Soybean salt-tolerant gene GmHAL3a and application thereof

Abstract

The invention discloses a soybean salt-tolerant gene GmHAL3a and application thereof, the gene GmHAL3a has a positive regulation effect on the salt stress coping process of soybeans, the sequence of the gene GmHAL3a is as shown in SEQ ID NO.1, and the sequence of encoded protein is as shown in SEQ ID NO.2. The invention further discloses a method for preparing the soybean salt-tolerant gene GmHAL3a. The gene GmHAL3a disclosed by the invention can be used for remarkably improving the tolerance of soybeans to salt stress.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a gene GmHAL3a for improving the salt tolerance of soybean and an application thereof. Background Art

[0002] Salt stress severely inhibits plant growth and development. Osmotic stress and ion toxicity are the two main reasons why salt stress affects plant growth. Osmotic stress refers to the high ion concentration outside the cell under salt stress, which directly leads to a decrease in osmotic potential, further resulting in a decrease in the plant's ability to absorb water and nutrients. Ion toxicity occurs when the salt level exceeds a certain threshold. When the plant cannot maintain the ion balance in the body, it will further trigger a series of secondary reactions, such as oxidative stress, nutritional stress, etc. [1] Therefore, salt stress will have certain effects on plant seed germination, growth and development, photosynthesis, ion accumulation, etc. [2] .

[0003] Soybean is the main source of high-quality protein and edible oil. At present, the total area of ​​saline-alkali soil in the world has reached about 1.1×109hm 2 In more than 100 countries and regions around the world, the area of ​​saline-alkali soil is still increasing, and it is a very important reserve arable land resource. [3] Therefore, cultivating salt-alkali tolerant soybeans is the most effective way to expand soybean planting area and increase my country's total soybean production.

[0004] [1]Mauro RP, Perez Alfocea F, Cookson SJ, et al. Editorial: physiological and molecular aspects of plant rootstock-scion interactions[J]. Frontiers in Plant Science, 2022, 13(1): 852518.

[0005] [2]Park HJ,Kim WY,Yun D J.Arole for GIGANTEA keeping the balance between flowering and salinity stress tolerance[J].Plant Signaling&Behavior,2013,8(7):e24820.

[0006] [3] Litalien A, Zeeb B. Curing the earth: A review of anthropogenic soilsalinization and plant-based strategies for sustainable mitigation [J]. Science of the Total Environment, 2020, 698(1): 134235. Summary of the invention

[0007] The purpose of the present invention is to provide a soybean GmHAL3a gene and its application in regulating salt tolerance. The gene can be introduced into plants to improve the tolerance of soybeans to salt stress, so as to improve plant varieties.

[0008] The soybean disease resistance regulatory gene GmHAL3a of the present invention has a sequence as shown in SEQ ID NO.1.

[0009] The present invention also provides a protein encoded by the gene GmHAL3a, the sequence of which is shown in SEQ ID NO.2.

[0010] The invention also provides a recombinant expression vector comprising the gene GmHAL3a.

[0011] The expression vector can be a conventional vector in the art connected to the gene GmHAL3a of the present invention, for example, a recombinant expression vector formed by cutting the vector pBinGFP4 with restriction enzymes Kpn I and BamH I and inserting the gene GmHAL3a.

[0012] The present invention also provides a transformant obtained by introducing a recombinant expression vector containing the gene GmHAL3a into a host cell, wherein the host cell is preferably an Escherichia coli cell or an Agrobacterium cell.

[0013] The present invention provides primers for amplifying the gene of the present invention.

[0014] The primers for amplifying the gene GmHAL3a of the present invention can be designed according to conventional methods in the art. In one embodiment, the primers are: GmHAL3a-F ATGGCCGGTTCAGAACCTGT (SEQ ID NO. 3); GmHAL3a-RTCAGATATCACCATTACCTT (SEQ ID NO. 4).

[0015] The present invention also provides the use of the soybean salt-tolerance gene GmHAL3a, recombinant expression vector, transformant, or primer in improving the salt tolerance of soybean. More specifically, the gene GmHAL3a is introduced into soybean for overexpression.

[0016] The present invention also provides a method for improving the salt tolerance of soybeans, wherein the gene GmHAL3a is introduced into soybeans for over-expression.

[0017] The present invention also provides a method for cultivating a salt-tolerant soybean variety, wherein the gene GmHAL3a is introduced into soybean for overexpression to obtain a salt-tolerant soybean variety.

[0018] The present invention also provides the use of the soybean salt-tolerant gene GmHAL3a, the recombinant expression vector, the transformant, or the primer in improving the soybean chlorophyll content under salt stress conditions.

[0019] Beneficial Effects of the Invention

[0020] The present invention shows that the phenotype and chlorophyll content index of transgenic soybeans overexpressing GmHAL3a after 300mM NaCl stress indicate that GmHAL3a plays an important regulatory role in improving plant tolerance to salt stress. By using this gene for genetic engineering improvement of soybean salt tolerance, it is found that this gene has a certain effect on breeding salt-tolerant soybean varieties, and can improve the yield and quality of soybeans by improving the salt tolerance of soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : A: Cloning of GmHAL3a.

[0022] Figure 2 : Expression pattern of GmHAL3a in soybean variety Tianlong No.1 after salt stress; A: Expression pattern of GmHAL3a in roots; B: Expression pattern of GmHAL3a in leaves.

[0023] Figure 3 : Subcellular localization of GmHAL3a.

[0024] Figure 4 : Phenotype and chlorophyll content accumulation of wild type and GmHAL3a overexpressing transgenic soybeans after salt stress (WT: Tianlong No. 1 as the wild type; GmHAL3a_OE5, GmHAL3a_OE12: different lines of GmHAL3a overexpressing transgenic soybeans), wherein: A: GmHAL3a gene expression level in leaves of wild type and GmHAL3a overexpressing transgenic soybeans; B: Phenotypes of wild type and GmHAL3a overexpressing transgenic soybeans after salt stress; C: Chlorophyll content accumulated in leaves of wild type and GmHAL3a overexpressing transgenic soybeans after salt stress. DETAILED DESCRIPTION

[0025] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0026] Agrobacterium strains EHA101 and GV3101 are both preserved and provided by our laboratory. Our research group promises to make them permanently available to the public. They can also be obtained commercially.

[0027] The pBinGFP4 vector used for subcellular localization was kindly donated by Professor Dou Daolong from the College of Plant Protection, Nanjing Agricultural University. Our research group promises to make it permanently available to the public. It can also be obtained commercially.

[0028] The nuclear localization signal NLS-mCherry vector used was kindly donated by Associate Professor Ding Chengqiang of the College of Agriculture of Nanjing Agricultural University. Our research group promises to make it permanently available to the public. It can also be obtained commercially.

[0029] Escherichia coli (E. coli) Trans 5α competent cells, DL5000 Plus DNA Marker, Taq enzyme, high-fidelity enzyme (Max Super-Fidelity DNA Polymerase) and plasmid extraction kits were purchased from Nanjing Novozymes Biotechnology Co., Ltd.; DNA / RNA reagent extraction kits were purchased from Shanghai Pudi Biotechnology Co., Ltd.; DNA gel recovery kit (GE706) was purchased from Beijing Jinsha Biotechnology Co., Ltd.; homologous recombination kits were purchased from Nanjing Jujiang Biotechnology Co., Ltd.; reverse transcription and fluorescence quantification kits were purchased from Shanghai Yishen Biotechnology Co., Ltd.

[0030] Example 1 Gene cloning and expression analysis of GmHAL3a after salt stress

[0031] Using the cDNA of soybean variety Suxie No. 1 leaf as template (SEQ ID NO. 1), the specific primers of GmHAL3a as shown in SEQ ID NO. 3 and SEQ ID NO. 4 were used to amplify a DNA fragment of 636 bp in length ( Figure 1 ).

[0032] GmHAL3a-F ATGGCCGGTTCAGAACCTGT (SEQ ID NO.3);

[0033] GmHAL3a-RTCAGATATCACCATTACCTT (SEQ ID NO. 4).

[0034] The soybean variety Tianlong No. 1 was treated with 200 mM NaCl and it was found that the transcription level of GmHAL3a in roots and leaves changed significantly after salt treatment compared with 0 h ( Figure 2 ), it can be seen that the gene GmHAL3a is highly related to the soybean response to salt stress. The nucleotide sequence of the gene GmHAL3a is shown in SEQ ID NO.1, and the encoded protein sequence is shown in SEQ ID NO.2.

[0035] Example 2 Subcellular localization analysis of protein

[0036] 1. Construction of transient expression vector

[0037] The primers (F: ATTACGAACGATAGGGTACCATGGCCGGTTCAGAACCTG; R: AATGTTTGAACGATCGAGCTCTCAGATATCACCATTACCTTGCTGA) for amplifying the GmHAL3a gene sequence (SEQ ID NO.1) containing restriction sites (Kpn I and BamH I sites) were designed using Vazyme's CE Design V1.04 software. The restriction enzymes Kpn I and BamH I were used to digest the vector pBinGFP4. After PCR, the band size was detected by agarose gel electrophoresis, and the product was purified. The pBINGFP4 expression vector was digested with TaKaRa's QuickCut restriction enzymes Kpn I and BamH I, and then the amplified fragment and the digested vector were recombined to form the recombinant plasmid pBin-GmHAL3a-GFP4.

[0038] 2. Agrobacterium injection into tobacco

[0039] (1) Pipette 10 μL of Agrobacterium containing the pBin-GmHAL3a-GFP4 recombinant plasmid into 4 mL of YEP culture medium containing rifampicin and kanamycin, and culture at 28°C and 200 rpm in a shaking incubator for 12-16 h.

[0040] (2) Take 200 μL of the cultured bacterial solution and add it to 30 mL of YEP culture medium containing rifampicin and kanamycin (use a 50 mL centrifuge tube) and culture it in a 28°C incubator overnight.

[0041] (3) Prepare the permeation solution reagent as shown in Table 1.

[0042] Table 1 - Permeate Configuration

[0043]

[0044] (4) OD 600The bacterial solution with an OD value of 0.5-0.7 was centrifuged at 4500×g for 5 min. The supernatant was discarded and washed three times with the permeate solution. The permeate solution was then added and mixed. 600 It can be used when the value reaches between 0.1-0.2.

[0045] (5) The resuspension containing empty pBinGFP4 and the resuspension containing membrane localization signal mCherry were mixed in equal volumes as the control group, and the resuspension containing pBin-GmHAL3a-GFP4 target plasmid and the resuspension containing mCherry were mixed in equal volumes as the experimental group.

[0046] (6) Select tobacco leaves with a growth cycle of 4 weeks and good growth for injection. Use a 1 mL syringe to absorb the bacterial solution, turn the leaf over, press the syringe tip vertically on the back of the leaf, and gently push the syringe to observe the diffusion of the bacterial solution in the tobacco leaf until the entire leaf is infected.

[0047] (7) The injected tobacco plants were kept in the dark for 48 h, and the localization of GmHAL3a was observed using a laser confocal microscope.

[0048] The results are as follows Figure 3 : After amplification, GmHAL3a was homologously recombined into the pBinGFP4 vector to construct the pBin-GmHAL3a-GFP4 fusion vector. The localization of GmHAL3a was observed by injecting tobacco using the Agrobacterium-mediated transient expression system, and it was found that the GmHAL3a protein was localized in the cell nucleus and plasma membrane.

[0049] Example 3

[0050] 1. Agrobacterium-mediated genetic transformation of soybean

[0051] The primers for amplifying the GmHAL3a gene (SEQ ID NO. 1) containing restriction sites (Sal I and Sma I sites) were designed using Vazyme's CE Design V1.04 software. Primer F: GAGAACACGGGGGACTCTAGAATGGCCGGTTCAGAACCTG; R: AATGTTTGAACGATCGAGCTCTCAGATATCACCATTACCTTGCTGA. GmHAL3a was recombined into the pTF101.1 expression vector to obtain the pTF101.1-GmHAL3a recombinant plasmid. The recombinant plasmid was transformed into Agrobacterium EHA101 for later use.

[0052] 2. Obtaining transgenic soybeans with GmHAL3a overexpression

[0053] 2.1 Genetic transformation

[0054] (1) Chlorine sterilization of wild-type Tianlong No. 1 seeds: Select Tianlong No. 1 soybean seeds of uniform size, without damaged seed coat and disease spots, and place them in a 9 cm long plastic square dish. Perform the operation in a ventilated place, use 100 mL of sodium hypochlorite and 15-20 mL of concentrated hydrochloric acid for reaction, and react for 1 hour under closed conditions.

[0055] (2) Germination: Prepare sterilized ultrapure water in advance, soak the seeds sterilized by chlorine in ultrapure water, and place 250 mL of ultrapure water and about 90 seeds in each 500 mL conical flask. Incubate in the dark at 25°C for 12-16 hours until the seeds are fully imbibed.

[0056] (3) Infection: Take 10 μL of EHA101 Agrobacterium culture medium containing pTF101.1-GmHAL3a and add it to 4 mL of YEP liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin, and culture at 28°C for 16-24 h. Take 500 μL of the shaken culture medium and spread it on a plate to continue culturing the strain for 2 days. Use a sterilized spoon to scrape the bacteria into the CCM infection solution and adjust the OD 600 Between 0.6 and 1.0. Pick up the imbibed seeds into a clean round dish, cut each bean from the hilum, and then use the tip of a knife to cut a few times at the cotyledon node, put the cut beans into the round dish containing the infected bacterial solution and shake slowly for 30 minutes.

[0057] (4) Co-cultivation: Pick the bean petals out of the infection solution, peel off the seed coat, and place the cotyledons with the curved surface facing downward in a sterile empty dish. Incubate in the dark at 25°C for 5 days.

[0058] (5) Inducing adventitious buds and bud elongation: Insert the explants obliquely into the bud induction medium (SI), and replace the medium every two weeks. During the subculture process, the lush green buds can be cut off, because the buds grown at this time are usually not positive. During the third subculture, cut off the cotyledons, leaving only 3-4 mm in length, and culture them in the bud elongation medium (SE). And each time the medium is changed, gently cut a wound on the back of the explant to better absorb the medium. Generally, the SE medium is changed 6 times.

[0059] (6) Rooting: When the elongated shoots grow to about 4 cm, use sterilized scissors to cut the induced shoots from the explants and transfer them to rooting medium (RM). Roots will grow in about 15 days.

[0060] (7) Hardening and transplanting to greenhouse: When the seedlings grow stably in the rooting medium, remove the seedlings, wash the remaining medium, transplant the seedlings into a plastic cup filled with vermiculite, and turn the plastic cup of the same size upside down to keep it moist. When the roots of the seedlings grow stably, gradually open the plastic cup to complete the hardening. Move the seedlings to a large flower pot and culture in the greenhouse until harvest.

[0061] 2.2 Identification of GmHAL3a overexpressing transgenic lines

[0062] Leaves of transgenic lines and wild-type plants were taken as samples to extract total RNA, and the transcription level of the target gene GmHAL3a was detected by qRT-PCR.

[0063] The results are as follows Figure 4 As shown in A, two high-expressing strains were selected, namely OE5 and OE12, whose up-regulation folds were between 4-10 times, indicating that GmHAL3a was successfully overexpressed.

[0064] Example 4: Exploring whether GmHAL3a is involved in regulating soybean salt tolerance

[0065] Seeds of the T3 generation GmHAL3a overexpressing transgenic soybean (GmHAL3a_OE) and wild-type Tianlong No. 1 of Example 3 were sown, and the same number of seedlings of different materials with consistent growth were retained. When the seedlings grew to two weeks old, 200mM NaCl treatment was carried out. After 17 days of salt stress, the leaves of WT dried up and wilted severely, but the leaves of GmHAL3a_OE only turned slightly yellow ( Figure 4 B). SPAD value refers to the relative content of chlorophyll. The SPAD of the three-leaved compound leaves at the top of the seedlings was measured and it was found that under normal conditions, the SPAD value of GmHAL3a_OE was about 36, which was not significantly different from WT; after salt stress, the SPAD value of GmHAL3a_OE decreased by about 25% to about 27; the SPAD value of WT was about 19, which was significantly lower than that of GmHAL3a_OE ( Figure 4 C).

[0066] The above results indicate that overexpression of GmHAL3a enables plants to maintain a better photosynthetic state under salt stress, thereby positively regulating the salt tolerance of soybean seedlings.

Claims

1. The soybean salt tolerance gene GmHAL3a, the sequence of which is shown in SEQ ID NO.

1.

2. The protein encoded by the gene GmHAL3a according to claim 1, the sequence of which is shown in SEQ ID NO.

2.

3. A recombinant expression vector comprising the gene GmHAL3a according to claim 1; preferably, the recombinant expression vector is formed by cutting the vector pBinGFP4 with restriction enzymes Kpn I and BamH I and inserting the gene GmHAL3a.

4. A transformant obtained by introducing a recombinant expression vector comprising the gene GmHAL3a according to claim 1 into a host cell.

5. The transformant according to claim 4, characterized in that The host cell is an Escherichia coli cell or an Agrobacterium cell.

6. Primers for amplifying the gene GmHAL3a according to claim 1, preferably, the primers are specifically shown as SEQ ID NO.3 and SEQ ID NO.

4.

7. Use of the gene GmHAL3a according to claim 1, the protein according to claim 2, the recombinant expression vector according to claim 3, the transformant according to claim 4 or 5, and the primers according to claim 6 in improving the salt tolerance of soybean; preferably, the gene GmHAL3a according to claim 1 is introduced into soybean for overexpression.

8. A method for improving the salt tolerance of soybeans, characterized in that: The gene GmHAL3a according to claim 1 is introduced into soybean for overexpression.

9. A method for breeding salt-tolerant soybean varieties, characterized in that: The gene GmHAL3a described in claim 1 is introduced into soybean for overexpression to obtain a salt-tolerant soybean variety.

10. Use of the gene GmHAL3a according to claim 1, the protein according to claim 2, the recombinant expression vector according to claim 3, the transformant according to claim 4 or 5, and the primers according to claim 6 in increasing the chlorophyll content of soybean under salt stress conditions.

Images