Plant disease-resistant gene, method for improving plant disease resistance and application

Abstract

The invention provides a plant disease-resistant gene, a method for improving plant disease resistance and application, and belongs to the technical field of functional genes. The invention provides a specific disease-resistant gene comprising a pathogenic bacteria inducible promoter and a wheat disease-resistant gene TFR1 which are connected in sequence, and a broad-spectrum disease-resistant gene comprising a strong promoter and a wheat disease-resistant gene TFR1 which are connected in sequence. The disease-resistant gene is transferred into various plants, the specific disease-resistant gene shows the disease resistance the same as that of a pathogenic bacteria induced promoter source, and the broad-spectrum disease-resistant gene shows broad-spectrum disease resistance, is flexible and changeable, is suitable for multiple crops, can be added according to different pathogenic bacteria of different crops, and has wide application prospects. According to the invention, transformation after connection of one gene and different promoters is realized, so that disease-resistant types are generated for various pathogenic bacteria, and the transgenosis cost is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and specifically relates to plant disease resistance genes and methods and applications for improving plant disease resistance. Background Art

[0002] The wheat TFR1 gene (NCBI Reference Sequence: XP_044432367.1) is a gene that is homologous to the barley rust resistance gene Rph3, and its function in wheat has not been reported. There are disease-resistant bodies in plant cells, which can be divided into two types. One type binds to specific effectors to form polymers, opens holes in the cell membrane, triggers calcium ion flow, and causes plant disease resistance. After the other effector binds, it needs the help of helper genes to polymerize and open holes in the cell membrane, triggering calcium ion flow and causing plant disease resistance. However, at present, plant disease-resistant bodies still have great inconveniences in transformation and design, and they are often unsatisfactory in the face of the invasion of various diseases such as fungi, bacteria, and viruses. At the same time, cloning and discovering more disease-resistant bodies from plants requires a lot of manpower, material resources, and financial resources.

[0003] At the same time, the current discovery of disease-resistant genes is limited. Traditional disease-resistant gene discovery programs consume a lot of manpower and material resources, and traditional disease-resistant genes can only fight against one or several physiological subspecies and cannot achieve joint disease resistance among large categories. Summary of the invention

[0004] The present invention provides a plant disease resistance gene and a method and application for improving plant disease resistance, introduces TFR1 into disease resistance of multiple plants, and proves its role in plant disease resistance.

[0005] The invention provides a plant-specific disease-resistant gene, comprising a promoter and a wheat disease-resistant gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1; and the promoter is a pathogen-inducible promoter of a corresponding pathogen resistant to a target disease.

[0006] Preferably, the pathogen-inducible promoter includes PR10pro.

[0007] The invention provides a plant broad-spectrum disease-resistant gene, comprising a strong promoter and a wheat disease-resistant gene TFR1 which are connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1.

[0008] Preferably, the strong promoter comprises Mas.

[0009] The present invention also provides the use of wheat disease resistance gene TFR1 or the plant specific disease resistance gene or the plant broad-spectrum disease resistance gene in plant disease resistance. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1; the plant and wheat have species differences.

[0010] Preferably, the plant species include monocots or dicots.

[0011] Preferably, the monocotyledonous plant includes rice;

[0012] The dicotyledonous plants include tobacco.

[0013] The present invention provides a method for improving plant-specific disease resistance, comprising transferring the plant-specific disease resistance gene into the plant.

[0014] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising transferring the above-mentioned plant broad-spectrum disease resistance gene into plants.

[0015] The present invention also provides the use of wheat disease resistance gene TFR1 or the plant specific disease resistance gene or the plant broad-spectrum disease resistance gene in creating disease-resistant plant germplasm. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1.

[0016] Beneficial effects: The present invention provides a class of disease-resistant genes based on wheat TFR1 gene, including specific disease-resistant genes formed by connecting with pathogen-inducible promoters, and broad-spectrum disease-resistant genes formed by connecting with strong promoters. The disease-resistant gene design method is more flexible and the designability is significantly enhanced. The present invention transfers the disease-resistant genes into a variety of plants, and the specific disease-resistant genes show the same disease resistance as the pathogen-inducible promoter source, and the broad-spectrum disease-resistant genes show broad-spectrum disease resistance, which is flexible and applicable to multiple crops. The promoter sequence is flexible and can be added according to different crops and different pathogens, realizing the transformation after connecting one gene with different promoters, thereby producing disease-resistant types to multiple pathogens and reducing the cost of transgenics. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The figure is a verification result that wheat TFR1 protein has the basic characteristics of plant disease resistance protein. In the figure, a is the result of TFR1 causing HR response and ROS burst in tobacco cells, b is the result of TFR1-induced ROS burst-ROS measurement in Nicotiana benthamiana, c is the result of TFR1 causing high expression of tobacco disease resistance-related genes, and d is the result of TFR1 causing ion leakage in Nicotiana benthamiana.

[0018] Figure 2 The figure is the result of the resistance verification of mTFR1 transgenic tobacco to pepper phytophthora and Rhizoctonia solani (Rhizoctonia solani was isolated in the field, derived from tobacco target spot disease leaves, and has not been published). In the figure, a is the result of mTFR1 inoculated pepper phytophthora lesions, b is the corresponding lesion area in figure a, c is the result of mTFR1 inoculated Rhizoctonia solani lesions, d is the corresponding lesion area in figure c;

[0019] Figure 3 The results of the size of rice blast lesions in pTFR1 transgenic rice are shown in Figure a. The results of rice leaf lesions and ROS bursts caused by TFR1 are shown in Figure b. The size of rice blast lesions in pTFR1 is shown in Figure c. The corresponding lesion area in Figure b is shown in Figure b.

[0020] Figure 4 This is the recombinant plasmid map of MAS-TFR1. DETAILED DESCRIPTION

[0021] The invention provides a plant-specific disease-resistant gene, comprising a promoter and a wheat disease-resistant gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1; and the promoter is a pathogen-inducible promoter of a corresponding pathogen resistant to a target disease.

[0022] The wheat disease resistance gene TFR1 (NCBI Reference Sequence: XP_044432367.1) of the present invention has an amino acid sequence of NCBI Reference Sequence: XP_044432367.1. The pathogen-inducible promoter of the present invention preferably includes PR10pro from rice, so the specific disease resistance gene formed by connecting PR10pro promoter and TFR1 has the effect of resisting rice blast.

[0023] The pathogen-inducible promoter of the present invention refers to a promoter that activates a target gene under the induction of pathogen infection, and expresses the target gene at a higher level during the pathogen infection period.

[0024] The invention provides a plant broad-spectrum disease-resistant gene, comprising a strong promoter and a wheat disease-resistant gene TFR1 which are connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1.

[0025] The strong promoter of the present invention preferably includes Mas. The broad-spectrum disease resistance gene of the present invention has a broad-spectrum disease resistance effect on a variety of crop diseases. For example, the broad-spectrum disease resistance gene formed by connecting Mas and TFR1 in the embodiment is transferred into tobacco, which has significant resistance to pepper phytophthora and Rhizoctonia solani.

[0026] The present invention also provides the use of wheat disease resistance gene TFR1 or the plant specific disease resistance gene or the plant broad-spectrum disease resistance gene in plant disease resistance. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1; the plant and wheat have species differences.

[0027] The present invention can transfer the TFR1 or specific disease resistance gene or broad-spectrum disease resistance gene into plants with species differences from wheat, thereby showing disease resistance. The present invention does not specifically specify the type of the plant, which can be a monocot or a dicot. The present invention is described using the monocot rice as an example and the dicot tobacco as an example, but they cannot be identified as the entire protection scope of the present invention.

[0028] The present invention provides a method for improving plant-specific disease resistance, comprising transferring the plant-specific disease resistance gene into the plant.

[0029] The present invention does not specifically limit the method of transfer. The corresponding gene is amplified by conventional means in the art and then inserted into an expression vector to construct a recombinant expression vector, and the recombinant expression vector is transferred into the target plant by a transformation method, thereby constructing a plant with specific disease resistance.

[0030] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising transferring the above-mentioned plant broad-spectrum disease resistance gene into plants.

[0031] The present invention does not specifically limit the method of transfer. The corresponding gene is amplified by conventional means in the art and then inserted into an expression vector to construct a recombinant expression vector, and the recombinant expression vector is transferred into the target plant by a transformation method, thereby constructing a plant with broad-spectrum disease resistance.

[0032] The present invention also provides the use of wheat disease resistance gene TFR1 or the plant specific disease resistance gene or the plant broad-spectrum disease resistance gene in creating disease-resistant plant germplasm. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1.

[0033] The present invention does not particularly limit the method for creating germplasm, but preferably includes genetic transformation.

[0034] To further illustrate the present invention, the plant disease resistance gene and the method and application of improving plant disease resistance provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1: Wheat TFR1 induces tobacco cell death and has plant disease resistance gene immunity characteristics

[0036] S1. Vector construction:

[0037] TFR1 was amplified and constructed into the pCAMBIA1300 vector by homologous recombination.

[0038] The primer sequences were designed as follows:

[0039] p1300-TFR1-F (SEQ ID No. 1): 5'ACACCAAATCGACTCTAGAAATGCCGCACATTGCTC3';

[0040] p1300-TFR1-R (SEQ ID No. 2): 5'CTTGCTCACCATGGTCTCGACGCCTTCGTCTGCC3'.

[0041] Amplification of TFR1 segment: PCR amplification was performed using the synthesized TFR1 (NCBI Reference Sequence: XP_044432367.1) segment as a template. The reaction conditions were: 95°C pre-denaturation for 5 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 28 cycles; 72°C extension for 5 min.

[0042] Homologous recombination ligation: The pCAMBIA1300 vector was digested with HindIII, and the digestion product and the corresponding fusion fragment were ligated to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain a vector containing the TFR1 gene (abbreviated as TFR1).

[0043] S2. Immune signature analysis:

[0044] (1) Transient expression of TFR1 in Nicotiana benthamiana to induce plant hypersensitivity (HR) response: This experiment was divided into three groups, pCAMBIAsuper1300 empty vector (EV) and positive control Xa23 (AIX09985.1) that induces HR response. TFR1 and Xa23 were constructed into pCAMBIAsuper1300 vectors and transformed into Agrobacterium GV3101. After shaking for 16 hours, the bacteria were resuspended in infection solution (10mMMgCl2, 10mM MES and 150μM acetosyringone) and the OD of each component was adjusted. 600TFR1, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 24 hours after injection, the tobacco leaves were observed and photographed.

[0045] Primer sequences:

[0046] p1300-Xa23-F (SEQ ID No. 3): ATACACCAAATCGACTCTAGAAAGCTTATGTTGCATCATCTCAAGGAGCT;

[0047] p1300-Xa23-R (SEQ ID No. 4): TCGCCCTTGCTCACCATGGTCTCTTAAACAGGGAGAATAACCATCTTGTCG.

[0048] The results are as follows Figure 1 As shown in a, both TFR1 and the positive control Xa23 can induce HR response in tobacco cells, while the empty vector (EV) does not induce HR response in tobacco cells.

[0049] (2) TFR1-induced reactive oxygen species (ROS) burst in Nicotiana benthamiana - DAB staining: As described in (1), TFR1, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 15 h after injection, the injected tobacco leaves were immersed in 20 ml of DAB staining solution, incubated horizontally in the dark for 8 h, and then placed in 95% ethanol for decolorization, incubated horizontally for 48 h, and photographed under white light.

[0050] The results are as follows Figure 1 As shown in a, both TFR1 and the positive control Xa23 can stain the ROS burst, while the control group empty vector (EV) has no such phenomenon. This shows that TFR1 expression in tobacco cells can induce ROS burst like the positive control Xa23.

[0051] (3) TFR1-induced ROS burst in Nicotiana benthamiana - ROS assay: The experiment was divided into eight groups, namely, TFR1 / Flg22 group, EV / Flg22 group, TFR1 / mock group (control group 1), and EV / mock group (control group 2). Among them, in the TFR1 / Flg22 group, the N. benthamiana leaves containing TFR1 Agrobacterium were induced with a mixed solution containing the N-terminal 22aa of bacterial flagellin (Flg22, purchased from Sigma: SRP8029) (final concentration 0.02mM), the N. benthamiana leaves containing empty vector EV Agrobacterium were induced with a mixed solution containing the N-terminal 22aa of bacterial flagellin (Flg22) (final concentration 0.02mM), the TFR1 / mock group was treated with distilled water for N. benthamiana leaves containing TFR1 Agrobacterium, and the EV / mock group was treated with distilled water for N. benthamiana leaves containing empty vector EV Agrobacterium. Each sample group had at least eight biological replicates.

[0052] Agrobacterium containing expression plasmids of TFR1 and empty vector EV was injected into 4-week-old Nicotiana benthamiana leaves, and Agrobacterium containing expression plasmids of empty vector was used as EV control. After 7 hours, 3 mm × 3 mm Nicotiana benthamiana leaf discs were collected and immersed in distilled water overnight in a 96-well plate. The distilled water was discarded, and 100 μL of mixed solution (50 μM luminol (Wako), 10 μg / mL horseradish peroxidase and 2 mM Flg22) was added to each well. 100 μL of distilled water was added to each well of the TFR1 / mock group and the EV / mock group as a control. Chemiluminescence was measured at intervals of 500 ms for 60 minutes in a SPARK-10M microplate reader (TECAN).

[0053] The results are as follows Figure 1 As shown in b, after induction with Flg22, the reactive oxygen in tobacco expressing the TFR1 gene increased sharply, significantly higher than that of the material not expressing the TFR1 gene, indicating that TFR1 expression can induce the production of reactive oxygen, and the total amount of reactive oxygen is much higher than that of the control group 1-2.

[0054] (4) Detection of disease resistance-related genes: Experimental method: The experiment was divided into four groups, namely, Agrobacterium injected with TFR1 expression plasmid in Nicotiana benthamiana as the experimental group and Agrobacterium injected with empty vector expression plasmid in Nicotiana benthamiana as the EV control. Each sample was subjected to at least three biological replicates.

[0055] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves containing TFR1 and control EVs were collected 15 hours after Agrobacterium injection and quickly frozen in liquid nitrogen. The leaves were ground in liquid nitrogen for RNA extraction. Total RNA was extracted from the samples using RNAprep PurePlantKit (TianGenBiotech; China). RNA was purified from total RNA using DNase I (Thermo Scientific). Complementary DNA (cDNA) was synthesized using HiScript II First Strand cDNA Synthesis Kit (Vazyme). qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad) using SYBR Green Mix (Vazyme), using tobacco actin gene as the internal reference gene, and primer sequences:

[0056] qRT-NbEF1a-F (SEQ ID No. 5): AGAGGCCCTCAGACAAAC;

[0057] qRT-NbEF1a-R (SEQ ID No. 6): TAGGTCCAAAGGTCACAA;

[0058] Detection of PR1b in tobacco samples, primer sequences:

[0059] qRT-NbPR1b-F (SEQ ID No. 7): GTGGACACTATACTCAGGTG;

[0060] qRT-NbPR1b-R (SEQ ID No. 8): TCCAACTTGGAATCAAAGGG;

[0061] Detection of PR2b in tobacco samples, primer sequences:

[0062] qRT-NbPR2b-F (SEQ ID No. 9): AGGTGTTTGCTATGGAATGC;

[0063] qRT-NbPR2b-R (SEQ ID No. 10): CTGTACCACCACCATTCTGC;

[0064] Detection of LOX in tobacco samples, primer sequences:

[0065] qRT-LOX-F(SEQ ID No.11):AAAACCTATGCCTCAAGAAC;

[0066] qRT-LOX-R (SEQ ID No. 12): ACTGCTGCATAGGCTTTGG.

[0067] 2 -ΔΔCt Methods were used to calculate gene expression levels.

[0068] The results are as follows Figure 1 As shown in Figure c, the expression levels of disease resistance genes such as LOX, PR1b, PR2b, etc. in tobacco samples injected with TFR1 were significantly increased, significantly higher than those in the control group, indicating that the expression of TFR1 activated the expression of plant disease resistance genes and proved that the TFR1 gene has the immune characteristics of plant R genes.

[0069] (5) TFR1-induced ion leakage assay of Nicotiana benthamiana: This experiment consisted of three groups: TFR1 group, Xa23 group, and EV group. Each group injected the corresponding Agrobacterium (TFR1, Xa23, or EV) into the same tobacco leaf, and each treatment group was set up with three replicates; 8 leaf disks with a diameter of 3 mm were cut from the injection area at 10 h, 15 h, and 20 h after injection; the leaf disks were immediately placed in a 10 mL centrifuge tube containing 5 mL of sterile ultrapure water; the centrifuge tube was incubated for 2 hours to allow the leaf disks to release ions, and the conductivity of the solution in the centrifuge tube was measured using a conductivity meter. The leaf disks were boiled for 10 minutes to ensure that the plant cells were completely ruptured and all electrolytes were released, and the conductivity of the solution in the centrifuge tube was measured again to determine the maximum conductivity after boiling. The plant ion leakage rate was counted and calculated.

[0070] Example 2 Analysis of resistance of mTFR1 transgenic tobacco to Phytophthora capsici and Rhizoctonia solani

[0071] Preparation of S1 and mTFR1 transgenic tobacco materials

[0072] The TFR1 vector constructed into the pCAMBIA1300 vector in Example 1 was used ( Figure 4 ) to prepare transgenic Nicotiana benthamiana.

[0073] The transgenic method is as follows:

[0074] (1) Agrobacterium infection of tobacco: Cut Nicotiana benthamiana leaves into 2 cm pieces. 2 The leaves were cultured on a co-culture medium (MS medium + NAA 0.1 mg / L + 6-BA 1.5 mg / L), and the cut leaves were placed in an Agrobacterium solution containing the artificially designed plant disease resistance protein vector constructed in Example 1 with an OD value of 0.4-0.6 and immersed for 10 minutes. The bacterial solution was then poured out and the leaves were transferred to a sterile filter paper, the bacterial solution was discarded and dried.

[0075] (2) Differentiation and screening of transgenic tobacco: The leaves co-cultured for 3 days were transferred to a culture medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8). Cultured at 25°C under light conditions. After culturing for two to three weeks, the tobacco sprouts that grew were excised and transferred to a seedling medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin) for culture.

[0076] (3) Rooting of transgenic tobacco: Tobacco seedlings with roots were selected and transferred to rooting medium (MS + 30 mg / L hygromycin) for culture and testing.

[0077] (4) Extract genomic DNA samples using the CTAB method.

[0078] (5) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and Maspro-TFR1 transgenic tobacco was obtained, named mTFR1.

[0079] The PCR detection primers are as follows:

[0080] SeqTFR1-F (SEQ ID No. 13): ATGCCGCACATTGCTC;

[0081] SeqTFR1-R (SEQ ID No. 14): GACGCCTTCGTCTGCC.

[0082] After culturing the mTFR1 transgenic tobacco obtained above for one month, disease resistance immunity test was performed.

[0083] Phytophthora capsica LT263 (Li, Qi, et al. "A Phytophthora capsici Effector Targets ACD11 Binding Partners thatRegulate ROS-Mediated Defense Response in Arabidopsis." Molecular Plant, vol. 12, 2019, pp. 565-581.) or Rhizoctonia solani HN-18 was activated on a PDA plate and cultured at 25°C for 3-4 days. The bacterial cake was punched with a 3mm puncher and inoculated into two young leaves of mTFR1 transgenic tobacco and wild-type tobacco (WT) that had been cultured for one month. mTFR1 transgenic tobacco was used as the experimental group, and WT tobacco was used as the control group. At 36h (hpi) after inoculation, photos were taken under ultraviolet (UV) light for statistics.

[0084] The results are as follows Figure 2 As shown in the figure, the size of the lesions of pepper Phytophthora and Rhizoctonia solani in mTFR1 was significantly smaller than that in the control group. In summary, mTFR1 transgenic tobacco has significant resistance to pepper Phytophthora and Rhizoctonia solani.

[0085] Example 3 Analysis of resistance of pTFR1 transgenic rice to rice blast fungus

[0086] Use TFR1 in Example 1 to connect the PR10pro promoter to construct the pRHE vector

[0087] The transgenic method is as follows:

[0088] (1) Seed disinfection: Soak peeled rice seeds in 75% ethanol for 1 minute, then treat them twice with 2.5% sodium hypochlorite, each for 15 minutes, and finally rinse them with sterile ddH2O for 3 to 5 times.

[0089] Induction and subculture of callus: Sterilized mature seeds were cultured in the dark at 28°C for 25-28 days to induce callus. After the callus grew to a suitable size, smooth, light yellow, hard embryonic callus was selected and evenly spread on the subculture callus medium (macroelements (20×) 50mL, trace elements (200×) 5mL, iron salts (200×) 5mL, organic matter (200×) 5mL, Sucrose 30.0g, pH adjusted to 5.8, ddH2O to 1L, agar 7.4g, autoclaved at 121°C for 30min, zeatin (1mg / mL) 200μL, kanamycin (100mg / mL) 1mL, hygromycin (25mg / mL) 1mL) was added when the temperature cooled to 60°C, and culture was continued for 7-8 days.

[0090] (2) Agrobacterium-mediated rice callus transformation and co-culture: After Agrobacterium was activated, it was co-cultured with callus (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, inositol (20 mg / mL) 5 mL, vitamin B1 (1 mg / mL) 1.3 mL, 2,4-D (1 mg / mL) 200 μL, KH2PO4 (100 mg / mL) 2 mL, KT (1 mg / mL) 100 μL, Sucrose 30 g, pH adjusted to 5.8, ddH2O to 1 L, agar 7.4 g, autoclaved at 121°C for 30 min.) to make the OD of Agrobacterium reach 5.8. 600 Between 0.1 and 0.15. The callus after co-cultivation was first washed three times with sterile water, then soaked in sterile water containing 500 mg / L of cephalosporin for 30 minutes, then dried with filter paper, and spread on the selective medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8, ddH2O to 1 L, agar 7.4 g, 121°C autoclave for 30 min, IAA (1 mg / mL) 100 μL, zeatin (1 mg / mL) 2 mL, kanamycin (100 mg / mL) 1 mL, hygromycin (25 μg / mL) 1 mL) was added when the temperature cooled to 60°C.

[0091] (3) Selection and culture of transformed callus tissue: After co-culture, the callus was first washed three times with sterile water, then immersed in sterile water containing 500 mg / L cephalosporin for 30 minutes, then dried with filter paper, evenly spread on the selection medium, and cultured in the dark at 28°C for 10 days. After that, a second screening was carried out to select the light yellow callus with good growth status and continue to culture.

[0092] (4) Callus differentiation culture: yellow, round callus was selected and evenly spread on a pre-differentiation medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8, ddH2O to 1 L, agar 7.4 g, autoclaved at 121°C for 30 min, added zeatin (1 mg / mL) 200 μL, kanamycin (100 mg / mL) 1 mL, hygromycin (25 μg / mL) 1 mL when the temperature was cooled to 60°C), and cultured in the dark at 28°C for 7 days. Then, the embryonic calli with good growth and light yellow color were selected and placed in differentiation medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, IBA (1 mg / mL) 2 mL, Sucrose 30.0 g, agar 7.4 g, pH adjusted to 5.8, ddH2O fixed to 1 L, autoclaved at 121°C for 30 min, kanamycin (100 mg / mL) 500 μL, hygromycin (25 μg / mL) 11 mL were added when the temperature was cooled to 60°C), and cultured at 28°C for about 30 to 60 days under light until transgenic seedlings grew out.

[0093] (5) Extract genomic DNA samples using the CTAB method.

[0094] (6) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and PR10pro-TFR1 transgenic tobacco was obtained, named pTFR1.

[0095] The PCR detection primers are as follows:

[0096] SeqTFR1-F (SEQ ID No. 15): ATGCCGCACATTGCTC;

[0097] SeqTFR1-R (SEQ ID No. 16): GACGCCTTCGTCTGCC.

[0098] After culturing the pTFR1 transgenic rice obtained above for one month, a disease resistance immunity test was performed.

[0099] Activate the rice blast fungus EA18 strain (Magnaporthe oryzae EA18) on OTA plates (YinWang, LeiYang, Chang Ma, et al.. "Genome Sequence of Magnaporthe oryzae EA18 Virulent to Multiple Widely Used Rice Varieties." Molecular Plant-Microbe Interactions, vol.35, no.8, 2022, pp). Place it at 25°C for 7-10 days, punch the bacteria cake with a 3mm puncher to inoculate the leaves of mTFR1 transgenic rice and wild-type rice (WT) that have been cultured for one month. Transgenic rice was used as the experimental group, and WT rice was used as the control group. Take photos and count them 14 days after inoculation (dpi).

[0100] The results are as follows Figure 3 As shown in the figure, the size of rice blast lesions in pTFR1 was significantly lower than that in the control group. In conclusion, pTFR1 transgenic rice has significant resistance to rice blast.

[0101] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A plant-specific disease resistance gene, characterized in that: It comprises a promoter and a wheat disease resistance gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease resistance gene TFR1 is XP_044432367.1; and the promoter is a pathogen-inducible promoter of a corresponding pathogen resistant to a target disease.

2. The plant-specific disease resistance gene according to claim 1, characterized in that: The pathogen-inducible promoter includes PR10pro.

3. A plant broad-spectrum disease resistance gene, characterized in that: It comprises a strong promoter and a wheat disease resistance gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease resistance gene TFR1 is XP_044432367.

1.

4. The plant broad-spectrum disease resistance gene according to claim 3, characterized in that: The strong promoters include Mas.

5. Use of the wheat disease resistance gene TFR1 or the plant specific disease resistance gene according to claim 1 or 2 or the plant broad-spectrum disease resistance gene according to claim 3 or 4 in plant disease resistance, characterized in that: The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1; the plant and wheat are different in species.

6. The use according to claim 5, characterized in that: The types of plants include monocots or dicots.

7. The use according to claim 6, characterized in that: The monocotyledonous plant includes rice; The dicotyledonous plants include tobacco.

8. A method for improving plant-specific disease resistance, characterized in that: The method comprises transferring the plant-specific disease-resistant gene according to claim 1 or 2 into the plant.

9. A method for improving the broad-spectrum disease resistance of plants, characterized in that: The method comprises transferring the plant broad-spectrum disease-resistant gene according to claim 3 or 4 into the plant.

10. Use of the wheat disease resistance gene TFR1 or the plant specific disease resistance gene according to claim 1 or 2 or the plant broad-spectrum disease resistance gene according to claim 3 or 4 in creating disease-resistant plant germplasm, characterized in that: The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1.

Images