for transplanting and planted in a seedling pot with a fixed soil composition ratio and weight (such as 500g vermiculite and 500g sandy soil, mixed and poured with 30ml water, with a total weight of 1.25g per pot). The seedlings were then cultured in a nursery room (28℃±2℃). The seedlings that grew normally to the three-leaf stage were treated with water control. The control group plants were irrigated normally, and the drought treatment group plants were deprived of water. The soil moisture content was controlled daily until the seedlings grew to the five-leaf stage. During this period, the phenotypes were observed and physiological indicators such as plant height, aboveground fresh weight and aboveground dry weight were measured. The corresponding calculation method was used to identify the drought resistance of different sorghum materials.

[0030] 2. DNA Sample Extraction

[0031] 2.1 Extract DNA using FastPure Plant DNA Isolation Mini Kit.

[0032] Table 1 Product components

[0033]

[0034] RNaseA: enzymatically digests RNA in samples;

[0035] BufferA1: provides sample lysis environment;

[0036] BufferA2: removes impurities such as proteins and cell debris;

[0037] BufferA3: provides column loading environment;

[0038] BufferAW: removes salt ions from DNA;

[0039] Elution Buffer: Elute the DNA from the adsorption column;

[0040] FastPure gDNA Columns IV: adsorption of genomic DNA;

[0041] Collection Tubes 2ml: filtrate collection tube.

[0042] 2.2 Sample processing

[0043] Liquid nitrogen grinding method

[0044] Take 100 mg of fresh plant leaf tissue, add liquid nitrogen and grind it into powder, then transfer the powder into a 1.5 ml centrifuge tube.

[0045] 2.3 DNA extraction

[0046] (1) Immediately add 400 μl Buffer A1 and 4 μl RNase A (10 mg / ml) to the ground sample powder, vortex and mix thoroughly to aid lysis.

[0047] Optional: When the polysaccharide content is particularly high, 2% PVP-40 can be added to Buffer A1; when the polyphenol content is particularly high, 0.2% β-mercaptoethanol can be added to Buffer A1. Both can also be added at the same time.

[0048] (2) Incubate in a 65°C water bath for 10 min. Invert the tube 2-3 times to mix the sample.

[0049] (3) Add 130 μl of Buffer A2 to the mixture, mix thoroughly, place on ice for 5 min, centrifuge at 14,000 rpm (18,400 × g) for 5-10 min, and carefully pipette the supernatant into a new 1.5 ml centrifuge tube (prepared by yourself), taking care not to aspirate the interface material.

[0050] (4) Calculate the amount of supernatant, add 1.5 times the volume of Buffer A3 (please check whether anhydrous ethanol has been added before use), and immediately mix by pipetting. Adding Buffer A3 may cause flocculent precipitation. After mixing, you can proceed to the next step.

[0051] (5) Transfer the mixture obtained in the previous step (including the precipitate) to FastPure gDNA Columns IV (the adsorption column has been placed in the collection tube), centrifuge at 12000 rpm (13,400 × g) for 30-60 seconds, and discard the filtrate.

[0052] (6) Add 600 μl Buffer AW (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate.

[0053] (7) Repeat step 6.

[0054] (8) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min to remove as much rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions. After centrifugation, the empty column can be left open for 2-5 min to allow the residual ethanol to evaporate completely.

[0055] (9) Place the adsorption column in a new 1.5 ml centrifuge tube (prepared by yourself). Add 50-100 μl of Elution Buffer preheated to 65-70°C to the center of the membrane of the adsorption column, place at room temperature for 3-5 minutes, and centrifuge at 12,000 rpm (13,400 × g) for 1 minute.

[0056] (10) Discard the adsorption column and store the DNA at -20°C.

[0057] 3. Primer Synthesis

[0058] The upstream primer sequence is F:GACATGTCTTAATCGCACGTAC,

[0059] The downstream primer sequence was R:GGTTTTTGCGGCTGATAAAGTG;

[0060] 4. PCR Amplification

[0061] Table 2

[0062] Components volume 2×TaqPCRMasterMix 5μl Upstream primer (10 μM) 0.5μl Downstream primer (10 μM) 0.5μl Template (DNA) 0.5μl <![CDATA[ddH2O]]> 3.5μl

[0063] Primer amplification conditions were set as follows: 95°C for 2 min; 94°C for 40 s, 58°C for 45 s, and 72°C for 1 min 30 s, for 26 cycles; and 72°C for 7 min.

[0064] Table 3 Sample sequence table

[0065]

[0066]

[0067]

[0068] The sample name is the drought resistance ranking of the sample. For example, the drought resistance of sample 1 material ranks 38th among the 52 materials.

[0069] 5. Electrophoresis

[0070] The PCR products in Table 4 were detected by electrophoresis on a non-denaturing polyacrylamide gel.

[0071] Table 4

[0072]

[0073]

[0074] The electrophoresis buffer was 0.5×TBE, with spaces at the left and right ends to avoid edge effects, the sample volume was 1.2 μl, and a 50 bp marker was placed in one hole at each end. The electrophoresis conditions were: 120 V, 400 mA, 30 min, 180 V, 400 mA, 1 h 15 min.

[0075] 6. Development

[0076] After electrophoresis, the gel was removed and marked with a gun tip, and silver-stained with AgNO3 solution (1.0 g AgNO3 dissolved in 1 L water) for 10-15 min;

[0077] Color development solution (20 g NaOH dissolved in 1 L water, add 10 ml formaldehyde) for 5-8 min;

[0078] After rinsing twice with water, place on a light box and take pictures.

[0079] 5. Experimental Results

[0080] The order of spotting samples from left to right is samples 1-52, see Figure 1 .

[0081] The above-mentioned InDel molecular markers and method steps were used to identify the genotypes of 52 sorghum materials with known drought resistance in Table 3. The identification results are shown in the figure below. Figure 1 According to the results of polyacrylamide gel electrophoresis, if the amplified band is relatively small, the material to be tested shows drought sensitivity. For example, the sample wells 6, 11, 13, 22, 30, 34, 36, 39, 40, 41, 43, 50, 51, and 52, the corresponding drought resistance rankings in the 52 materials are Sb33, Sb13, Sb42, Sb29, Sb22, Sb27, Sb37, Sb45, Sb32, Sb47, Sb24, Sb44, Sb48, and Sb34, and the accuracy in these 52 materials is 86%.

Claims

1. An InDel molecular marker for assisting identification of sorghum drought resistance, characterized in that: The upstream primer sequence of the molecular marker is F:GACATGTCTTAATCGCACGTAC, and the downstream primer sequence is R:GGTTTTTGCGGCTGATAAAGTG; The InDel molecular marker for sorghum drought resistance is used for identification of sorghum drought resistance traits, and the appearance of a 304 bp band indicates that the material has strong drought resistance.

2. A primer pair for amplifying sorghum InDel molecular markers, characterized in that: The primer pair is an upstream primer sequence F: GACATGTCTTAATCGCACGTAC, and a downstream primer sequence R: GGTTTTTGCGGCTGATAAAGTG.

3. A method for identifying drought resistance of sorghum, characterized in that: The following steps are involved: (1) using the sorghum sample DNA as a template and amplifying the InDel molecular marker using a primer pair selected from claim 1; (2) Electrophoresis pattern analysis: The band type is interpreted based on the polyacrylamide gel electrophoresis amplification results of the sample. The presence of a 304 bp band indicates that the material has strong drought resistance.

4. A method for identifying drought resistance of sorghum according to claim 3, characterized in that: The amplification is PCR amplification: The reaction system included: 2× TaqPCR MasterMix 5 μl, 10 μM upstream primer 0.5 μl, 10 μM downstream primer 0.5 μl, DNA template 0.5 μl, ddH2O 3.5 μl; The reaction procedure was: 95°C for 2 min; 94°C for 40 s, 58°C for 45 s, 72°C for 1 min 30 s, 26 cycles; 72°C for 7 min.

5. A method for identifying drought resistance of sorghum according to claim 3, characterized in that: The polyacrylamide gel is a non-denaturing polyacrylamide gel, and the formula is as follows: 30% gel preparation solution 15ml, 5×TBE electrophoresis buffer 10ml, H2O 25ml, 10% AP 600μl, TEMD 40μl.

6. A method for identifying drought resistance of sorghum according to claim 3, characterized in that: The electrophoresis conditions were 120 V, 400 mA, 30 min, and 180 V, 400 mA, 1 h 15 min.

7. A method for identifying drought resistance of sorghum according to claim 3, characterized in that: After electrophoresis, the gel was taken out and marked with a punching gun tip. Silver staining was performed with AgNO3 solution for 10-15 min. The color was developed with the color developing solution for 5-8 min. After rinsing with water twice, the gel was placed on a light box and photographed to obtain the results.

8. Use of the molecular marker detection reagent according to claim 1 in assisting identification of sorghum drought-resistant variety breeding.

Images