Genetically engineered bacterium exosome vesicle and application thereof in preparation of medicine for treating tumors

Abstract

The invention provides a genetically engineered bacterial exosome vesicle and application thereof in preparation of a medicine for treating tumors, and comprises a genetically engineered bacterial exosome vesicle Neo-MICBOMVs, and the surface of the genetically engineered bacterial exosome vesicle Neo-MICBOMVs is loaded with a fusion protein composed of a tumor neoantigen protein and an MICB [alpha] 3 structural domain protein. The fusion protein can be used as a vaccine pharmaceutical composition for treating tumors, can be used as a targeting antigen presenting cell, can promote activation of an immune system, can increase immune infiltration in a tumor microenvironment, can inhibit immune escape of tumor cells, and can improve the effect of tumor immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of tumor immunotherapy, and in particular to a genetically engineered bacterial exosome and its application in preparing a drug for treating tumors. Background Art

[0002] Tumor immunotherapy has been a hot research direction in the field of tumor treatment in recent years. It aims to activate the patient's own immune system, start immune cells to recognize and kill tumor cells, and exert anti-tumor efficacy. Neoantigens are proteins or peptides specifically expressed by tumor cells that are produced by non-synonymous mutations in the genome of tumor cells. They can induce a strong immune response in the body, have the characteristics of strong specificity, weak side effects, and high safety. They have now become an important target for tumor immunotherapy. The personalized immunotherapy model based on neoantigens is considered to be the main development direction of immunotherapy for solid tumors in the future. The results of multiple clinical trials at home and abroad have revealed the effectiveness and application prospects of neoantigen vaccines developed with neoantigens as targets in the treatment of various cancers. Studies have shown that although monotherapy with neoantigen vaccines can promote the migration of specific lymphocytes from peripheral blood to tumor sites, enhance immune infiltration in tumor tissues, and improve the tumor immune microenvironment, it has also been observed that neoantigen-specific lymphocytes highly express receptors such as PD-1, Tim-3, and CTLA-4 on their surfaces, which inhibits the immune response and causes tumor immune escape. Therefore, while receiving neoantigen vaccine treatment and increasing the infiltration of neoantigen-specific lymphocytes inside the tumor, combined immunosuppressive therapy to inhibit the immune escape mechanism of tumor cells may be a key means to further improve the efficacy of tumor neoantigen vaccines.

[0003] MICA / B is one of the ligands of NKG2D and is widely expressed on the surface of tumor cells. Natural killer cells can recognize tumor cells and activate the killing program of tumor cells through the NKG2D receptors expressed on their surface. At the same time, T lymphocytes can also release co-stimulatory signals by binding to MICA / B on the surface of tumor cells, indirectly activating anti-tumor immune responses. However, tumor cells induce the hydrolysis and shedding of MICA / B proteins on the cell surface by secreting metalloproteinases or exosomes, releasing soluble MICA / B proteins to block the recognition and killing of immune cells, inhibit immune responses, and form immune escape. Recently, researchers have found that antibodies targeting the MICBα3 domain can effectively inhibit the shedding of MICB proteins on the surface of tumor cells in vivo, significantly increase the expression of MICB proteins on the surface of tumor cells, and inhibit tumor immune escape. Given that MICB is highly expressed on the surface of many human cancer cells, antibodies based on the MICBα3 domain may be used as a tumor-associated antigen (TAA) combined with tumor neoantigen vaccine therapy to further enhance the function of lymphocytes and avoid tumor immune escape, thereby achieving better immunotherapy efficacy. Summary of the invention

[0004] The first purpose of the present invention is to provide a bacterial exosome vesicle for delivering proteins, including a genetically engineered bacterial exosome vesicle Neo-MICBOMVs, which carries a fusion protein composed of tumor neoantigen protein and MICBα3 domain protein on its surface. It targets antigen presenting cells, promotes the activation of the immune system, increases immune infiltration in the tumor microenvironment, inhibits the immune escape of tumor cells, and improves the effect of tumor immunotherapy.

[0005] The technical solution adopted by the present invention is: an expression vector, the expression vector carries a nucleic acid encoding a fusion protein, the nucleic acid encoding the fusion protein contains a nucleic acid 1 encoding Escherichia coli ClyA protein, a nucleic acid 2 encoding a MICBα3 domain protein, a nucleic acid 3 encoding an Fc protein, a nucleic acid 4 encoding an antigen and a nucleic acid 5 connecting nucleic acid 1, nucleic acid 2, nucleic acid 3 and nucleic acid 4, and the nucleic acid 5 is used to encode a Furin protease recognition site.

[0006] The expression vector is a non-pathogenic viral vector.

[0007] The nucleic acid 1 is shown as SEQ ID No.1, the nucleic acid 2 is shown as GenBank: UIK24483.1, the nucleic acid 3 is shown as SEQ ID No.2, the antigen includes a tumor antigen, the tumor antigen includes a tumor-specific antigen and a tumor-associated antigen, and the amino acid sequence of the Furin protease recognition site is RGRKRRS.

[0008] The tumor neoantigens include 7 short peptide gene sequences based on the mouse liver cancer cell line Hepa1-6, and the nucleic acid encoding the tumor neoantigens is shown in SEQ ID NO:3.

[0009] The nucleic acid encoding the fusion protein contains the nucleotide sequence shown in SEQ ID NO:4.

[0010] A genetically engineered bacterial exosome, wherein the surface of the exosome vesicle carries or can secrete the fusion protein expressed by the expression vector.

[0011] The fusion protein consists of tumor neoantigen protein, MICBα3 domain protein, Fc protein and Furin protease recognition site.

[0012] A method for preparing genetically engineered bacterial exosome vesicles comprises the following preparation steps:

[0013] (1) Preparation of exosome vesicles: The expression vector was transformed into Escherichia coli and cultured overnight in LB plates, and a single clone was cultured in LB medium;

[0014] (2) Extraction of exosome vesicles: Take the LB medium cultured in step (1), centrifuge to remove the E. coli in the medium, filter the supernatant, and centrifuge in an ultracentrifuge to collect the exosomes.

[0015] The bacterial exosome vesicles are all derived from the engineered Escherichia coli Rosetta strain, and tumor neoantigen protein and MICBα3 domain protein are expressed on the bacterial membrane surface. The bacterial exosome vesicles are secreted by Escherichia coli Rosetta and obtained by ultracentrifugation.

[0016] The present invention first inserts the Escherichia coli ClyA protein gene sequence, tumor neoantigen protein gene sequence, MICBα3 protein gene sequence and Fc protein gene sequence into the pET28a empty vector plasmid, and inserts the 3×HA sequence at the 3' end to obtain a plasmid (pET28a-ClyA-Neo-MICB-Fc). The above plasmid is transformed into the Escherichia coli Rosetta strain, the fusion protein expression is induced, the bacterial exosomes are extracted by ultracentrifugation, and finally the expression of the fusion protein is verified by Western Blot.

[0017] Specifically, the bacterial exosome vesicles carrying the target fusion protein are constructed by the following method:

[0018] (1) Preparation of exosome vesicles: The Escherichia coli ClyA protein gene sequence, tumor neoantigen protein gene sequence, MICBα3 domain protein gene sequence and Fc protein gene sequence were linked by a flexible peptide sequence to form a new fusion protein gene sequence, which was then inserted into the pET28a empty plasmid (or other empty plasmids for expressing fusion proteins) to obtain the pET28a-ClyA-Neo-MICB-Fc plasmid. The expression plasmid was transformed into Escherichia coli Rosetta and cultured overnight on an LB plate supplemented with Kanamycin. A single clone was cultured in an LB medium supplemented with Kanamycin. When the OD value of the culture medium was between 0.6 and 0.8, IPTG was added to continue the culture.

[0019] (2) Extraction of exosome vesicles: Take the LB medium after cultivation, centrifuge to remove the E. coli Rosetta in the medium, filter the supernatant through 0.45 nm and 0.22 nm filters in turn, and centrifuge in an ultracentrifuge to collect exosomes. Use the protein quantitative BCA method to quantify the total protein. The expression of the target fusion protein can be detected by Western Blot, which proves that the bacterial exosome vesicles carrying the fusion protein of tumor neoantigen and MICBα3 domain protein were successfully constructed.

[0020] The present invention uses a genetic engineering strategy to connect the tumor neoantigen protein gene sequence, the MICBα3 domain protein gene sequence and the Fc protein gene sequence with a Furin protease cleavage sequence to form a fusion protein gene sequence, and induces expression in Escherichia coli Rosetta to obtain bacterial exosome vesicles Neo-MICBOMVs. The fusion protein carried in the exosome vesicles can be cleaved by Furin protease in vivo to obtain tumor neoantigen protein and MICBα3 domain protein. Tumor neoantigen proteins can be processed by antigen-presenting cells and present antigen information to T lymphocytes, inducing the activation of neoantigen-specific T cells, which specifically identify and kill tumor cells; MICBα3 domain proteins can be phagocytosed by B cells and induce the production of antibodies against MICBα3 domain proteins, which can bind to MICB proteins on the surface of tumor cells, prevent the shedding of MICB proteins, and inhibit related immune escape mechanisms; Fc proteins can increase the binding ability of exosome vesicles to target cells and promote the phagocytosis of exosome vesicles; exosome vesicles have a variety of pathogen-related molecular patterns such as LPS, which can activate the immune system, enhance antigen cross-presentation, and assist tumor neoantigens in exerting their effects.

[0021] Another object of the present invention is to provide the use of the bacterial exosome vesicles in the preparation of a drug for treating a tumor, wherein the tumor is a tumor of the tumor patient.

[0022] The Neo-MICBOMVs exosome vesicles constructed by the present invention can activate the patient's immune system, induce the production of neoantigen-specific T cells and infiltrate them into tumor tissues in large quantities, exert anti-tumor effects, and at the same time induce the production of MICBα3 antibodies in the body, which specifically bind to the MICB protein on the surface of tumor cells, organize the hydrolysis and release of MICB protein, and prevent tumor cells from immune escape. The combined action of the two can inhibit the immune escape of tumor cells on the basis of activating anti-tumor immunity and increasing the infiltration of specific T cells, further improving the efficacy of immunotherapy.

[0023] The Neo-MICBOMVs exosome vesicles constructed by the present invention can be administered by any known delivery method: intravenous injection, intra-arterial, intra-tumor, parenteral, intrapulmonary, and regional delivery forms of local administration.

[0024] Compared with the prior art, the main advantages and beneficial effects of the present invention are mainly reflected in:

[0025] (1) The bacterial exosome vesicles constructed by the present invention are derived from organisms. Compared with other nanomaterials currently used for tumor cell immunotherapy, the exosome vesicles have the advantages of good biocompatibility, low toxicity and side effects, and strong specificity. Moreover, the exosome vesicle delivery strategy can retain the biological activity of protein molecules.

[0026] (2) The exosome vesicle composition provided by the present invention provides a new solution to the current dilemma of low response rate and unsatisfactory objective remission rate in cancer immunotherapy patients.

[0027] (2) The preparation process is simple and can be prepared quickly in large quantities, and the required equipment is conventional equipment. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Some key characterization data involved in the preparation of Neo-MICBOMVs exosome vesicles. Figure 1 A Transmission electron microscopy (TEM) image of the constructed Neo-MICBOMVs exosome vesicles; Figure 1 B. The particle size of the constructed Neo-MICBOMVs exosome vesicles;

[0029] FIG. 2 is an evaluation of the therapeutic efficacy of Neo-MICBOMVs in a mouse HCC orthotopic tumor model. Figure 2A Schematic diagram of Neo-MICBOMVs treatment of HCC orthotopic tumors in mice; Figure 2B Characterize tumor burden in mice receiving different treatment regimens using a small animal in vivo imaging system; Figure 2C Kaplan-Meies comparison of survival differences of tumor-bearing mice among treatment groups;

[0030] Figure 3 This is a diagram showing the results of evaluating the biosafety of Neo-MICBOMVs in treating HCC orthotopic tumor mice using H&E staining of the main organ pathology of mice;

[0031] Figure 4 Immunohistochemical evaluation of the effects of different treatment regimens on CD4 + T and CD8 + The influence of T cell infiltration;

[0032] Figure 5 To analyze the effects of different immunotherapies on TILs activation (expression of PD-1, 4-1BB, CTLA-4, and CD8) by flow cytometry;

[0033] Figure 6 For Ptpn2 376-384 (RWLYWQPTL): H-2K b (Ptpn2) tetramer flow cytometry analysis evaluates the induction of neoantigen-specific TILs by different immunotherapies;

[0034] Figure 7 The effects of each treatment regimen on tumor recurrence in mice. DETAILED DESCRIPTION

[0035] The invention is further described below through examples in combination with the accompanying drawings. The examples are only used to further explain the technical solution of the present invention and cannot be considered as limiting the scope of protection of the present invention. Non-essential improvements or adjustments made by technicians in this field based on the contents of the above invention all fall within the scope of protection of the present invention.

[0036] Explanation of terms

[0037] ClyA is a protein produced by Escherichia coli, also known as β-actin. ClyA can be recognized by macrophages and dendritic cells, thereby stimulating an immune response. The gene sequence is shown in SEQ ID No.1.

[0038] The furin protease recognition site is a specific amino acid sequence for furin protease to recognize and cleave substrates. After cleavage by furin protease, these protein precursors are converted into mature proteins with biological activity, and their amino acid sequence is RGRKRRS, as shown in SEQ ID NO:5.

[0039] Fc proteins are derived from various sources, human or non-human (e.g., mammalian origin, bacteria, etc.), and they have high affinity for the Fc domains of various antibody isotypes, subtypes, and species (e.g., IgG (in the case of IgG, as a non-limiting example, IgG1, IgG2, IgG3, IgG4, IgG2a, IgG2d, and / or IgG2c), IgA, IgM, IgM, IgD, etc.), and they can be fused with EV proteins. EV protein is a protein in extracellular vesicles (EVs). Extracellular vesicles are a general term for various membrane-containing vesicle structures released by cells. They are between 30-100nm in size, contain various molecular cargoes, and play an important role as communication media between cells. EVs contain many molecular cargoes such as proteins, nucleic acids, carbohydrates, and lipids, which have multiple biological functions. For example, some proteins in EVs (such as annexin A2) can promote the invasion and metastasis of tumor cells; some nucleic acids (such as miRNA) can regulate cell metabolism and biological functions; and some lipids (such as cholesterol) can regulate cell proliferation and differentiation. Therefore, EV proteins can be used as biomarkers to study and diagnose diseases, and can also be used as drug carriers to deliver drugs. The gene sequence is shown in SEQ ID No. 2.

[0040] Embodiment 1:

[0041] Seven nucleotide sequences encoding short peptides of mouse liver cancer cell line Hepa1-6 tumor neoantigens screened and verified based on bioinformatics technology were codon optimized, and the nucleotide sequence encoding the Furin protease recognition site (as shown in SEQ ID No. 1) was connected to form the gene sequence encoding the neoantigen protein NeoFurin. The amino acid sequence of the neoantigen short peptide is shown in Table 1 below:

[0042]

[0043] The gene sequence encoding the NeoFurin fusion protein is shown in SEQ ID No.3.

[0044] The gene sequence encoding ClyA protein (as shown in SEQ ID No.1), the gene sequence encoding NeoFurin fusion protein (as shown in SEQ ID No.3), the gene sequence encoding MICBα3 domain protein (GenBank: UIK24483.1) and the gene sequence encoding Fc protein (as shown in SEQ ID No.2) were connected through the gene sequence encoding Furin protease recognition site, and inserted into the pET28a empty plasmid to obtain pET28a-ClyA-Neo-MICB-Fc expression plasmid, and the plasmid structure was confirmed by gene sequencing. The gene sequence of ClyA-Neo-MICB-Fc fusion protein is shown in SEQ ID NO:4.

[0045] Based on the target gene sequence, the target gene was synthesized by a gene company and constructed into the pET28 expression plasmid. The construction process is as follows: (taking the construction of the ClyA gene into the pET28 expression plasmid as an example)

[0046] 1. Design upstream and downstream primers according to the gene sequence encoding ClyA protein, add restriction sites, and hand them over to the gene company for synthesis. The specific sequences of the primers are as follows:

[0047] ClyA-F: CCATGGGGATGACTGAAATCGTTGCAGATAAAA

[0048] ClyA-R:GAATTCCCCTGCCTCTGCAGCACCA

[0049] 2. Amplify the target gene by PCR. The reaction system is as follows:

[0050]

[0051] Place the reaction system in a PCR instrument for PCR reaction. After the reaction is completed, take the PCR product, add 5.5 μL 10× Loading Buffer, use 1% agarose gel, perform horizontal gel electrophoresis at 120V voltage, and recover the target fragment after the electrophoresis is completed;

[0052] 3. Prepare ClyA-PCR product digestion system and pET28 vector plasmid digestion system in a 200 μL EP tube according to the following table:

[0053]

[0054] 4. Place the enzyme digestion system at 37°C for 2 hours, and recover and purify the digestion product;

[0055] 5. Prepare the DNA ligation system in a 200 μL EP tube according to the following table:

[0056]

[0057]

[0058] 6. Place the ligation system in a 16°C room temperature for 2 hours;

[0059] 7. Mix the completed ligation system with 100 μL TOP10 competent cells and incubate on ice for 30 minutes;

[0060] 8. After incubation, heat shock the competent cells in a 42°C water bath for 60 seconds.

[0061] 9. After heat shock, incubate the competent cells on ice for 2 minutes;

[0062] 10. Add 500 μL of antibiotic-free LB medium to the competent cells and resuscitate them in a 37°C constant temperature shaker at 220 rpm / min for 45 min;

[0063] 11. Spread the revived bacterial solution onto the LB plate with Kana resistance, and invert the plate in a 37°C incubator for overnight culture;

[0064] 12. The next day, single colonies were picked from the plate, cultured in LB medium with Kana resistance for 6 h, plasmids were extracted, and the connection results were identified by first-generation gene sequencing to obtain the pET28-ClyA expression plasmid.

[0065] Repeat the above steps to sequentially insert the gene sequence encoding NeoFurin fusion protein (as shown in SEQ ID No. 3), the gene sequence encoding MICB α3 domain protein, and the gene sequence encoding Fc protein (as shown in SEQ ID No. 2) into the pET28-ClyA expression plasmid to obtain the pET28-ClyA-Neo-MICB-Fc expression plasmid.

[0066] Embodiment 2:

[0067] The pET28a-ClyA-Neo-MICB-Fc expression plasmid was transformed into the E. coli Rosetta strain as follows:

[0068] 1. Mix 200 ng of pET28a-ClyA-Neo-MICB-Fc expression plasmid with 100 μL of E. coli Rosetta competent cells and incubate on ice for 30 min.

[0069] 2. After incubation, heat shock the competent cells in a 42°C water bath for 60 seconds.

[0070] 3. After heat shock, incubate the competent cells on ice for 2 minutes;

[0071] 4. Add 500 μL of antibiotic-free LB medium to the competent cells and resuscitate them in a 37°C constant temperature shaker at 220 rpm / min for 45 min;

[0072] 5. Spread the revived bacterial solution onto the LB plate with Kana resistance, and invert the plate in a 37°C incubator for overnight culture;

[0073] 6. The next day, pick a single colony from the plate and culture it in LB medium with Kana resistance.

[0074] Embodiment 3:

[0075] E. coli Rosetta carrying the pET28a-ClyA-Neo-MICB-Fc expression plasmid was cultured, protein expression was induced, and exosome Neo-MICBOMVs were extracted as follows:

[0076] 1. Add E. coli Rosetta carrying the pET28a-ClyA-Neo-MICB-Fc expression plasmid into a conical flask, and add 100 mL of LB medium with Kana resistance, and culture in a 37°C constant temperature shaker at 220 rpm / min. When the OD value of the bacterial solution is 0.6-0.8, add 0.5 nM IPTG, transfer to a 16°C constant temperature shaker at 160 rpm / min and culture for 20 h;

[0077] 2. After the culture is completed, centrifuge the bacterial solution at 8000rpm for 10 minutes, and collect the supernatant at 0.45nm,

[0078] Filter through a 0.22 nm sterile filter, and ultracentrifuge the filtered supernatant at 150,000 g for 3 h at 4 °C;

[0079] 3. After ultracentrifugation, discard the supernatant, resuspend the precipitate with 1 mL PBS, and store it in a -80°C refrigerator for later use.

[0080] The extracted exosomes were characterized by TEM. Figure 1 As shown in A, the results show that the particle size of exosome vesicles is about 30-50nm; the particle size of exosome vesicles in solution is measured by DLS and is distributed around 32nm ( Figure 1 B), which is consistent with the TEM results.

[0081] Example 4

[0082] The use of immunotherapy strategies based on personalized tumor neoantigens combined with shared antigens in mice is as follows:

[0083] 1. Based on the above method, Neo-MICBOMVs were synthesized and extracted; exosome vesicles NeoOMVs carrying only tumor neoantigen proteins and exosome vesicles MICBOMVs carrying only MICBα3 domain proteins were constructed and extracted by the above genetic engineering means as controls.

[0084] 2. Establish an orthotopic tumor model of mouse liver cancer cell line Hepa1-6 at -10 days;

[0085] 3. NeoOMVs, MICBOMVs and Neo-MICBOMVs were subcutaneously injected on days 0, 4 and 8 to treat tumor-bearing mice. The tumor burden of mice was detected by small animal in vivo imaging technology. The therapeutic effects of the blank control group PBS, the neoantigen vaccine group NeoOMVs, the common antigen vaccine group MICBOMVs and the combined treatment group Neo-MICBOMVs were evaluated. The results are shown in Figure 2.

[0086] 4. After the treatment cycle, the mice were killed and their organs were obtained. The biosafety of the exosome vesicle vaccine was evaluated by H&E staining. The results are as follows: Figure 3 As shown, no obvious acute toxicity was observed in the main organs of mice in each group;

[0087] 5. Take mouse tumor tissue and evaluate the infiltration of immune cells in tumor tissue by immunohistochemical staining. The results are as follows: Figure 4 As shown, it can be seen that the immune cell infiltration in the combined treatment group (Neo-MICBOMVs) is optimal;

[0088] 6. Isolate mouse tumor tissue, prepare single cell suspension, separate monocytes by gradient density centrifugation, and analyze T cell activation in each treatment group by flow cytometry. The results are as follows: Figure 5 As shown, TILs activation was optimal in the combined treatment group;

[0089] 7. Furthermore, Ptpn2 tetramer staining was used to evaluate the activation and infiltration of neoantigen-specific T cells in the tumor tissues of each treatment group. Figure 6 As shown, combined therapy can induce a larger proportion of neoantigen-specific T cells to infiltrate into tumor tissues.

[0090] Example 5

[0091] The mice whose tumors were completely eliminated by the combined treatment in Example 4 were re-inoculated with 1×10 Hepa1-6 mouse liver cancer cells on day 39. 5 / 25μL to simulate tumor recurrence, and small animal in vivo imaging technology was used to detect tumor recurrence. The results are as follows Figure 7As shown, the results show that combined treatment can effectively inhibit tumor recurrence in situ. (In Example 3, the other three control groups were not completely tumor-free and could not construct a recurrence model to simulate tumor recurrence, so only the mice in the combined treatment group were re-inoculated with liver cancer cells.)

Claims

1. An expression vector, characterized in that: The expression vector carries a nucleic acid encoding a fusion protein, which contains nucleic acid 1 encoding Escherichia coli ClyA protein, nucleic acid 2 encoding MICBα3 domain protein, nucleic acid 3 encoding Fc protein, nucleic acid 4 encoding antigen and nucleic acid 5 connecting nucleic acid 1, nucleic acid 2, nucleic acid 3 and nucleic acid 4, and nucleic acid 5 is used to encode a Furin protease recognition site.

2. The expression vector according to claim 1, wherein the expression vector is a non-pathogenic viral vector.

3. The expression vector according to claim 2, characterized in that: The nucleic acid 1 is shown as SEQ ID No. 1, the nucleic acid 2 is shown as GenBank: UIK24483.1, the nucleic acid 3 is shown as SEQ ID No. 2, the antigens include tumor antigens, the tumor antigens include tumor-specific antigens and tumor-associated antigens, and the amino acid sequence of the Furin protease recognition site is RGRKRRS.

4. The expression vector according to claim 3, characterized in that The tumor neoantigens include 7 short peptide gene sequences based on the mouse liver cancer cell line Hepa1-6, and the nucleic acid quadrilateral sequences encoding the tumor neoantigens are shown in SEQ ID NO:

3.

5. The expression vector according to claim 4, wherein the nucleic acid encoding the fusion protein contains the nucleotide sequence shown in SEQ ID NO:

4.

6. A genetically engineered bacterial exosome vesicle, characterized in that: The surface of the exosome vesicle carries or can secrete the fusion protein expressed by the expression vector according to any one of claims 1 to 4.

7. The exosome according to claim 6, characterized in that The fusion protein consists of tumor neoantigen protein, MICBα3 domain protein, Fc protein and Furin protease recognition site.

8. A method for preparing the genetically engineered bacterial exosome vesicles according to claim 7, comprising the following preparation steps: (1) Preparation of exosome vesicles: The expression vector was transformed into Escherichia coli and cultured overnight in LB plates, and a single clone was cultured in LB medium; (2) Extraction of exosome vesicles: Take the LB medium cultured in step (1), centrifuge to remove the E. coli in the medium, filter the supernatant, and centrifuge in an ultracentrifuge to collect exosomes.

9. A vaccine composition comprising the fusion protein according to any one of claims 6 to 7 and a pharmaceutically acceptable carrier.

10. A method for inhibiting the shedding of MICB protein on the surface of tumor cells, characterized in that: An effective amount of the exosome vesicles according to claim 6 or the pharmaceutical composition according to claim 9 is administered to a subject in need thereof.

Images