Recombinant XVII type collagen as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and provides a recombinant XVII type collagen as well as a preparation method and application thereof. A target gene sequence is obtained through bioinformatics predictive analysis and integrated design on the basis of a human XVII type collagen sequence, codon optimization is carried out, a T7 promoter in a plasmid vector is optimized, an engineering strain of the high-hydrophobicity humanized XVII type collagen is prepared, and the high-hydrophobicity humanized XVII type collagen is obtained. The strain is subjected to culture and inducible expression to obtain high-yield recombinant XVII type collagen. The recombinant XVII type collagen disclosed by the invention is reasonable in sequence design, large in expression quantity, simple in preparation method and stable in heredity, and rapid separation of the collagen can be realized in a production and preparation process by utilizing high hydrophobicity.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a recombinant humanized type XVII collagen, and also includes a preparation method and application thereof. Background Art

[0002] Collagen is the most abundant structural and functional protein in the human body, accounting for about one-third of the total human protein. It has a characteristic structure (Gly-Xaa-Yaa) n Repeating sequence and unique triple helix structure. At the same time, collagen is also a superfamily of proteins containing 29 subtypes. Different subtypes of collagen are distributed in different connective tissues and play different biological functions. According to their structure, they can be divided into fibrous collagen, basement membrane collagen, microfibril collagen, anchoring collagen, hexagonal reticular collagen, non-fibrous collagen, transmembrane collagen, etc. All types of collagen have common triple helical structural characteristics and form complex high-level structures through multi-level self-assembly. Collagen has good biological activity and can regulate cell behaviors such as cell adhesion, proliferation and differentiation. Collagen is widely used in biomedicine and tissue engineering due to its excellent properties such as low immunogenicity, high biocompatibility and biodegradability.

[0003] The content of human type XVII collagen in the human body is relatively low, and the content of type XVII collagen in animals is also extremely rare. It is also very difficult to extract and cannot be mass-produced. At the same time, animal-derived collagen products inevitably have immunogenicity and potential biosafety risks such as viruses and epidemics, and are not widely used. These have led to the fact that there are no commercialized type XVII collagen products from humans or other animals on the market, which has further limited the research and application of human type XVII collagen. The main way to solve this problem now is to complete collagen through biotechnology such as genetic engineering.

[0004] Bioengineering technology usually introduces the target gene into the host cell at the molecular level and uses the host cell's transcription and translation system to produce the recombinant target protein. Compared with collagen extracted from tissues, recombinant collagen has the following advantages: 1) no virus risk; 2) low immunogenicity; 3) good water solubility; 4) processability; 5) stable quality; 6) large-scale preparation. However, the existing technology lacks a solution for the efficient production of recombinant type XVII collagen. Summary of the invention

[0005] The present invention provides a recombinant humanized type XVII collagen to solve the problem in the prior art that human type XVII collagen is difficult to produce and obtain in batches.

[0006] In a first aspect, the present invention provides a recombinant type XVII collagen, the amino acid sequence of which is shown in SEQ ID NO.4.

[0007] The second aspect of the present invention provides a nucleic acid molecule encoding the above-mentioned recombinant type XVII collagen.

[0008] Optionally, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.5.

[0009] The third aspect of the present invention provides an expression vector comprising the above-mentioned nucleic acid molecule.

[0010] Optionally, the expression vector is a plasmid vector, the plasmid vector contains a T7 promoter, and the sequence of the T7 promoter is shown in SEQ ID NO.6 or SEQ ID NO.7.

[0011] Optionally, the plasmid is pBBR or pUC.

[0012] The fourth aspect of the present invention provides a recombinant expression strain, wherein the recombinant expression strain contains the above-mentioned nucleic acid molecule or the above-mentioned expression vector.

[0013] Optionally, the host bacteria of the recombinant expression strain is Escherichia coli BL21 (DE3).

[0014] The fifth aspect of the present invention provides a method for preparing recombinant type XVII collagen, comprising culturing the above-mentioned recombinant expression strain, inducing the expression of the target gene of the recombinant expression strain to obtain recombinant type XVII collagen; and separating and purifying the obtained recombinant type XVII collagen.

[0015] In a sixth aspect, the present invention provides use of an amino acid sequence as shown in SEQ ID NO.1 or a nucleotide sequence as shown in SEQ ID NO.2 or SEQ ID NO.3 in the preparation of recombinant type XVII collagen.

[0016] The seventh aspect of the present invention provides the use of the above-mentioned recombinant type XVII collagen, the above-mentioned nucleic acid molecule, the above-mentioned expression vector, and the above-mentioned recombinant expression strain in the preparation of skin care products, skin repair dressings, implants, and device products.

[0017] Beneficial effects:

[0018] The recombinant type XVII collagen of the present invention is a highly hydrophobic human type XVII collagen. The type XVII collagen of the present invention obtains the target gene sequence through bioinformatics prediction analysis and integrated design, and performs codon optimization, and also optimizes the T7 promoter in the plasmid vector to obtain an engineering strain; the engineering strain can successfully express highly hydrophobic humanized type XVII collagen, and in some embodiments, its protein yield can reach 5g / L. The recombinant type XVII collagen of the present invention has a reasonable sequence design, a large expression amount, a simple preparation method, and genetic stability. It can also use high hydrophobicity to achieve rapid separation of collagen during the production and preparation process. The humanized type XVII collagen of the present invention has high cell activity and can be industrially produced. It has broad application prospects in the fields of skin care products, skin repair dressings, implants, medical devices, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a curve chart of the hydrophobicity analysis of 10kDa collagen in the embodiment of the present invention. Among them, the curve value MIN: -1.633, MAX: 1.133; the horizontal axis: each amino acid position, the vertical axis: the strength of hydrophilicity and hydrophobicity, with 0 as the dividing line, >0 indicates hydrophobicity, and <0 indicates hydrophilicity. Analysis software: Expasy-ProtScale.

[0020] Figure 2 Flowchart for the construction of the engineering plasmid pET-28a-LuxI-LuxR-PLux-COL17A 10(3).

[0021] Figure 3 To construct a T7 promoter gene mutation library. In the figure, (A) fluorescence histograms of some mutant strains and WT strains; (B) WebLogo of T7 promoter gene mutation sequence; (C) division of expression levels based on fluorescence heat map.

[0022] Figure 4 The results show the effect of inducers on the expression of 10kDa (3) collagen.

[0023] Figure 5 This is an SDS-PAGE diagram of the collagen expressed by the 10kDa(3) engineering strain of the example of the present invention.

[0024] Figure 6 The SDS-PAGE diagram of the recombinant collagen expressed at high density in a 5L fermentation tank of the recombinant strain of the present invention. DETAILED DESCRIPTION

[0025] The embodiment of the present invention provides an engineering modification technology and preparation method for efficiently producing recombinant highly hydrophobic humanized type XVII collagen. The amino acid sequence of the highly hydrophobic type XVII collagen α1 chain fragment is predicted and screened by bioinformatics means, preferably the 10kDa (SEQ ID NO.1) protein sequence, and the corresponding sequence (SEQ ID NO.2), and the codons encoded by it are optimized according to the chassis strain BL21 (DE3) to obtain the corresponding sequence (SEQ ID NO.3); thus, the present invention also provides the use of the amino acid sequence shown in SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.2 or SEQ ID NO.3 in the preparation of recombinant type XVII collagen, that is, using it as the basic target gene fragment of recombinant collagen to produce and prepare recombinant type XVII collagen.

[0026] Furthermore, in order to make the recombinant collagen-like protein exert better activity, the amino acid sequence shown in SEQ ID NO.1 was repeated three times end to end as a repeating unit to obtain a recombinant collagen-like protein sequence (SEQ ID NO.4), and the corresponding gene sequence was (SEQ ID NO.5); then, the green fluorescent protein was fused to the C-terminus of the amino acid sequence of SEQ ID NO.1 with the help of GS linker, and the above sequence was inserted into the T7 promoter of plasmid pBBR or pUC by PCR and Gibson assembly technology to obtain an engineering plasmid, and then chemically transfected or electroporated, and transfected into Escherichia coli BL21 to obtain an engineering strain that efficiently expresses highly hydrophobic humanized type XVII collagen. The engineering strain was cultured, including high-density culture and fermentation, to obtain recombinant type XVII collagen.

[0027] Among them, for the bioinformatics means, the available tools or databases include alphfold, swissmodle, PDB or NCBI, etc. For the engineering plasmid, a carboxyl-terminal fusion fluorescent protein is included, and more specifically, in addition to green fluorescent protein, red fluorescent protein and yellow fluorescent protein, etc. can also be included. In the embodiment of the present invention, the promoter of the engineering plasmid is the T7 promoter of the bacteriophage, which is optimized and studied in one scheme of the present invention, and randomly mutated to obtain T7 promoters with different expression strengths, and finally two T7 promoters with better expression strengths are selected (sequences SEQ ID NO.6 and SEQ ID NO.7).

[0028] Example 1 Gene Design

[0029] The present invention uses the nucleic acid sequence of human type XVII collagen a1 chain (NM_000494.4) published in the NCBI database as a template, performs bioinformatics analysis, prediction and screening on the sequence, and finally selects the nucleic acid sequence (SEQ ID NO.2) with a core encoding molecular weight of 10kDa functional amino acids. Figure 1 ) showed that 10kDa collagen is a hydrophobic protein. On this basis, the nucleotide sequence was optimized and designed according to the codon preference of the chassis strain Escherichia coli (SEQ ID NO.3). In order to make the recombinant collagen protein play a better activity, the amino acid sequence shown in SEQ ID NO.1 was repeated three times end to end as a repeating unit to obtain a recombinant collagen protein sequence (SEQ ID NO.4), and the corresponding gene sequence was (SEQ ID NO.5), which was also a sequence after codon optimization. After that, the gene synthesis was commissioned to Sangon Biotech (Shanghai) Co., Ltd.

[0030] Example 2 Molecular Biology Experiment

[0031] 1) DNA fragment amplification: Use Phanta polymerase to perform high-fidelity PCR amplification of DNA fragments, followed by gel electrophoresis separation to obtain the target band; use EZNA gel recovery kit to recover and purify the target band.

[0032] 2) DNA assembly: The plasmid was assembled using the Gibson assembly method. The target DNA solution recovered above was mixed with 100 ng of the backbone DNA fragment and the remaining DNA linker fragments in equal moles, and then made up to 5 μL with sterile double distilled water, and then mixed with Gibson Mixture, and reacted at 50°C for 1 hour to obtain the target product.

[0033] 3) Plasmid amplification: The DNA assembly product is transferred into E. coli (BL21) by chemical transformation, and then cultured to achieve plasmid amplification. The chemical transformation method is described in detail as follows:

[0034] ①Take 50ul of competent cells melted in an ice bath, add the target DNA, mix gently, and place in an ice bath for 30 minutes;

[0035] ②Heat shock in a 42°C water bath for 45 seconds, then quickly transfer the tube to an ice bath for 2 minutes;

[0036] ③ Add 500ul of sterile 2×YT medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 37°C, 200rpm for 1 hour to allow the bacteria to recover;

[0037] ④Pipette 500ul of transformed competent cells onto 2×YT agar medium containing corresponding antibiotics, and spread the cells evenly. Place the plate at 37℃ until the liquid is absorbed, invert the plate, and culture at 37℃ overnight.

[0038] Example 3 Construction of engineered strains

[0039] Primers were designed using pET-PLux-LuxI-LuxR plasmid as template:

[0040] F.DHDK acgcgtgctagaggcatcaa

[0041] R.DHDK ggtacctttctcctctttaatgaattc

[0042] The skeleton was amplified and recovered by gel, and the optimized 10kDa(3) gene fragment was constructed by homologous recombination to construct the pET-28a-LuxI-LuxR-PLux-COL17A 10(3) engineering plasmid and chemically transformed into chassis Escherichia coli ( Figure 2 ). The constructed engineering strain is recombinant E. coli BL21 / pET-28a-Col17.

[0043] The T7 promoter in the above engineering plasmid is the optimized promoter T7H6 (SEQ ID NO.7).

[0044] For T7 promoter optimization:

[0045] The first five bases of the T7 promoter were randomly mutated, and a P construct was constructed with gfp as the reporter gene. T7 Mutation library. Figure 3 As shown, 372 randomly selected mutant clones can express GFP, from which mutants with output intensity covering 0.5-600% of the original T7 promoter were obtained; then, mutant P T7 The gene sequence of the promoter was sequenced and analyzed to obtain a mutant library and generate a WebLogo ( Figure 3 B) to reveal the base preference at the mutation site; then, some promoter sequences were selected from the mutant library to test gfp expression under different IPTG concentrations; the results further obtained P with different expression levels under the same concentration of inducer. T7 Promoter Library ( Figure 3 C). It is preferred that two T7 promoter sequences, T7L4 and T7H6, have sequences of SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0046] Example 4 Plasmid Sequencing and Enzyme Digestion Verification

[0047] Design verification primers to perform PCR verification and Sanger sequencing on the pET-28a-LuxI-LuxR-PLux-COL17A 10(3) plasmid. Use restriction endonucleases to verify the plasmids with correct sequencing results. Verify the size of the product fragments to exclude false positive plasmids caused by repeated or incorrect DNA fragment connections.

[0048] Example 5 Characterization of engineered strains

[0049] Primers were designed to add the fluorescent protein gene eGFP to the tail of the type XVII collagen gene, and the expression of the engineered strain was detected by flow cytometry. The specific implementation steps were: the engineered strain was inoculated into 2×YT medium, the control group was induced to ferment for 48 hours, and the experimental group was induced to ferment for 24 hours and then the inducer IPTG was added.

[0050] like Figure 4 As shown, the experimental results show that the expression capacity of the engineered strain can be enhanced by adding the inducer IPTG.

[0051] Example 6 Engineering strain induced fermentation

[0052] Under laboratory conditions, the engineered strain was inoculated into 500 mL of 2×YT medium and fermented for 24 h. Then, the inducer IPTG was added to the medium to induce the expression of the autoinducer and its receptor protein for 24 h. The fermentation broth was centrifuged and ultrasonically disrupted. After centrifugation, the supernatant and bacterial sludge were taken for SDS-PAGE. Figure 5 As shown, the SDS-PAGE results of the recombinant type XVII collagen (i.e., 10kDa (3) collagen) of the present invention showed that its molecular weight was 35kDa, showing that the apparent molecular weight was larger than the expected molecular weight. Preliminary analysis speculated that the collagen was glycosylated, which was consistent with the bioinformatics prediction of the glycosylation sites.

[0053] Example 7 High-density culture of recombinant E. coli BL21 / pET-28a-Col17 in 5L tank

[0054] The recombinant bacteria E.coliBL21 / pET-28a-Col17 was cultured in a 5L tank at high density. The bacterial solution in the glycerol tube was inoculated into 100mL seed LB medium containing 50μg / mL kanamycin at an inoculation volume of 1‰, and cultured at 37℃ and 180rpm for about 18h. All the cultured seed solution was transferred to a 5L fermenter containing 3L fermentation medium. The initial fermentation parameters were set as follows: stirring speed 150rpm, fermentation temperature 37℃, ventilation volume 4L / min, dissolved oxygen associated stirring was adjusted and controlled at 20%, and the pH was controlled at 7.0 by automatically adding ammonia water during the fermentation process. After the dissolved oxygen rose to 35%, feeding began, the initial feeding rate was 1.0mL / min, the dissolved oxygen was adjusted to maintain at 20% by increasing the ventilation volume, 0.5mM IPTG was added, the dissolved oxygen was controlled at about 30%, induced for 18h, and the fermentation broth was detected by SDS-PAGE.

[0055] The results of SDS-PAGE were as follows: Figure 6 As shown, after imageJ software analysis, the grayscale values ​​of the standard protein and the recombinant humanized collagen were determined, and it was calculated that when the recombinant bacteria E. coli BL21 / pET-28a-Col17 was induced in a 5L tank with high-density fermentation for 18 hours, the engineering strain regulated by the T7H6 promoter had a maximum recombinant humanized collagen production of 5.3 g / L, achieving a high expression efficiency of the recombinant humanized collagen.

[0056] The present invention is described in detail above in conjunction with specific implementation methods and exemplary examples, but these descriptions cannot be understood as limiting the present invention. Those skilled in the art understand that, without departing from the spirit and scope of the present invention, the technical solution of the present invention and its implementation methods may be subjected to a variety of equivalent substitutions, modifications or improvements, all of which fall within the scope of protection claimed by the claims of the present invention.

Claims

1. A recombinant type XVII collagen, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

4.

2. A nucleic acid molecule encoding the recombinant type XVII collagen according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

5.

4. An expression vector comprising the nucleic acid molecule of claim 2 or 3.

5. The expression vector according to claim 4, characterized in that The expression vector is a plasmid vector, which contains a T7 promoter. The sequence of the T7 promoter is shown in SEQ ID NO.6 or SEQ ID NO.

7.

6. A recombinant expression strain, characterized in that: Containing the nucleic acid molecule according to claim 2 or 3 or the expression vector according to claim 4 or 5.

7. The recombinant expression strain according to claim 6, characterized in that: The host bacteria of the recombinant expression strain is Escherichia coli BL21 (DE3).

8. The method for preparing recombinant type XVII collagen according to claim 1, characterized in that: include: Cultivate the recombinant expression strain according to claim 6 or 7, and induce the expression of the target gene of the recombinant expression strain to obtain recombinant type XVII collagen; and separate and purify the obtained recombinant type XVII collagen.

9. Use of the amino acid sequence shown in SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.2 or SEQ ID NO.3 in the preparation of recombinant type XVII collagen.

10. Use of the recombinant type XVII collagen according to claim 1, the nucleic acid molecule according to claim 2 or 3, the expression vector according to claim 4 or 5, or the recombinant expression strain according to claim 6 or 7 in the preparation of skin care products, skin repair dressings, implants, and device products.

Images