Excavation method and application of new functional genes of asexual reproduction type filamentous fungi

Abstract

The invention discloses a mining method and application of a new functional gene of asexual reproduction filamentous fungi, and relates to the technical field of applied microorganisms, and the preservation number is CGMCC No.12166. The preservation unit is China General Microbiological Culture Collection Center; the preservation date is April 11, 2016. The invention discloses a mining method of a new functional gene of asexual reproduction filamentous fungi. The mining method comprises the following steps: S1, constructing a uridine synthesis defect type trichoderma strain A with hygromycin resistance; s2, obtaining a random mutant strain B; s3, constructing a temporary simulated diploid through a protoplast fusion method; s4, carrying out random complementation on chromosome genes of the random mutants through homologous recombination of the two sets of chromosomes in the nucleus, and screening through phenotypic change to obtain phenotypic complemented mutants; and S5, determining a key mutation site for back-complementing by using a re-sequencing technology, and reversely verifying the gene function by using a gene editing method. The method disclosed by the invention provides a new method for researching functional genes of asexual reproduction type filamentous fungi.

Description

Technical Field

[0001] The invention relates to the field of applied microbial technology, and in particular to a method for mining new functional genes of asexually propagated filamentous fungi and applications thereof. Background Art

[0002] Fungi include yeast, mold and mushroom (large fungi), which belong to different subphyla of the kingdom Fungi, and mold is a general term for filamentous fungi. In recent years, with the continuous improvement of sequencing technology, whole genome sequencing of filamentous fungi has become very convenient, and the study of gene function has gradually become a hot topic in the field of fungi research, but genome annotation is obtained based on sequence alignment, and the premise of this alignment is that there must be known functional genes in the database; although gene knockout, RNA interference, overexpression and yeast two-hybrid technology have been successfully used in the study of gene function in filamentous fungi in the past decade, most of these studies also rely on reverse genetics research on genes with known functions, and are not very original; not only that, most of the gene functions in filamentous fungi and their functional coupling with other genes (i.e., through multi-gene knockout) are still unclear. Therefore, starting from the phenotype, discovering new functional genes is one of the most original works in the field of filamentous fungi research. However, the reproduction of most filamentous fungi relies on asexual spores (arthrospores, chlamydospores, sporangiospores and conidia) formed by the differentiation of mycelium. It is difficult to discover new functional genes and analyze the functional coupling relationship with other genes through hybridization, backcrossing and gene function complementation based on biological phenotypic traits like sexually reproducing organisms. This has become a bottleneck in the molecular biology research of filamentous fungi worldwide. Summary of the invention

[0003] The purpose of the present invention is to solve the above problems and provide a method for mining new functional genes of asexually propagated filamentous fungi and its application.

[0004] In order to achieve the above-mentioned object, the technical scheme of the present invention is as follows: an asexually propagating filamentous fungus, wherein the asexually propagating filamentous fungus is a wild strain of Trichoderma, and the preservation number of the wild strain of Trichoderma is: CGMCC No.12166; the preservation unit is: China General Microbiological Culture Collection Center; the preservation date is: April 11, 2016.

[0005] The present invention further discloses a method for mining new functional genes of asexually propagated filamentous fungi, comprising the following steps:

[0006] S1. Construction of Trichoderma strain A that is deficient in urea synthesis but resistant to hygromycin;

[0007] S2, obtaining a random mutant strain B, irradiating the wild-type strain with X-rays and screening out a random mutant strain B with acid resistance;

[0008] S3, protoplast preparation and fusion, constructing a temporary pseudo-"diploid" by protoplast fusion method; the two sets of chromosomes of the temporary pseudo-"diploid" are respectively from Trichoderma strain A and random mutant strain B;

[0009] S4, screening and phenotypic verification, random complementation of random mutant chromosome genes through homologous recombination of two sets of chromosomes in the nucleus, and screening of phenotypic changes to obtain phenotypic complement mutants;

[0010] S5. Resequencing and gene editing verification: Use resequencing technology to determine the key mutation sites to be complemented and reversely verify the gene function through gene editing methods.

[0011] Preferably, in step S1, the construction of the Trichoderma strain A is to knock out the key gene ura3 (A1A105144) of Trichoderma uridine synthesis by using hygromycin as a biomarker.

[0012] Preferably, in step S2, the random mutant strain B is obtained by taking 200 μl of a 1×10 7 The spore suspension was plated in a 96-well plate and then irradiated with X-rays. The irradiated spore suspension was diluted and spread on a screening medium under the required conditions to screen for mutant strain B with a significant phenotypic change.

[0013] Preferably, the total dose of X-ray irradiation is 250 Gy, and the irradiation is performed three times in total, with the doses of 84 Gy, 84 Gy and 82 Gy respectively.

[0014] Preferably, the process and verification method of protoplast fusion are as follows: protoplasts are prepared from Trichoderma strain A and random mutant strain B respectively, and then fused using a PEG-mediated method, regenerated transformants are screened using a poor nutrient medium containing hygromycin and then single spore separation is performed, heterokaryotic transformants are removed, temporary pseudo-"diploid" transformants are retained, and verification is performed using specific primers.

[0015] Preferably, the protoplast fusion method is to mediate protoplast fusion by gradually decreasing the concentration of PEG, and the specific process is: 9.5% PEG + Ca 2+ Hypertonic solution at room temperature for 5 minutes; 7% PEG + Ca 2+ Hypertonic solution on ice for 5 minutes; 5% PEG + Ca 2 + Keep the hypertonic solution on ice for 20 min.

[0016] Preferably, the specific primers include: E-U3-F, E-hygb-R; E-U3-F, E-U3-R.

[0017] Preferably, a basal salt glucose medium containing hygromycin B is used as a temporary pseudo-"diploid" selection medium.

[0018] Preferably, in step S4, a basal salt glucose medium is used to screen strains in which the target functional gene is complemented.

[0019] Preferably, in step S5, the specific process of using resequencing technology to determine the key mutation sites for complementation is: the mutant C whose phenotype changed after the last complementation and the initial mutant strain B are cultured on PDA, and then the mycelium is extracted for mapping analysis. After data analysis, the mutation sites of the two are compared. The mutation sites of the complemented strain C are less than those of the mutant strain B. The difference in the mutation sites between the two is the range of the key gene.

[0020] Compared with the prior art, this solution has the following beneficial effects:

[0021] 1) The present invention has found the suitable dose for random mutation of the asexually reproducing filamentous fungus Trichoderma for the first time through research. While X-rays cause the spore lethality of asexually reproducing filamentous fungi to reach 99.9%, the most suitable culture medium is used to screen mutants and combined with resequencing technology to detect mutation sites, thereby establishing an experimental model from phenotype to functional gene.

[0022] 2) The present invention achieves the screening of fusion strains by constructing a strain A that is deficient in uridine synthesis but has hygromycin resistance and a random mutant B that has the ability to synthesize uridine, and screening the strains of protoplast fusion by utilizing the characteristics of functional complementation.

[0023] 3) The present invention is the first to utilize the instability of temporary pseudo-"diploid strains" to cause automatic separation of chromosomes, thereby achieving recovery of chromosomes after random complementation.

[0024] 4) The present invention utilizes the characteristics of random chromosome complementation to focus on the initial mutant strain and the last phenotypic complementation strain; after finding the specific range of the functional gene by comparing the mutation sites of the two, gene editing technology is used to further verify and find the target gene. This method shortens the time for screening the target gene and also improves the accuracy of screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of gene knockout and verification strategy of ura3 in an embodiment of the present invention;

[0026] Figure 2 Schematic diagram of the single-nucleus multi-chromosome verification strategy and PCR verification results in an embodiment of the present invention;

[0027] Figure 3 Schematic diagram of the protoplast fusion process and separation strategy in an embodiment of the present invention;

[0028] Figure 4 is a schematic diagram of the phenotypes and resequencing results of the mutant strain and the complemented strain in the embodiment of the present invention;

[0029] Figure 5 It is a phenotypic comparison diagram of the complemented strain and the dominant mutant strain after editing and verification of the differential mutation sites in the embodiment of the present invention. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0031] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0032] Example:

[0033] An asexually reproducing filamentous fungus, the asexually reproducing filamentous fungus is a wild strain of Trichoderma, the preservation number of the wild strain of Trichoderma is: CGMCC No.12166; the preservation unit is: China General Microbiological Culture Collection Management Center; the preservation date is: April 11, 2016.

[0034] The above-mentioned method for mining new functional genes of acid response of asexually propagated filamentous fungi comprises the following steps:

[0035] S1. Construction of Trichoderma strain A that is deficient in urea synthesis but resistant to hygromycin;

[0036] In this embodiment, the specific construction steps of Trichoderma strain A (tool strain A) are as follows:

[0037] S101, preparation of transformation fragments

[0038] Four pairs of primers were designed for the gene ura3 (A1A105144), wherein the first pair of primers U3-up-F (CTGTCAGGCAATTAGCACAGG) and U3-up-R (CGAGCCTACCTAGTAC ACACAATCGGACTAACAAGCGCCATCAATGCC) amplified a 1500 bp fragment upstream of the ura3 gene from the Trichoderma genome; the second pair of primers U3-do-F (GATAACCATCGCATG CAAGGTCGATTCCCATTCTTTCGGTGCAGCTCTTCAG) and U3-do-R (GTCTCTGATCGTCCTACCAATCTGG) amplified a 1500 bp fragment downstream of the ura3 gene from the Trichoderma genome; the third pair of primers HygB-F (CGATTGTGTGTACTAGGTAGGCTCG) and Hyg BR (GGAATCGACCTTGCATGCGATG) amplified the open reading frame of the hygromycin B phosphotransferase gene from the pcDNA1 plasmid, which is the hygromycin resistance expression frame. The fourth pair of primers E-U3-F (CGGGACTGTTGGAGTAGGTTC) and E-HygB-R (GGTCGTTTCTGACACAACGG TG) are homologous recombination verification primers. The three fragments of the upstream of the ura3 gene, the hygromycin B resistance expression frame and the downstream of the ura3 gene were designed by primers so that the two adjacent fragments had a base complementary overlap region of about 25bp, in which the upstream end and the hygromycin initial end were complementary and overlapped, and the hygromycin end and the downstream initial end were complementary and overlapped; the ura3 gene knockout fragment of the ura3 upstream fragment + hygromycin resistance expression frame + ura3 downstream fragment can be obtained by overlapping extension PCR.

[0039] S102, transformation and knockout of uridine synthesis gene U3

[0040] Wild-type Trichoderma was diluted to 10 7The mixture was then evenly coated on a PDA medium covered with serofen and cultured for 16 hours. After the spores had just germinated, the cells were placed in a hypertonic solution containing Trichoderma cell wall lysing enzymes to prepare protoplasts. The ura3 gene knockout fragment was introduced into the Trichoderma wild-type protoplasts and then cultured on a PDA medium containing 1M sucrose. After 20 hours, the lower sucrose PDA medium was covered with a PDA upper medium containing hygromycin B and ureaside. After 48 hours, strains that could grow in the upper layer were picked and inoculated on a PDA plate containing hygromycin B and ureaside for culture. After the transformed strains grew for 48 hours, the transformed strain mycelium was picked and lysed with a lysis solution at high temperature, and then PCR verification of homologous recombination was performed. The transformed strains of homologous recombination were continued to be cultured, and after light sporulation, single spores were purified on a PDA plate containing hygromycin B and ureaside to obtain homozygous ura3 homologous recombination gene knockout transformants.

[0041] S2. Obtain a random mutant strain B, irradiate the wild-type strain with X-rays and screen out a random mutant strain B with acid resistance.

[0042] In this embodiment, the specific steps for screening the acid-resistant random mutant B are as follows:

[0043] S201, X-ray irradiation of spores

[0044] NJAU4742 was spore-forming on PDA, and the spore solution obtained after washing with sterile water was diluted to 1×10 7 / mL, take 100μl and the concentration is 1×10 7 The spore suspension was mixed with acetic acid-sodium acetate buffer (pH 5.0) in a 1:1 ratio and plated in a 96-well plate and then irradiated with X-rays (total dose 250 Gy, divided into three irradiations, 84 Gy, 84 Gy and 82 Gy each time), with an interval of 10 minutes between each irradiation.

[0045] S202. Screening of acid-resistant mutants

[0046] The irradiated mutant sporozoite solution is diluted to different concentrations, and the same amount is applied to the corresponding screening medium to find the optimal concentration for screening, and the mutant strain B with a significant phenotype change is screened. The mutant strain has various growth indicators that are significantly better than the wild type under the screening conditions: for example, the acid-resistant mutant screened by the present invention has a significantly better growth rate than the wild type on a medium with a pH of 2.2, and its growth diameter is 2-3 cm larger than that of the wild type, while the thickness of the hyphae is not reduced.

[0047] S3. Protoplast preparation and fusion. A temporary pseudo-"diploid" was constructed by protoplast fusion method. The two sets of chromosomes of the temporary pseudo-"diploid" came from Trichoderma strain A and random mutant strain B, respectively.

[0048] In this embodiment, the specific steps of protoplast preparation and fusion are as follows:

[0049] S301. Protoplast preparation

[0050] The concentration is 1×10 7 The template strain A and mutant strain B spores were uniformly coated on a PDA medium covered with seroprofen containing uridine and cultured for 19 hours; the mutant strain B spores were uniformly coated on a PDA medium covered with seroprofen containing uridine and cultured for 16 hours. After the spores of the two strains have just germinated, they are placed in a hypertonic solution containing Trichoderma cell wall lysis solution, and lysed at 28°C and 100rpm to prepare protoplasts. The lysate was filtered with a sterile four-layer gauze, and the filtrate was preserved and centrifuged in a centrifuge at 2000rpm for 10 minutes. After retaining 2-3mL of supernatant, it was centrifuged again under the same conditions and the supernatant was discarded to obtain a protoplast solid.

[0051] S301, protoplast fusion

[0052] The mutants of protoplast fusion were screened by the method of PEG-mediated with gradually decreasing concentration and dual pressure. First, the protoplasts of a single strain were prepared (for specific methods, refer to patent number 201810031220.9), and then the protoplast fusion was induced by PEG with gradually decreasing concentration. The specific process was as follows: first, 9.5% PEG+CaCl2 hypertonic solution was placed at room temperature (25°C) for 5 minutes, then 7% PEG+CaCl2 hypertonic solution was placed on ice for 5 minutes, then 5% PEG+CaCl2 hypertonic solution was placed on ice for 5 minutes, and finally 25% PEG and CaCl2 hypertonic solution were added to a certain volume in a ratio of 1 to 4 and then cultured on a 1M sucrose PDA plate. After 16 hours, the upper layer was covered with a layer of basal salt glucose medium containing hygromycin B as a screening medium and the upper transformants were selected and inoculated on a PDA plate containing hygromycin B after 48 hours. After 48 hours of growth, the mycelium of the transformed strain was picked and lysed at high temperature with a lysis solution for PCR verification of homologous recombination. There are two pairs of verification primers: the first pair of primers E-U3-F (CGGGACTGTTGGAGTAGGTTC) and E-HygB-R (GGTCGTTTCTGACACAACGGTG) are used to verify the chromosomal genotype of the tool strain A; E-U3-F (CGGGACTGTTGGAGTAGGTTC) and E-U3-R (CATCCAATGCAATGCATGCGAG) are used to verify the chromosomal genotype of the mutant strain B. When only one of the bands of the corresponding size can be amplified by PCR through two pairs of primers, it is speculated that the hygromycin B resistance gene expression frame is randomly inserted into the chromosome of strain B or the ura3 open reading frame is randomly inserted into the chromosome of strain A; when both pairs of primers can amplify the bands of the corresponding size through PCR, we believe that the mutant has the following conditions: 1. The protoplasts of the mutant contain only a single nucleus and the nucleus contains chromosomes of multiple genotypes and comes from strain A and strain B respectively; 2. The protoplasts of the mutant contain multiple nuclei, and the nuclei come from strain A and strain B respectively; 3. The mutant has a single nucleus and multiple nuclei coexisting. Through PCR verification, the protoplast fusion efficiency of the mutant selected on the screening medium is about 60%. When the hyphae of the fusion strain are lysed and the bands of the corresponding size can be amplified by PCR through two pairs of primers, it is sporulated and monospores are formed on PDA containing hygromycin B. Since Trichoderma spores belong to conidia, their spores contain only one nucleus, so the offspring of heterokaryotic fusion strains are theoretically single-resistance strains, which cannot grow on dual selective medium, while diploid fusion strains theoretically have diploid offspring. The data of single spores on the plate also supports this conclusion: when the mutant produces spores, the spore solution is diluted to a concentration of 107 / mL and 30 microliters are applied to the PDA plate containing hygromycin B, the number of single spores is only 4-5, indicating that most of the spores of the fusion strain have only one resistance.At this time, the mutant obtained by single spore can be considered as a fusion strain of single nucleus and multiple chromosomes. Then it is allowed to continue to grow and produce spores on PDA containing hygromycin B. This step is to make the chromosomes of acid-resistant mutant strain B undergo homologous recombination with the chromosomes of strain A as much as possible during the polyploid period to replenish the damaged genes. The second single spore still needs 10. 7 Only when the concentration of spore liquid is 102 / mL, can the number of single spores reach 4-5 strains on the PDA plate containing hygromycin B, which shows that the polyploid Trichoderma fusion strain is unstable and will differentiate into haploids with a high probability during the mycelial growth process. In order to obtain the haploid strain of strain B that is homozygous after multiple passages of homologous recombination in the polyploid state, 30 microliters of spore liquid 4*102 / mL after sporulation of the fusion strain was aspirated and coated on the basic salt glucose medium, and the number of single spores was 6-7 strains. This result is consistent with the probability that only half of the polyploids will be strain B after differentiation. This experimental data partially verifies the previous inference about the growth of polyploids. Through homologous recombination of polyploids, we obtained the complemented haploid strain C whose growth ability under acidic conditions is lower than that of strain B and wild type, which shows that some favorable mutations in the complementation process were successfully complemented, and some mutations that are not conducive to growth under acidic conditions are still retained. This result proves the feasibility of protoplast fusion of Trichoderma strain NJAU4742. At the same time, since the random mutation sites after radiation irradiation are often more than 100, it is impossible to screen by single gene complementation. However, large-scale gene complementation after protoplast fusion provides a feasible method for screening Trichoderma-specific genes: first, random mutation is used to screen mutant strains with obvious phenotypes, and then protoplast fusion is performed with strain A to complement genes. Finally, after the complemented strains with obvious phenotypic complementation appear, resequencing is performed to screen related genes.

[0053] S4. Screening and phenotypic verification: random complementation of random mutant chromosome genes is performed through homologous recombination of the two sets of chromosomes in the nucleus, and phenotypic complement mutants are obtained through screening through phenotypic changes.

[0054] In this embodiment, the screening method of the functional complementation strain is as follows:

[0055] The temporary pseudo-"diploid" strain is subjected to multiple single-spore separations on a oligotrophic medium containing hygromycin (to increase the probability of homologous recombination, i.e., to increase the probability of functional genes being complemented). Each single-spore separation requires PCR primer verification (the resistance gene may be integrated into the mutant or template strain genome through random insertion and homologous recombination to produce heterozygotes that need to be removed). Finally, the transformants with restored phenotypes (compared with WT) are screened on a oligotrophic medium under corresponding screening conditions. At this time, chromosome separation occurs in the temporary pseudo-"diploid". Since the strain providing the complementation template is a U3-deficient type, it cannot grow on the oligotrophic medium. The screened transformants are strains C in which the target functional gene is complemented.

[0056] S5. Resequencing and gene editing verification: Use resequencing technology to determine the key mutation sites to be complemented and reversely verify the gene function through gene editing methods.

[0057] In this embodiment, resequencing and gene editing verification specifically include the following steps:

[0058] S501, resequencing analysis of functional complementation strains

[0059] The mutant C whose phenotype changed after the last complementation and the initial mutant strain B were cultured on PDA and the mycelium was extracted for mapping analysis. After data analysis, the mutation sites of the two were compared. The mutation sites of the complemented strain C were less than those of the mutant strain B. The difference in mutation sites between the two was the range of the key gene.

[0060] S502, functional gene knockout verification

[0061] After comparing the mutation sites of C and B to find the range of key functional genes, B is used as the starting strain, and the genes within the range are complemented individually by the PEG-mediated method. By comparing the phenotypes under the corresponding screening conditions, the key gene that makes the phenotype of B close to that of C is found. After finding the gene, the wild type is used as the starting strain to knock out the gene for verification. If the phenotype of the wild type is close to that of B after the gene is knocked out, the gene is the key gene.

[0062] There are 15 different mutation sites between the complemented strain and the dominant mutant strain, and these 15 mutation sites were edited and verified. The genes involved in these 15 mutation sites were knocked out by homologous recombination using hygromycin as a biomarker and the phenotype was verified. Four pairs of primers were designed for the asr1 gene (A1A106651). The first pair of primers, asr1-up-F (CTACCGGCCTAGAGGC AATTTC) and asr1-up-R (GGTAGCTCTCATCGATTGGTCGCGGGCTAGTTATGCGTATAGCAG), amplified a 1500 bp fragment upstream of the asr1 gene from the Trichoderma genome; the second pair of primers, asr1-do-F (CCATAGTACCACCCCGCCATAAAGCAAATTCTTCTACGGGG AGGGAC) and U3-do-R (GATAAGCCCGGGGATGGTATTG) amplified a 1500 bp fragment downstream of the asr1 gene from the Trichoderma genome; the third pair of primers, HygB-F (CGATTGT GTGTACTAGGTAGGCTCG) and HygB-R (GGAATCGACCTTGCATGCGATG) were used to amplify the open reading frame of the hygromycin B phosphotransferase gene from the pcDNA1 plasmid, which is the hygromycin resistance expression frame. The fourth pair of primers E-asr1-F (GTTGTTTGGACTCGAAGCGC) and E-HygB-R (GGTCGTTTCTGACACAACGGTG) are homologous recombination verification primers. The three fragments upstream of the asr1 gene, the hygromycin B resistance expression frame and the downstream of the asr1 gene were designed with primers so that the two adjacent fragments had a base complementary overlap region of about 25 bp, in which the upstream end and the initial end of hygromycin overlapped complementary, and the hygromycin end and the initial end of the downstream overlapped complementary; the gene knockout fragment of the asr1 upstream fragment + hygromycin resistance expression frame + asr1 downstream fragment could be obtained by overlapping extension PCR. The results showed that the deletion of one of the genes could significantly improve the growth ability under Trichoderma acid stress, which is consistent with the trend of the mutant strain. (such as Figure 5 (shown)

[0063] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. An asexually reproducing filamentous fungus, characterized in that: The asexually reproducing filamentous fungus is a wild strain of Trichoderma, and the preservation number of the wild strain of Trichoderma is: CGMCC No.12166; the preservation unit is: China General Microbiological Culture Collection Management Center; the preservation date is: April 11, 2016.

2. A method for mining new functional genes of asexually propagated filamentous fungi according to claim 1, characterized in that: The following steps are involved: S1. Construction of Trichoderma strain A that is deficient in urea synthesis but resistant to hygromycin; S2, obtaining a random mutant strain B, irradiating the wild-type strain with X-rays and screening out a random mutant strain B with acid resistance; S3, protoplast preparation and fusion, constructing a temporary pseudo-"diploid" by protoplast fusion method; the two sets of chromosomes of the temporary pseudo-"diploid" are respectively from Trichoderma strain A and random mutant strain B; S4, screening and phenotypic verification, random complementation of random mutant chromosome genes through homologous recombination of two sets of chromosomes in the nucleus, and screening of phenotypic changes to obtain phenotypic complement mutants; S5. Resequencing and gene editing verification: Use resequencing technology to determine the key mutation sites to be complemented and reversely verify the gene function through gene editing methods.

3. The method according to claim 2, characterized in that: In step S1, the construction of the Trichoderma strain A is to knock out the key gene ura3 (A1A105144) of Trichoderma uridine synthesis by using hygromycin as a biomarker.

4. The method according to claim 2, characterized in that: In step S2, the random mutant strain B is obtained by taking 200 μl of a 1×10 7 The spore suspension was plated in a 96-well plate and then irradiated with X-rays. The irradiated spore suspension was diluted and spread on a screening medium under the required conditions to screen for mutant strain B with a significant phenotypic change.

5. The method according to claim 4, characterized in that: The total dose of X-ray irradiation is 250 Gy, and the irradiation is performed three times in total, with doses of 84 Gy, 84 Gy and 82 Gy respectively.

6. The method according to claim 2, characterized in that: In step S3, the process and verification method of protoplast fusion are as follows: protoplasts of Trichoderma strain A and random mutant strain B are prepared respectively, and then fused using a PEG-mediated method, regenerated transformants are screened using a hygromycin-containing oligotrophic medium and then single spore separation is performed, heterokaryotic transformants are removed, temporary pseudo-"diploid" transformants are retained, and verification is performed using specific primers.

7. The method according to claim 6, characterized in that: The protoplast fusion method is to mediate protoplast fusion by gradually decreasing the concentration of PEG, and the specific process is: 9.5% PEG + Ca 2+ Hypertonic solution at room temperature for 5 minutes; 7% PEG + Ca 2+ Hypertonic solution on ice for 5 minutes; 5% PEG + Ca 2+ Keep the hypertonic solution on ice for 20 min.

8. The method according to claim 6, characterized in that: The specific primers include: E-U3-F, E-hygb-R; E-U3-F, E-U3-R.

9. The method according to claim 5, characterized in that: The basic salt glucose medium containing hygromycin B was used as a temporary pseudo-"diploid" screening medium.

10. The method according to claim 2, characterized in that: In step S4, a basic salt glucose medium is used to screen strains in which the target functional gene is complemented.

11. The method according to claim 2, characterized in that: In step S5, the specific process of using resequencing technology to determine the key mutation sites for complementation is: the mutant C whose phenotype changed after the last complementation and the initial mutant strain B are cultured on PDA, and then the mycelium is extracted for mapping analysis. After data analysis, the mutation sites of the two are compared. The mutation sites of the complemented strain C are less than those of the mutant strain B. The difference in the mutation sites between the two is the range of the key gene.

12. Application of the method according to any one of claims 2 to 11 in mining new functional genes in response to acid.

Images