Application of miR-18a and downstream target thereof and composition for treating drug-resistant melanoma

Abstract

The invention relates to the field of treatment of malignant melanoma, and discloses application of miR-18a and a downstream target thereof, and a composition for treating drug-resistant melanoma. The application finds the potential of miR-18a and downstream target thereof as malignant melanoma targeted therapy and immunotherapy biomarkers and the possibility of miR-18a and downstream target thereof as a therapeutic target for overcoming drug resistance. The application discovers that after the miR-18a is knocked out, melanoma targeted therapy drug resistance and CD8 + T cell tolerance can be simultaneously caused. Then, in a malignant melanoma patient receiving a BRAF inhibitor and immunotherapy, high expression prognosis of the miR-18a is relatively good, which prompts that the miR-18a can predict the curative effect of targeted therapy and immunotherapy and can be used as a biomarker of the curative effect of targeted therapy and immunotherapy. The invention further discloses a specific mechanism of miR-18a for causing targeted therapy or immunotherapy drug resistance.

Description

Technical Field

[0001] The present application relates to the field of malignant melanoma treatment, and in particular to the application of miR-18a and its downstream targets and a composition for treating drug-resistant melanoma. Background Art

[0002] Malignant melanoma is a highly malignant tumor that is prone to lymph node metastasis and distant metastasis, with a high mortality rate, accounting for 75% of all skin malignancies. In addition to the skin, malignant melanoma can also occur in mucosa (including colorectal mucosa, nasal mucosa, etc.), extremities, uveal tract, etc.

[0003] The MAPK pathway plays an important role in malignant melanoma. It is mainly composed of RAS / RAF / MEK / ERK, which can transmit extracellular signals, including hormones, cytokines, growth factors, etc., to the cell nucleus, thereby changing cell gene expression to regulate cell proliferation, differentiation, and apoptosis. Since the discovery of BRAF mutation in 2002, dozens of mutation types have been detected. 95% of mutations are caused by a missense mutation in exon 15, that is, the thymine at the 1799th nucleotide mutates to adenosine (T>A), which leads to a mutation at the protein level, with valine (V) replacing glutamic acid (E) at amino acid 600. This mutation is called BRAF V600E. The BRAF V600E mutation increases the activity of BRAF by 500 times, resulting in increased activity of downstream MEK and ERK, thereby activating the entire MAPK pathway.

[0004] BRAF inhibitors developed for BRAF V600E mutation have achieved good efficacy in malignant melanoma and are widely used in clinical practice. Typical representative drugs include vemurafenib, dabrafenib, and encorfenib, among which vemurafenib was the first to be used in clinical practice. The BRIM-3 clinical study compared the efficacy of vemurafenib and dacarbazine. At 6 months of treatment, the overall survival rate of the vemurafenib group was 84%, and the overall survival rate of the dacarbazine group was 64%. The remission rate of vemurafenib was 48%, and that of dacarbazine was 5%. Based on the good trial results of BRIM-3, vemurafenib was approved by the US FDA in August 2011 for the treatment of BRAF V600E mutation-positive malignant melanoma.

[0005] However, most patients will develop resistance to BRAF inhibitors, including vemurafenib, within one year of taking the drugs. Even combined use of MEK inhibitors can only delay the onset of resistance, but cannot avoid the emergence of resistance. There is currently no recognized biomarker that can predict the efficacy of targeted therapy. In addition, vemurafenib and other BRAF inhibitors have some common resistance mechanisms when used alone or in combination with MEK inhibitors. Understanding these resistance mechanisms is of great significance for overcoming the resistance to BRAF inhibitors and improving the prognosis of melanoma patients. How to overcome the resistance of malignant melanoma to the BRAF inhibitor vemurafenib has become a major research hotspot.

[0006] In addition to targeted therapy, immunotherapy has also become one of the main treatment methods for patients with malignant melanoma. The KEYNOTE001 trial is the earliest clinical trial of pembrolizumab in patients with malignant melanoma. According to the latest follow-up results, among 655 advanced patients, the OS of all patients and first-line patients were 23.8 months and 38.6 months, respectively, and the median PFS was 8.3 months and 16.9 months, respectively. In the KEYNOTE054 trial comparing the efficacy of pembrolizumab and placebo, compared with placebo treatment, at a median follow-up of 42.3 months, the 3.5-year metastasis-free survival rate of the pembrolizumab treatment group was 65.3%, and that of the placebo group was 49.4%, which was statistically significant.

[0007] However, there are still some patients with malignant melanoma who cannot benefit from immunotherapy, or whose disease progresses in the early stages of treatment and who develop resistance to immunotherapy. Currently, there is no unified, recognized biomarker to predict the efficacy of immunotherapy, so it is impossible to predict which patients will benefit from immunotherapy before immunotherapy. In addition, finding the mechanism of resistance to immunotherapy in malignant melanoma is also important for improving the prognosis of patients with malignant melanoma.

[0008] miR-18a is a family member of miR-17-92a, encoded by the MIR17HG gene, and has been rarely studied in malignant melanoma. So far, only a few studies have reported the role of miR-18a in malignant melanoma, and they are limited to the effect of miR-18a on cell growth. So far, no studies have reported the role and specific mechanism of miR-18a in vemurafenib resistance and immunotherapy resistance, as well as the potential of miR-18a as a therapeutic target and prognostic biomarker for malignant melanoma. Summary of the invention

[0009] In view of this, the purpose of the present application is to provide an application of miR-18a, by targeting miR-18a or its downstream targets AJUBA, YAP, THBS1, revealing the key pleiotropic effects of related research in regulating the resistance of melanoma cells to BRAF inhibitors (such as vemurafenib) and T cell-mediated cytotoxicity, thereby providing new related drugs for the treatment of drug-resistant melanoma.

[0010] In order to achieve the above purpose or partially achieve the above purpose, as a first aspect of the present application, provided is the use of miR-18a or its downstream targets AJUBA, YAP, THBS1, CD47 as targets in the preparation of drugs for treating drug-resistant melanoma.

[0011] Optionally, the drug-resistant melanoma includes a melanoma resistant to vemurafenib and / or a melanoma resistant to T cell killing.

[0012] Further optionally, the drug-resistant melanoma includes a melanoma having a BRAF V600E mutation.

[0013] Optionally, the drug for treating drug-resistant melanoma includes targeted drugs and immune preparations.

[0014] As a second aspect of the present application, a method for preparing a drug for treating drug-resistant melanoma is provided, wherein miR-18a is used as a target, melanoma cells with miR-18a knocked out or knocked down are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can increase the expression level of miR-18a; or

[0015] Using any one or more of AJUBA, YAP, THBS1, and CD47 as targets, melanoma cells with miR-18a knocked out or knocked down are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can inhibit the expression level or activity of AJUBA, YAP, THBS1, and CD47.

[0016] As a third aspect of the present application, provided is the use of any one or more of a miR-18a mimic, a drug that promotes miR-18a expression, an AJUBA inhibitor, a YAP inhibitor, a THBS1 inhibitor, and a CD47 inhibitor in the preparation of a drug for treating drug-resistant melanoma.

[0017] Optionally, the inhibitor includes siRNA that reduces the expression level of AJUBA, YAP, THBS1, and CD47, or includes drugs that reduce the activity of AJUBA, YAP, THBS1, and CD47. Further optionally, the drug that reduces the activity of YAP includes verteporfin.

[0018] As the fourth aspect of the present application, a composition for combined treatment of drug-resistant melanoma is provided, including any one or more of a miR-18a mimic, a drug that promotes miR-18a expression, an AJUBA inhibitor, a YAP inhibitor, a THBS1 inhibitor, a BRAF inhibitor, a MEK inhibitor, and a CD47 inhibitor.

[0019] Optionally, the BRAF inhibitor includes vemurafenib, and the MEK inhibitor includes trametinib.

[0020] As the fifth aspect of the present application, provided is the use of a reagent for detecting biomarkers in the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy for malignant melanoma, wherein the biomarkers include one or more of miR-18a and its downstream targets AJUBA, YAP, THBS1, and CD47.

[0021] This application study found that reduced levels of miR-18a lead to resistance to vemurafenib treatment and also weaken the ability of T cells to kill melanoma cells. The experiment of reintroducing miRNA-18a in two melanoma clones with miR-18a knocked out significantly reduced resistance to vemurafenib and T cell cytotoxicity. Furthermore, this application also accurately locates the key target proteins in many signaling pathways downstream of miR-18a, and proves its key role in the treatment of melanoma resistance in both targeted drugs and immunotherapy by inhibiting the expression level or activity of these key target proteins, which can provide a new theoretical basis for the analysis, detection and treatment of resistant melanoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The drawings constituting a part of the present application are used to provide a further understanding of the present application. The illustrative embodiments and descriptions of the present application are used to explain the present application and do not constitute an improper limitation on the present application.

[0023] Figure 1The figure shows that knocking out miR-18a can lead to vemurafenib resistance and CD8+T cell tolerance at the cellular level; A: Cell proliferation of A375-Cas9 and the corresponding three 18a-KO cell lines (KO1 / KO2 / KO3) under the treatment of vemurafenib at different concentrations and different time periods, and cell proliferation co-cultured with different concentrations of T cells; B: Cell proliferation of SK-MEL-28-Cas9 and the corresponding three 18a-KO cell lines (KO1 / KO2 / KO3) under the treatment of vemurafenib at different concentrations and different time periods, and cell proliferation co-cultured with different concentrations of T cells;

[0024] Figure 2 The figure shows the confirmation at the cellular level that knocking out miR-18a can lead to vemurafenib resistance and CD8+T cell tolerance; A: Cell proliferation of A375-Cas9, SK-MEL-28-Cas9 and 18a-KO1 cell lines under treatment with a wider range of vemurafenib concentrations; B: Cell proliferation of A375-Cas9, SK-MEL-28-Cas9 and 18a-KO1 cell lines under co-culture with a wider range of T cell concentrations; C: Cell proliferation after adding vemurafenib after replenishing miR-18a mimics; D: Cell proliferation after co-culture with T cells after replenishing miR-18amimics; E: Clonal formation of different A375 miR-18a KO after adding vemurafenib; F: Clonal formation of different SK-MEL-28miR-18aKO after adding vemurafenib;

[0025] Among them, VMF means the group added with vemurafenib; NC+V means the group added with vemurafenib after supplementation with miR-18amimics control (Negative control, a segment of RNA sequence with no effect); 3p+V means the group added with vemurafenib after supplementation with miR-18a-3p mimics; 5p+V means the group added with vemurafenib after supplementation with miR-18a-5p mimics; 3p+5p+V means the group added with vemurafenib after supplementation with miR-18a-3p and miR-18a-5p mimics;

[0026] Figure 3The figures show the construction of vemurafenib-resistant cell line A375-VR and T cell-tolerant cell line A375-TR, and the relationship between miR-18a and the efficacy of targeted therapy and immunotherapy for melanoma; A: The construction process of A375-VR and A375-TR; B: Cell proliferation of A375 and A375-VR with vemurafenib added; C: Cell proliferation of A375 and A375-TR treated with T cells; D: Expression of miR-18a in A375 and A375-VR with vemurafenib added; E: Expression of miR-18a in A375 and A375-TR treated with T cells; F: Construction of tissue microarray of 53 patients receiving targeted therapy or immunotherapy; G: Survival difference between patients with high expression of miR-18a and low expression of miR-18a;

[0027] Figure 4 The molecular mechanism of miR-18a regulating targeted drug resistance is shown in the figure; A: The expression of AJUBA increased significantly after targeted therapy; B: Luciferase reporter gene experiment confirmed that AJUBA is the direct target gene of miR-18a; C: The expression of AJUBA increased in three miR-18a KO cell lines (KO1 / KO2 / KO3); D: The difference in the expression of YAP and p-YAP in A375-cas9 cell line and A375 miR-18a KO cell line; E: The expression of YAP and p-YAP after knocking down AJUBA; F: The YAP inhibitor verteporfin and vemurafenib were used together to detect cell proliferation; Among them, VEM represents the vemurafenib group, VP represents the verteporfin group, and VEM+VP represents the combination group of the two; WT represents the A375-cas9 cell line, and 18a KO represents the A375miR-18a KO cell line;

[0028] Figure 5 The figure shows the molecular mechanism of miR-18a regulating targeted drug resistance through the nude mouse treatment model; A: Construction of nude mouse subcutaneous transplant tumor model; B: Growth curve and tumor volume of tumors in different groups; C: Immunohistochemical staining of tumor masses in different groups; VEM represents vemurafenib group, VP represents verteporfin group, VEM+VP represents the combination group of the two; 18a mimic represents miR-18a-5p mimic group, VEM+18a mimic represents the combination group of the two;

[0029] Figure 6The molecular mechanism of miR-18a regulating T cell tolerance is shown in the figure; A: THBS1 expression increased significantly after immunotherapy; B: Luciferase reporter gene experiment confirmed that the target gene of miR-18a is THBS1; C: Verification of THBS1 expression in three miR-18aKO cell lines (KO1 / KO2 / KO3); D: Western blot analysis confirmed that THBS1 expression increased after knocking down miR-18a; E: CCK8 experiment found that after knocking out THBS1, tumor cells were co-cultured with T cells, and the cell proliferation level was significantly reduced; F: The addition of CD47 inhibitor during co-culture with T cells lifted immune tolerance; Among them, WT represents A375-cas9 cell line, WT+5p represents A375-cas9 cell line complemented with miR-18a-5p mimics, MUT represents the binding region of mutated miR-18a and THBS1, and MUT+5p represents the complementation of miR-18a-5p after mutated binding region of miR-18a and THBS1. mimics, 18a KO indicates A375 miR-18a KO cell line, 18a KO+siTHBS1 indicates A375 miR-18a KO cell line with THBS1 knockdown;

[0030] Figure 7 The molecular mechanism of miR-18a regulating T cell tolerance was revealed by the nude mouse treatment model; A: Construction of C57 subcutaneous transplanted tumor mouse model; B: Growth curve and tumor volume of the control group and the group supplemented with miR-18a mimics(5p); C: Immunohistochemical staining of tumor masses in the control group and the group supplemented with miR-18a mimics(5p); D: Cell clustering after single-cell sequencing of the harvested tumor masses; E: THBS1 expression in most cell populations in the group supplemented with miR-18a mimics(5p) was significantly reduced; F: Changes in key signaling pathways in different cell subpopulations.

[0031] Figure 8 Shown are the differences in cell communication and THBS1-CD47 scores between the control group and the miR-18a-supplemented group; A: Difference in cell communication between the two groups; B: Difference in THBS1-CD47 scores between the two groups. DETAILED DESCRIPTION

[0032] The present application discloses the application of miR-18a and its downstream targets and a composition for treating drug-resistant melanoma. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all deemed to be included in this application. The products and processes described in this application have been described through preferred embodiments. The relevant personnel can obviously modify or appropriately change and combine the products and processes described herein without departing from the content, spirit and scope of this application to realize and apply the technology of this application. Obviously, the described embodiments are part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0033] It should be noted that, in this article, if relational terms such as "first" and "second", "step 1" and "step 2", and "(1)" and "(2)" appear, they are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "comprise", "include" or any other variants thereof are intended to cover non-exclusive inclusion, so that the process, method, article or equipment including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or equipment. In the absence of further restrictions, the elements defined by the sentence "comprise one..." do not exclude the presence of other identical elements in the process, method, article or equipment including the elements. At the same time, the embodiments in this application and the features in the embodiments may be combined with each other without conflict.

[0034] Although miR-18a has been widely reported in various cancers related to tumor occurrence, progression, metastasis and drug resistance. However, the role of miR-18a as a tumor promoter or inhibitor in different cancer environments remains controversial and non-universal. The main significance of this application is to provide the potential of miR-18a as a biomarker for predicting the efficacy of targeted drug therapy and immunotherapy in malignant melanoma, as well as an important target for overcoming resistance to targeted drug therapy and immunotherapy, and based on these research results, provide a technical solution in the preparation of melanoma drugs for the treatment of drug resistance using miR-18a and the key downstream target proteins of miR-18a determined by this application as punctuation.

[0035] In this application, by using CRISPR / cas9 technology, sgRNA targeting miRNA-18a was packaged into lentivirus, and A375-Cas9 cells and SK-MEL-28-Cas9 cells were infected with lentivirus to knock out miRNA-18a, and A375 cell lines and SK-MEL-28 cell lines with stable knockout of miRNA-18a were constructed. Then, a monoclonal strain (miR-18a KO clone) with stable knockout of miRNA-18a was obtained by limiting dilution, and relevant verification experiments were carried out. In this application, T cells used EasySep human CD8 + T cell isolation kit (STEMCELL#17953) was used to isolate CD8 T cells from fresh whole blood samples of volunteers. + T cells were used for validation experiments.

[0036] In certain embodiments of the present application, knockout of miR-18a results in resistance of miR-18a KO clones of A375-Cas9 cells and SK-MEL-28-Cas9 cells to vemurafenib treatment at concentrations of 1 μM and 2 μM at 24, 48 and 72 h ( Figure 1 -A, B). At the same time, knockout of miR-18a significantly weakened the ability of T cells to kill melanoma cells at a cell ratio of 1:1 and 1:2 ( Figure 1 Additional dose-response analyses revealed that both miR-18a KO melanoma clones exhibited robust resistance to vemurafenib and T cell cytotoxicity over a wider range of drug concentrations and T cell ratios compared to A375-Cas9 and SK-MEL-28-Cas9 cell lines ( Figure 2 A and -B). However, reintroduction of mature miRNAs, miRNA-18a-5p and miRNA-18a-3p, into two melanoma cell miR-18a KO clones significantly alleviated resistance to vemurafenib and T cell cytotoxicity ( Figure 2 In addition, loss of miR-18a also induced other drug-resistant phenotypes in response to treatment in different melanoma cells; for example, under vemurafenib treatment, miR-18aKO clones of A375 and SK-MEL-28 showed lower apoptosis rates and higher clonogenicity compared with wild-type (WT) melanoma cells ( Figure 2 -E, F). These results highlight the role of miR-18a in regulating the response of melanoma cells to vemurafenib treatment and CD8 + Key pleiotropic roles in T cell cytotoxicity.

[0037] In certain embodiments of the present application, in order to further verify that miR-18a dysregulation is associated with poor effects of targeted therapy and immunotherapy for melanoma, the present application treated A375 cells with gradually increasing doses of vemurafenib or activated CD8 + The proportion of T cells increased (corresponding to the A375-VR group and the A375-TR group, see Figure 3 -A) established an acquired tolerance model, and the results showed that both the vemurafenib-resistant strain (A375-VR group) and the T cell cytotoxicity-resistant strain (A375-TR group) showed a persistent tolerance effect, even after stopping drug induction, this persistent drug and T cell tolerance effect was still present ( Figure 3 -B, C). In some other embodiments of the present application, miRNA-18a-5p and miRNA-18a-3p were significantly downregulated in A375-VR and A375-TR cell lines ( Figure 3 -D, E), suggesting that loss of miR-18a expression may directly contribute to the development of melanoma resistance to vemurafenib and T cell-mediated cytotoxicity.

[0038] In certain embodiments of the present application, in order to further clarify the relationship between miR-18a expression level and melanoma targeted / immunotherapy results, the present application collected paraffin-embedded surgical tissue specimens and clinical prognosis data of melanoma patients who had been treated in Tianjin Medical University Cancer Hospital (53 patient samples treated with BRAFi / MEKi or ICI). By performing miRNA hybridization tissue microarray analysis on tissue sections ( Figure 3 -F), the patients were divided into two groups according to the expression level of miR-18a-5p. Figure 3 -G event-free survival (EFS) analysis showed that the group with lower miR-18a-5p expression had significantly lower EFS (P value = 0.036). These findings emphasize the close association between miR-18a expression in melanoma and the efficacy of targeted or immunotherapy, and may become a valuable biomarker for predicting primary and acquired resistance of BRAF V600E melanoma to conventional treatment.

[0039] In certain embodiments of the present application, the present application studies the response of TNFsignaling, NF-κB signaling, PI3K-Akt signaling, Cell adhesion, ECM-R Interaction, Hippo signaling, FoxO signaling, VEGF signaling, MAPK signaling, Rap1 signaling, Wnt signaling and other signaling pathways in the oncogenic signaling pathway of melanoma to treatment in miR-18a KO clone cells, and the results of differential gene expression enrichment analysis of these signaling pathways show different performances. Finally, multiple studies in the present application have demonstrated a close association between Hippo signaling and melanoma resistance to BRAFi / MEKi. However, the upstream molecular regulators and their mechanisms in this process remain unclear. Functional screening, cell models and clinical evidence together indicate that miR-18a, especially miR-18a-5p, is closely related to the BRAFi / MEKi treatment response associated with Hippo signaling. In some other embodiments of the present application, the initial analysis of the present application focused on potential direct target genes of miR-18a-5p and their differential expression levels in RNA sequencing under different environments, revealing significant upregulation of AJUBA, a key Hippo pathway regulator, in miR-18a KO clones of A375 cells. In addition, in a group of patients who received targeted therapy and had low miR-18a-5p levels, AJUBA expression was significantly increased after treatment ( Figure 4 -A). These observations suggest that AJUBA may be a key molecule in the miR-18a-5p-mediated resistance mechanism. To evaluate the effectiveness of AJUBA as a direct target of miR-18a-5p, we designed a dual-luciferase assay and found that sequences in the AJUBA 3'UTR were recognized and significantly inhibited by miR-18a-5p in vitro, thereby reducing reporter gene expression ( Figure 4 This was further validated by RT-qPCR and western blot analysis in miR-18a KO clones, which showed increased AJUBA expression, confirming the targeting relationship ( Figure 4 -C).

[0040] In certain embodiments of the present application, in order to determine whether miR-18a-5p mediates resistance to downstream Hippo pathway components through AJUBA, the present application evaluated the key Hippo downstream gene YAP and phosphorylated YAP (YAP-p) under various conditions in A375 cells. The results showed that an increase in YAP and YAP-p was observed after miR-18a KO, and vemurafenib treatment further enhanced the accumulation of dephosphorylated YAP, especially in miR-18a KO cells ( Figure 4 -D). In addition, silencing AJUBA in miR-18a KO cells using siRNA at A375 significantly inhibited YAP and Hippo signaling after vemurafenib treatment ( Figure 4 -E), these siRNAs silencing AJUBA can be selected from any of the following:

[0041] (1) Sense strand: GCACCUGUAUCAAGUGCAATT; Antisense strand: UUGCACUUGAUACAGGUGCTT; as shown in SEQ ID No. 1-2;

[0042] (2) Sense strand: GGACCGGGAUUAUCACUUUTT; Antisense strand: AAAGUGAUAAUCCCGGUCCTT; as shown in SEQ ID No. 3-4;

[0043] (3) Sense strand: GGCUUUCUACAGUGUCAAUTT; antisense strand: AUUGACACUGUAGAAAGCCTT; shown in SEQ ID No. 5-6.

[0044] Note: Since the ST.26 standard sequence table creation software needs to replace the base U with T when creating RNA sequences, the actual sequence shall be subject to the instructions (the same below).

[0045] These results confirmed that loss of miR-18a alleviated the inhibition of AJUBA and promoted the expression of YAP, while vemurafenib treatment further promoted the dephosphorylation and accumulation of YAP in miR-18a-deficient cells, thereby promoting the development of melanoma drug resistance.

[0046] In certain embodiments of the present application, in order to verify the drug-resistant phenotype and study potential strategies to alleviate drug resistance, the present application first tested verteporfin, which is a photosensitizer used to treat abnormal ocular neovascularization and a potential YAP inhibitor that can inhibit YAP activity by direct binding. Cell proliferation assays showed that verteporfin alone and in combination with vemurafenib significantly reduced the resistance of A375 miR-18a KO cells to vemurafenib ( Figure 4-F). In addition, the present application also conducted animal experiments on BALB / c nude mice, which were subcutaneously injected with miR-18a KO cells of A375, and nude mice with consistent xenograft size were selected after 20 days. These mice underwent multiple rounds of intervention, including a single intratumoral injection of miR-18a-5p mimics (18a mimic) by JetPEI (Polyplus-Transfection), and the use of vemurafenib or verteporfin alone or in combination ( Figure 5 -A). Treatment with miR-18a-5p mimics alone significantly reduced the volume and weight of xenograft tumors compared with control host mice, whereas treatment with vemurafenib or verteporfin alone showed only weak tumor inhibitory effects ( Figure 5 -B). In addition, the combination of vemurafenib with miR-18a-5p mimics or verteporfin significantly reduced tumor growth in xenograft nude mice, indicating that inhibition of the Hippo signaling pathway can effectively overcome vemurafenib resistance caused by miR-18a deficiency ( Figure 5 -B). Immunohistochemical (IHC) staining of the proliferation activity marker Ki-67 and key Hippo signaling proteins AJUBA, YAP, and YAP-p showed that vemurafenib treatment combined with miR-18a-5p mimics or verteporfin effectively controlled tumor proliferation and Hippo signaling activation in vivo ( Figure 5 -C). Consistent with the tumor volume measurements, administration of miR-18a-5p mimics alone also slightly suppressed in vivo proliferation and expression of downstream Hippo signaling targets. These results confirm that loss of miR-18a, and especially miR-18a-5p, leads to vemurafenib resistance by regulating the AJUBA-YAP Hippo signaling pathway.

[0047] In some other embodiments of the present application, the present application believes that the loss of miR-18a in melanoma may destroy CD8 through the ECM receptor interaction pathway. + The cytotoxic capacity of T cells. To further investigate the underlying mechanism, this application first analyzed potential direct target genes to calculate miR-18a-5p levels and their differential RNA-seq expression levels in different immune environments. The results showed that the key regulatory protein thrombospondin-1 (THBS1) was significantly upregulated in miR-18a KO cells of A375. In addition, in the two groups of patients with low miR-18a-5p levels who received immunotherapy, THBS1 expression was significantly increased after treatment ( Figure 6-A). These observations suggest that THBS1 may be one of the key molecules for miR-18a-5p to regulate the tumor microenvironment to convey anti-T cell-mediated cytotoxicity mechanisms. To evaluate the efficacy of THBS1 as a direct target of miR-18a-5p, a dual-luciferase assay was designed and found that the sequence in the THBS1 3'UTR was recognized and significantly inhibited the in vitro reporter gene expression ( Figure 6 -B, C). In miR-18aKO clones, RT-qPCR and Western blot assays confirmed that loss of miR-18a led to increased THBS1 expression, thus validating its role as a target ( Figure 6 In addition, knockdown of THBS1 in miR-18a KO cells using siRNA at A375 significantly alleviated the response to different concentrations of CD8 + T cell resistance Figure 6 -E), these siRNAs for knocking down THBS1 can be selected from any of the following:

[0048] (1) Sense strand: GCCUGAUGACAAGUUCCAATT; Antisense strand: UUGGAACUUGUCAUCAGGCTT; as shown in SEQ ID No. 7-8;

[0049] (2) Sense strand: GGUUUCCUCCUUCUGGCAUTT; Antisense strand: AUGCCAGAGGAGGAAACCTT; as shown in SEQ ID No. 9-10;

[0050] (3) Sense strand: GCGUGAAGUGUACUAGCUATT; Antisense strand: UAGCUAGUACACUUCACGCTT; as shown in SEQ ID No. 11-12;

[0051] (4) Sense strand: CCAACAAACAGGUGUGCAATT; antisense strand: UUGCACACCUGUUUGUUGGTT; as shown in SEQ ID No. 13-14.

[0052] After adding CD47 inhibitors, the killing effect on CD8+T cells can be significantly weakened ( Figure 6 These results suggest that the miR-18a-THBS1 axis may be a key pathway for attenuating T cell cytotoxicity and regulating the immunosuppressive tumor microenvironment in melanoma.

[0053] In some other embodiments of the present application, the present application uses the mouse BRAF V600E melanoma cell line YUMM1.7 to generate a miR-18a KO monoclonal strain. Short-term (4 days) subcutaneous implantation of miR-18aKO YUMM1.7 cells was performed in C57BL / 6 mice with normal immune function, and mice with consistent tumor size were selected, and two rounds of intratumoral injections were performed using miR-18a-5p mimic JetPEI ( Figure 7 -A). Initially, miR-18a KO YUMM 1.7 transplants gradually grew and were affected by the immune system of C57BL / 6 mice. As expected, treatment with miR-18a-5p mimics significantly slowed the increase in tumor volume and weight compared with control miR-18a KO host mice ( Figure 7 -B), indicating that an increase in miR-18a-5p helps the mouse immune system kill melanoma cells more quickly. To better understand how miR-18a-5p reshapes the melanoma immune microenvironment, scRNA-seq was performed on harvested transplanted tumors with and without treatment with miR-18a-5p mimics. Single-cell transcriptome analysis of transplanted tumors and tumor-infiltrating immune cells identified multiple clusters, including melanoma, T cell, and melanoma-associated macrophage populations, for further study ( Figure 7 -D). The results showed that after miR-18a-5p mimics treatment, THBS1 expression was significantly reduced in most cell populations ( Figure 7 GESA analysis of these three selected cell populations showed that after treatment with miR-18a-5p mimics, key signaling pathways associated with tumor progression and immune microenvironment regulation (such as NF-κB and TGF-β inflammatory signaling, hypoxia, and glycolysis) were inhibited in these cell populations, while epithelial-mesenchymal transition (EMT) was inhibited only in melanoma and its associated macrophage populations; in addition, activation of interferon-α signaling was observed in these cell populations ( Figure 7 These results suggest that miR-18a is widely involved in regulating signaling pathways related to melanoma progression and its immune microenvironment.

[0054] In some other embodiments of the present application, in order to verify how melanoma uses the miR-18a-THBS1 axis to regulate T cell function in the tumor immune microenvironment, cell communication analysis was performed using scRNA-seq under various conditions. The results of the present application showed that after treatment with miR-18a-5p mimics, the communication between melanoma cells and T cells (especially CD8+ T cells) was significantly weakened ( Figure 8 -A). Notably, the melanoma-derived ligand THBS1 binds to CD8 +The interaction between the T cell surface receptor Cd47 scored high in miR-18a KO tumors and their associated microenvironment ( Figure 8 -B). This suggests that the extracellular matrix protein THBS1 secreted by melanoma may interact with CD8 + CD47 binding on T cells mediates CD8 + In addition, activated CD8 + Inhibition of CD47 by using the CD47 inhibitor Magrolimab in T cells can quickly and effectively eliminate tumor cells ( Figure 6 -F). In addition, IHC staining of Ki-67, THBS1, and CD47 proteins in harvested transplanted mouse tumors showed that miR-18a-5p mimic treatment significantly reduced tumor proliferation and the levels of THBS1 and CD47 in vivo ( Figure 7 Finally, multiplex IHC also confirmed that THBS1 and CD47 were upregulated in tumor-infiltrating CD8 + In summary, the experiments in this application comprehensively solved how miR-18a regulates CD8 by regulating the production of THBS1 and its interaction with CD47. + T cell cytotoxicity and emphasize that targeting the THBS1-CD47 signaling pathway can alleviate the immunosuppressive state that makes melanoma resistant to immunotherapy.

[0055] Based on all the above validation test results, in the first aspect of the present application, the use of miR-18a or its downstream targets AJUBA, YAP, THBS1, CD47 as targets in the preparation of drugs for treating drug-resistant melanoma is provided.

[0056] Wherein, the miR-18a includes miR-18a-5p and / or miR-18a-3p, more preferably miR-18a-5p, which have well-known sequences and meanings in the art.

[0057] In certain embodiments of the present application, the resistant melanoma includes a melanoma that is resistant to vemurafenib and / or a melanoma that is resistant to T cell killing, and the drug for treating resistant melanoma includes targeted drugs and immune preparations. Furthermore, the resistant melanoma includes a melanoma with a BRAF V600E mutation. According to the key role of each target in the present application in drug-resistant melanoma, these targets can be used to develop related drugs in vitro in the actual drug development process. Therefore, in the second aspect of the present application, a method for preparing a drug for treating drug-resistant melanoma is provided, using miR-18a as a target, artificially designing melanoma cells in vitro to knock out or knock down miR-18a, using the melanoma cells as experimental subjects, screening and / or designing drugs that can increase their miR-18a expression levels; or

[0058] Using any one or more of AJUBA, YAP, THBS1, and CD47 as targets, melanoma cells with miR-18a knocked out or knocked down are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can inhibit the expression level or activity of AJUBA, YAP, and THBS1.

[0059] In the process of drug development, artificial design can be used through biotechnology means, including but not limited to gene silencing, gene knockout, etc., to construct melanoma cells with target phenotypes in vitro for drug screening and verification.

[0060] According to the positive / negative effects of these targets in drug-resistant melanoma, drug-resistant melanoma can be treated by increasing or inhibiting its level and activity in vivo, including but not limited to targeted therapy and immunotherapy. Therefore, in the third aspect of the present application, any one or more of miR-18a mimics, drugs that promote miR-18a expression, AJUBA inhibitors, YAP inhibitors, THBS1 inhibitors, and CD47 inhibitors are provided for use in the preparation of drugs for treating drug-resistant melanoma. Among them, the miR-18a mimics include miR-18a-5p and / or miR-18a-3p mimics, which are artificially synthesized RNA reagents with the same sequence as endogenous miR-18a, miR-18a-5p, and miR-18a-3p. In some other embodiments of the present application: the miR-18a-5p mimic has any one of the following sequences:

[0061] (1) UAAGGMGCAUCUAGMGCAGAUAG; shown in SEQ ID No. 15;

[0062] (2) AUCΜGCACUAGAΜGCACCUUAUU; shown in SEQ ID No.16;

[0063] The miR-18a-3p mimic has any one of the following sequences:

[0064] (1) ACMGCCCUAAGMGCUCCUUCMGG; shown in SEQ ID No. 17;

[0065] (2) AGAAGGAGCACUUAGGGCAGUUU; shown in SEQ ID No. 18;

[0066] Here, M represents a degenerate base, which is A or C.

[0067] In certain embodiments of the present application, the miR-18a mimic also includes a transfection reagent, through which the mimic is transfected into the target cell and made to function. The transfection reagent determines the transfection efficiency, thereby affecting the effect of the mimic.

[0068] In certain embodiments of the present application, the inhibitor includes siRNA that reduces the expression levels of AJUBA, YAP, THBS1, and CD47, such as the siRNA that silences AJUBA and knocks down THBS1 mentioned in the present application;

[0069] Or include drugs that reduce the activity of AJUBA, YAP, THBS1, and CD47, such as verteporfin, a drug that reduces the activity of YAP.

[0070] In the aforementioned multiple validation tests of the present application, a variety of combined drug strategies are provided and show good effects in improving melanoma drug resistance. Therefore, in the fourth aspect of the present application, a composition for combined treatment of drug-resistant melanoma is provided, including any one or more of miR-18a mimics, drugs that promote miR-18a expression, AJUBA inhibitors, YAP inhibitors, THBS1 inhibitors, BRAF inhibitors, MEK inhibitors, and CD47 inhibitors. The composition can be used in combination, and the application methods include but are not limited to sequential use, use together, etc. Among them, the BRAF inhibitors include but are not limited to vemurafenib, and the MEK inhibitors include but are not limited to trametinib.

[0071] According to the above-mentioned experimental results, the present application has discovered the potential of miR-18a and its downstream targets as biomarkers for targeted therapy and immunotherapy of malignant melanoma and the possibility of being therapeutic targets for overcoming drug resistance, and has revealed the specific mechanism by which miR-18a causes resistance to targeted therapy or immunotherapy, that is, drug resistance can be generated or eliminated by regulating the expression of the corresponding downstream key target proteins. Therefore, in the fifth aspect of the present application, a reagent for detecting biomarkers is provided for the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy of malignant melanoma, wherein the biomarker includes one or more of miR-18a and its downstream targets AJUBA, YAP, THBS1, and CD47.

[0072] In each group of comparative experiments provided in the present application, if not otherwise specified, except for the differences indicated in each group, other experimental conditions, materials, etc. are kept consistent so as to be comparable. In addition, materials used in the present application can be purchased and obtained through commercial channels. The above is only a specific implementation mode of the present application, so that those skilled in the art can understand or implement the present application. It will be apparent to those skilled in the art that various modifications to these embodiments, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown in this article, but will comply with the widest scope consistent with the principles and novel features applied for herein.

Claims

1. Application of miR-18a or its downstream targets AJUBA, YAP, THBS1, and CD47 as targets in the preparation of drugs for the treatment of drug-resistant melanoma.

2. The use according to claim 1, characterized in that: The drug-resistant melanoma includes a melanoma that is resistant to vemurafenib and / or a melanoma that is resistant to T cell killing.

3. The use according to claim 1 or 2, characterized in that: The drug-resistant melanoma includes melanoma with BRAFV600E mutation.

4. The use according to claim 1, characterized in that: The drugs for treating drug-resistant melanoma include targeted drugs and immune preparations.

5. A method for preparing a drug for treating drug-resistant melanoma, characterized in that: Using miR-18a as a target, artificially designing melanoma cells in vitro to knock out or knock down miR-18a, and using the melanoma cells as experimental subjects to screen and / or design drugs that can increase the expression level of miR-18a; or Using any one or more of AJUBA, YAP, THBS1, and CD47 as targets, melanoma cells with miR-18a knocked out or knocked down are artificially designed in vitro, and the melanoma cells are used as experimental subjects to screen and / or design drugs that can inhibit the expression level or activity of AJUBA, YAP, THBS1, and CD47.

6. Use of any one or more of miR-18a mimics, drugs that promote miR-18a expression, AJUBA inhibitors, YAP inhibitors, THBS1 inhibitors, and CD47 inhibitors in the preparation of drugs for treating drug-resistant melanoma.

7. The use according to claim 6, characterized in that: The inhibitor includes siRNA that reduces the expression level of AJUBA, YAP, THBS1, and CD47, or includes drugs that reduce the activity of AJUBA, YAP, THBS1, and CD47.

8. A combination composition for treating drug-resistant melanoma, characterized in that: The invention comprises any one or more of miR-18a mimics, drugs promoting miR-18a expression, BRAF inhibitors, MEK inhibitors, AJUBA inhibitors, YAP inhibitors, THBS1 inhibitors and CD47 inhibitors.

9. The composition according to claim 8, characterized in that The BRAF inhibitor includes vemurafenib, and the MEK inhibitor includes trametinib.

10. Use of a reagent for detecting biomarkers in the preparation of a product for predicting the efficacy of targeted therapy and immunotherapy for malignant melanoma, characterized in that: The biomarkers include one or more of miR-18a and its downstream targets AJUBA, YAP, THBS1, and CD47.

Images