Digital PCR (Polymerase Chain Reaction) detection method for West Nile virus

Abstract

The invention discloses a digital PCR (polymerase chain reaction) detection method for west nile virus, and belongs to the technical field of molecular biological detection. According to the invention, a WNV conserved region NS2A sequence is taken as a template, a primer probe is designed, a West Nile Virus WNV detection method with good repeatability, high sensitivity and good specificity is established, and a detection result shows that the method has good specificity and high sensitivity, and can be used for detecting the West Nile Virus WNV. The kit has the advantages that the kit is free of cross reaction on poultry and livestock diseases such as toxoplasmosis (TOX), brucella (BRF), avian influenza virus (AIV), H3N8 equine influenza virus, NiV (Nipah virus), equine influenza virus (EHV) and equine arteritis virus (EAV), the detection sensitivity of the WNV virus can reach 4 copies / mu L, and results show that the established WNV digital PCR method has the characteristics of high efficiency, specificity, sensitivity and the like and can be used for test detection of the West Nile virus.

Description

Technical Field

[0001] The invention relates to a West Nile virus digital PCR detection method, belonging to the technical field of molecular biology detection. Background Art

[0002] West Nile fever is a mosquito-borne zoonosis caused by West Nile virus (WNV), which belongs to the genus Flavivirus of the family Flaviviridae (Smithburn et al., 1940). WNV is transmitted in mosquitoes and birds. For most birds except American crows and blue jays, infection with West Nile virus has no obvious symptoms. In horses, there will be signs such as muscle weakness and ataxia, and some horses will also show muscle tremors and cranial nerve damage. In humans, most of the infections are latent, and a few people will have headaches, fever, vomiting and other cold-like symptoms. Only a very small number of people will develop symptoms of viral encephalitis and meningitis after infection. Recently, more and more data show that the scope of infection of the virus has expanded dramatically, and it is urgent to develop a rapid and accurate WNV detection method.

[0003] At present, WNV laboratory detection methods include molecular biology detection, antigen detection and serological detection. Serological methods include enzyme-linked immunosorbent assay (ELISA), virus neutralization test (VN), plaque reduction neutralization test (PRN), etc. Molecular biology detection methods mainly include nested RT-PCR (Nested RT-PCR), real-time fluorescence quantitative PCR (Real timeRT-qPCR) and digital PCR (Digital PCR, dPCR), etc. Antigen detection is a test completed by immunohistochemical staining (IHC) on infected tissues.

[0004] Traditional PCR and RT-PCR methods are relatively simple to operate, but are limited by template concentration. When the template concentration is too low, the accuracy of the test results is low. Serological testing methods have high requirements for the freshness of blood samples, and the experimental operation is relatively cumbersome, requiring high skill levels of experimental personnel.

[0005] Immunohistochemistry tests can only detect animal tissues. The sensitivity and specificity of the test are closely related to the selected antibodies, and the false negative rate of the test results is high. Digital PCR is an emerging technology for absolute quantitative nucleic acid detection. Compared with RT-qPCR, it has the characteristics of strong specificity, high sensitivity and good repeatability. This technology has been applied in the fields of pharmaceutical research and development, disease screening, food safety, etc.

[0006] Chinese patent CN202410114678.6 discloses a dual real-time fluorescent MIRA detection primer probe set, kit and method for African horse sickness and West Nile virus; all types of AHSV and WNV can be identified. The sensitivity of the invention for the detection of both pathogens is 102 copies / μL. It has the characteristics of strong specificity and short reaction time, and is very suitable for on-site rapid diagnosis of African horse sickness and West Nile virus.

[0007] Chinese patent CN202210521965 discloses a primer-probe combination and an integrated microfluidic chip kit for detecting West Nile virus nucleic acid. The primer-probe combination provided by the invention is used to detect West Nile virus, which has good sensitivity and accuracy, high amplification efficiency, and is easy to operate, fast and time-saving. The integrated chip microfluidics method integrates nucleic acid extraction, purification, amplification and detection to solve the problem of rapid detection of pathogens and realize the "sample in-result out" POCT detection scheme. After sampling, it is directly added to the equipment, purified and amplified, and the results are available within 60 minutes.

[0008] Digital PCR is an absolute quantitative technology for nucleic acid detection that emerged in the 1990s. Compared with RT-qPCR, it has the characteristics of strong specificity, high sensitivity, and good repeatability. It has an absolute advantage in extremely low-concentration nucleic acid detection, and its reading is accurate, which can directly judge the concentration of the target gene contained in the detection solution. This technology has been applied in the fields of pharmaceutical research and development, epidemic screening, food safety, etc. As a new absolute quantitative detection technology, digital PCR can theoretically complete the detection of single viral nucleic acid, thereby effectively avoiding the doubts about the validity and specificity of the results in the RT-PCR method and ELISA method.

[0009] There is no report on the detection of West Nile virus by digital PCR in the prior art. Summary of the invention

[0010] The technical problem to be solved by the present invention is to provide a method for detecting West Nile Virus (WNV) with good repeatability, high sensitivity and good specificity. Specifically, the present invention establishes, optimizes and verifies a digital PCR method that can be used for accurate detection of WNV based on fluorescent quantitative PCR.

[0011] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0012] First, the present invention uses the NS2A sequence of the WNV conserved region as a template to design primers and probes, and the specific sequence sequences are shown in SEQ ID NO: 1-4, which are as follows:

[0013]

[0014] The present invention also provides a kit for detecting West Nile virus, the primers and probes, and the kit for detecting West Nile virus is prepared by using the primers and probes designed above.

[0015] The kit provided above can be used to detect West Nile virus.

[0016] The present invention also provides a digital PCR detection method for West Nile virus, and the system and procedure of the detection method are as follows:

[0017] Preparation system: Supermix (Bio Rad) 5 μL, Reversetranscriptase 2 μL, upstream and downstream primers (10 μmol / L) 1.8 μL each (final concentration 0.9 μmol / L), probe (10 μmol / L) 0.5 μL (final concentration 0.25 μmol / L), template 1 μL, add water to make up to 20 μL;

[0018] 20 μL of reaction solution was transferred to the droplet generation slot. At the same time, 70 μL of droplet generation oil was added to the lower well. After covering with the stop bar, the plate was placed in the droplet generator to generate droplets. Then, 40 μL of droplets were transferred to a 96-well PCR plate. After heating and sealing, the plate was placed in the PCR instrument. The reaction conditions were: 42°C for 60 min, 95°C for 10 min, 95°C for 30 s, 60°C for 1 min, 40 cycles of amplification, and 98°C for 10 min. After amplification was completed, the droplet fluorescence signal was read using a droplet reader and the results were analyzed in the software.

[0019] Preferably, the annealing temperature used in the detection method is 60°C.

[0020] Beneficial effects of the present invention:

[0021] The present invention uses the NS2A sequence of the WNV conservative region as a template, designs primers and probes, and establishes a West Nile Virus (WNV) detection method with good repeatability, high sensitivity and good specificity. The test results show that the method has the highest efficiency when the final primer concentration is 900nM, the probe concentration is 250nM, and the annealing temperature is 60°C. At the same time, the method has good specificity and has no cross-reaction to poultry and livestock diseases such as toxoplasmosis (TOX), Brucella (BRF), avian influenza virus (AIV), H3N8 equine influenza virus, Nipah virus (NiV), equine influenza virus (EHV), and equine arteritis virus (EAV). The detection sensitivity of WNV virus can reach 4 copies / μL. The results show that the established WNV digital PCR method has the characteristics of high efficiency, specificity, sensitivity, etc., and can be used for experimental detection of West Nile virus.

[0022] The present invention has explored a mature WNV digital PCR operation method, and has certain advantages in the confirmation of low-copy virus samples, which is of great significance for the efficient prevention and control of WNV and the detection of animal diseases at ports. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings.

[0024] Figure 1 This is the annealing temperature optimization result and analysis diagram. The figure shows the results at annealing temperature of A01 / A02: 54.6℃, A03: 55.6℃, A04: 57.0℃, A05: 58.5℃, B06: 60℃, A07: 61.3℃, A08: 62.6℃, A09: 63.9℃, and A10: 65℃.

[0025] Figure 2 The figure shows the optimization results and analysis of primer concentrations. In the figure, A09: 100nM probe, 500nM primer; B09: 100nM probe, 900nM primer; C09: 100nM probe, 1200nM primer; D09: 250nM probe, 500nM primer; E09: 250nM probe, 900nM primer; F09: 250nM probe, 1200nM primer; A10: 500nM probe, 500nM primer;

[0026] B10: 500 nM probe, 900 nM primer; C10: 500 nM probe, 1200 nM primer; D10: 700 nM probe, 500 nM primer; E10: 700 nM probe, 900 nM primer; F10: 700 nM probe, 1200 nM primer.

[0027] Figure 3 This is a graph of specificity validation results, in which A04: NiV; B04: BRF; C04: EHV; D04: H3N8 equine influenza; H04: AIV; G05: TOX; F05: EAV; A05: WNV.

[0028] Figure 4 This is a fluorescence PCR sensitivity analysis chart, using template concentrations of 4×10e 1 -4×10e 7 Verify the sensitivity of fluorescent PCR.

[0029] Figure 5 This is a digital PCR sensitivity analysis chart, specifically using template concentrations of 4×10e 0 -4×10e 5 Validation of digital PCR sensitivity. DETAILED DESCRIPTION

[0030] Example 1 Establishment of digital PCR detection method for West Nile virus

[0031] 1 Materials and methods

[0032] 1.1 Source of viral nucleic acid

[0033] EAV virus, H3N8 virus, WNV virus, and AIV virus were stored in this laboratory; TOX plasmid, EHV plasmid, NIV plasmid, and BRF plasmid were produced by Sangon Biotech (Shanghai) Co., Ltd.;

[0034] 1.2 Design and synthesis of primers and probes

[0035] The full genome sequence of West Nile virus lineage 1 was downloaded from NCBI, and the NS2A sequence of the WNV conserved region was used as a template to design primers and probes. The WNV digital PCR primers and probes WNV-d-F1, WNV-d-R1, WNV-d-P1, and WNV-d-P2 (Table 1) were designed using Primer Premier 5 software. All primers and probes were synthesized by Sangon Biotech Co., Ltd.

[0036]

[0037] 1.3WNV reverse transcription real-time fluorescence quantitative PCR (RT-qPCR) reaction system and procedure

[0038] The laboratory viral nucleic acid RNA was used as a template for reverse transcription real-time fluorescence quantitative PCR (RT-qPCR) amplification. The RT-qPCR reaction system was: 1 μL of upstream and downstream primers and probes (10 μmol / L), 5 μL of DNA template, and DEPC water was added to make the volume 25 μL. The amplification program was pre-denaturation at 95°C for 10 min; 95°C for 15 s; 60°C for 1 min; and 40 cycles of amplification.

[0039] 1.4WNV reverse transcription digital PCR (RT-ddPCR) reaction system and procedure

[0040] The digital PCR method was established based on the fluorescent PCR method using the designed primers. The configuration system was as follows: 5 μL of Supermix (Bio Rad), 2 μL of Reversetranscriptase, 1.8 μL of upstream and downstream primers (10 μmol / L) (final concentration 0.9 μmol / L), 0.5 μL of probe (10 μmol / L) (final concentration 0.25 μmol / L), 1 μL of template, and water was added to 20 μL. The 20 μL reaction solution was transferred to the droplet generation slot. At the same time, 70 μL of droplet generation oil was added to the lower well, and the plate was covered with a stop bar and placed in a droplet generator to generate droplets. Subsequently, 40 μL of droplets were transferred to a 96-well PCR plate, heated and sealed, and placed in a PCR instrument. The reaction conditions were: 42°C for 60 min, 95°C for 10 min; 95°C for 30 s; 60°C for 1 min, amplification for 40 cycles; 98°C for 10 min. After amplification, the droplet fluorescence signal was read using a droplet reader and the results were analyzed in the software.

[0041] 1.5WNV reverse transcription digital PCR primer concentration and reaction temperature

[0042] Using the established method, the optimal reaction annealing temperature and primer probe concentration were explored with viral nucleic acid RNA as the template. The annealing temperatures were selected as 54.6°C, 55.6°C, 57.0°C, 58.5°C, 60°C, 61.3°C, 62.6°C, 63.9°C, and 65°C, respectively; and the amplification efficiency was verified at final primer concentrations of 500nM, 900nM, 1200nM and probe concentrations of 100nM, 250nM, 500nM, and 700nM, respectively.

[0043] 1.6 Specificity and sensitivity of WNV reverse transcription digital PCR

[0044] RT-ddPCR amplification was performed using 8 viral nucleic acids, including Niv, BRF, EHV, H3N8 equine influenza, AIV, TOX, EAV and WNV, as templates to observe the distribution of positive droplets. At the same time, the viral nucleic acid RNA stock solution was diluted 10 times, with a concentration range of 4*10 0 -4*10 7 Three biological replicates were set up for each concentration, and the sensitivity of RT-qPCR and RT-ddPCR was verified at the same time, and standard curves were drawn to complete linear analysis.

[0045] Example 2 Results of Digital PCR Detection Method for West Nile Virus

[0046] 2.1 Optimization of digital PCR reaction temperature

[0047] Using RNA with the full length of WNV as template, the optimal reaction temperature of WNV digital PCR primer probe was verified in the range of 54.6℃~65℃, and 8 groups of annealing temperatures were set as 54.6℃, 55.6℃, 57.0℃, 58.5℃, 60℃, 61.3℃, 62.6℃, 63.9℃, 65℃( Figure 1 ). The results showed that at 60°C, the average signal intensity was the highest, the standard deviation was small, and at the same template concentration, when the annealing temperature was 60°C, the proportion of positive spots was 46.36% (Table 2), which was the highest in the verified annealing temperature range, and the measured concentration value was closest to the actual sample concentration. Therefore, it was preliminarily determined that 60°C was the optimal reaction temperature corresponding to the primers designed in this study.

[0048]

[0049] 2.2 Optimization of digital PCR primer and probe concentrations

[0050] Using RNA with the full length of WNV as template, the amplification efficiency of the primers at final concentrations of 500nM, 900nM, 1200nM and the probe concentrations of 100nM, 250nM, 500nM, and 700nM was verified. Figure 2 ). The results showed that under the same template concentration conditions, the final concentration of primers was 900nM and the final concentration of probes was 250nM, which had the highest amplification positive rate. At the same time, the average positive signal value was relatively high and the signal was relatively concentrated. Therefore, it was preliminarily determined that the final concentration of primers was 900nM and the final concentration of probes was 250nM as the optimal reaction primer and probe concentrations.

[0051]

[0052]

[0053] 2.3 Digital PCR specificity verification

[0054] To verify the specificity of the designed primers and probes, eight viral nucleic acids, including Niv, BRF, EHV, H3N8 equine influenza, AIV, TOX, EAV and WNV, were used as templates. The specificity test was performed using the primers and probes designed in this experiment. It was found that only the WNV template produced a positive signal, while the other Niv, BRF, EHV, H3N8 equine influenza, AIV, TOX and EAV did not produce positive droplets. Therefore, it was preliminarily determined that this set of primers and probes had good specificity.

[0055] 2.4 Digital PCR and fluorescence PCR sensitivity analysis RT-qPCR was performed using RNA diluted in multiples as template ( Figure 4 ) and digital PCR( Figure 5 ), the results show that the linear regression coefficient of digital PCR is R 2=0.9998; Fluorescence PCR linear regression coefficient R 2 =0.9902, the sensitivity is good, and the standard curves have a good linear relationship.

[0056] At present, WNV laboratory detection methods include molecular biological detection, antigen detection and serological detection. However, according to the WOAH terrestrial animal diagnostic test and vaccine manual, each method has limitations. RT-PCR can complete the detection of poultry, but in terminal hosts such as horses, RT-PCR positive results are very rare, and the ELISA method lacks specificity and can cross-react with other yellow fever (Flaviviruses) antibodies. Therefore, it is recommended to use other more specific methods such as virus neutralization to complete the detection of the same sample.

[0057] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. A primer set and a probe for detecting West Nile virus, characterized in that: The primer sequences are as follows: wnv-d-f1:gtgttacgctatgtcatcttggtg; wnv-d-r1: actggttgtatcttgaaggtcgc; The probe sequences are as follows: wnv-d-p1:6-fam-gctttcgcagaatctaattcggggagga-bhq1; wnv-d-p2:6-fam-gctttcgcagaatctaattcggggagga-tamra-n.

2. A kit for detecting West Nile virus, characterized in that: Contains the primer set and probe according to claim 1.

3. Use of the kit according to claim 2 in detecting West Nile virus.

4. A digital PCR detection method for West Nile virus, characterized in that: The system and procedures of the test method are as follows: Preparation system: Supermix (Bio Rad) 5 μL, Reversetranscriptase 2 μL, upstream and downstream primers (10 μmol / L) 1.8 μL each (final concentration 0.9 μmol / L), probe (10 μmol / L) 0.5 μL (final concentration 0.25 μmol / L), template 1 μL, add water to make up to 20 μL; Transfer 20 μL of the reaction solution to the microdroplet generation slot, and at the same time, add 70 μL of microdroplet generation oil to the lower well, cover with the stop bar, and place in the microdroplet generator to generate microdroplets; Then, 40 μL of the droplet was transferred to a 96-well PCR plate, and after heating and sealing, it was placed in a PCR instrument. The reaction conditions were: 42°C for 60 min, 95°C for 10 min, 95°C for 30 s, 60°C for 1 min, 40 cycles of amplification, and 98°C for 10 min. After amplification was completed, the droplet fluorescence signal was read using a droplet reader, and the results were analyzed in the software.

5. The digital PCR detection method for West Nile virus according to claim 4, characterized in that: The annealing temperature used in the detection method was 60°C.

Images