CtPDS gene of Cucurbita edulis and its VIGS virus vector and silencing method

Abstract

The present invention relates to the field of genetic engineering technology, in particular to ground cucumber CtPDS Gene and VIGS virus vector and silencing method thereof. The present invention provides a phytoene dehydrogenase of cucurbita oleracea, the amino acid sequence of which is shown in SEQ ID NO.1. The present invention discovered the amino acid sequence of cucurbita oleracea phytoene dehydrogenase and its encoding gene CtPDS sequence, on this basis, provides a kind of silencing CtPDS Gene target nucleic acid molecule, VIGS silencing system and silencing method. CtPDS Leaves of gene-silenced plants CtPDS The gene expression level was significantly reduced, the silencing efficiency reached 56%~65%, the chlorophyll and carotenoid contents decreased significantly, and the leaves showed a whitening phenotype, providing technical support for the functional research of key genes in the ground melon.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to ground cucumber CtPDS Genes and their VIGS viral vectors and silencing methods. Background Art

[0002] Ground melon[ Cynanchum thesioides Freyn K. Schum. is a plant of the genus Freyn of the family Apocynaceae, an upright semi-shrub; the underground stems are monoaxial and horizontal; the stems are multi-branched from the base. In China, it is distributed in Inner Mongolia, Northeast China, Xinjiang and other places, and grows in arid sandy land, wasteland, and field edges. It can be used as a resource for medicine, food, and feed, and can also be used for the management of barren slopes and wastelands. Therefore, the development of an efficient, convenient, and rapid technical solution for the functional verification of the ground melon gene is of great importance to the genetic improvement of the ground melon.

[0003] Virus-induced gene silencing has the advantages of simple operation, short research cycle, and no need for genetic transformation. It has been widely used in a variety of monocotyledonous and dicotyledonous plants. It is based on the plant's defense mechanism against viral gene replication, integrating the non-transgenic systemic infection of plant viruses and the plant's immune response mechanism. It can silence targeted genes simply, quickly and efficiently, greatly facilitating reverse genetic studies of plant gene function. Compared with traditional gene function analysis methods, virus-induced gene silencing (VIGS) can silence and functionally analyze target genes in the infected plant without the need to develop stable transformants, and has the potential to silence single or multiple gene family members.

[0004] Phytoene desaturase (PDS) is a key enzyme in the biosynthesis of carotenoids. When the carotenoid synthesis pathway is blocked, the plant will show albinism. It is often used as a phenotypic control to monitor the silencing effect and is a very important gene for the development of VIGS silencing technology. However, the current research on the gene function of ground melon is still relatively backward, and the phytoene desaturase and coding sequence of ground melon are not clear. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a CtPDS The present invention has discovered the amino acid sequence of phytoene dehydrogenase from Cucurbita oleracea and its coding gene. CtPDS sequence, on this basis, provides a kind of silencing CtPDS The target nucleic acid molecule, VIGS silencing system and silencing method of the gene can effectively reduce the CtPDSThe expression level of the gene was significantly reduced, and the chlorophyll and carotenoid contents in the leaves of the ground melon were significantly decreased, providing important technical support for the functional verification of the ground melon gene.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a phytoene dehydrogenase from Cucurbita oleracea, the amino acid sequence of which is shown as SEQ ID NO.1.

[0008] The present invention provides a gene encoding the phytoene dehydrogenase described in the above technical solution. CtPDS Gene, the CtPDS The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0009] The present invention provides the above-mentioned technical solution of silencing CtPDS Application of genes in reducing the chlorophyll content and / or carotenoid content in leaves of Gastrodia elata.

[0010] The present invention provides a method for silencing the above technical solution. CtPDS The target nucleic acid molecule of the gene, the nucleotide sequence of the target nucleic acid molecule is shown in SEQ ID NO.13.

[0011] The present invention provides a method for silencing the above technical solution. CtPDS A VIGS viral vector containing a gene, wherein the VIGS viral vector comprises the target nucleic acid molecule described in the above technical solution.

[0012] Preferably, the backbone vector of the VIGS viral vector includes a pTRV2 vector.

[0013] The present invention provides a method for silencing the above technical solution. CtPDS Genetically engineered bacteria, the engineered bacteria comprising the VIGS virus vector described in the above technical solution.

[0014] The present invention provides a method for silencing the above technical solution. CtPDS The gene-infecting bacterial solution comprises the engineered bacteria described in the above technical solution.

[0015] Preferably, the infection bacterial solution further comprises an engineered bacterium containing an auxiliary vector; the auxiliary vector comprises a pTRV1 vector; the OD of the infection bacterial solution is 600 The value is 0.8~1.0.

[0016] The present invention provides a method for silencing the above technical solution. CtPDS The method comprises: injecting the infective bacterial solution described in the above technical solution into the apical meristem of the ground squash seedlings.

[0017] Beneficial effects:

[0018] The present invention provides a phytoene dehydrogenase from Cucurbita oleracea, the amino acid sequence of which is shown in SEQ ID NO.1. The present invention discovered the amino acid sequence of the phytoene dehydrogenase from Cucurbita oleracea and its encoding gene CtPDS sequence, on this basis, provides a kind of silencing CtPDS Gene target nucleic acid molecule, VIGS silencing system and silencing method. CtPDS Leaves of gene-silenced plants CtPDS The gene expression level was significantly reduced, the silencing efficiency reached 56%~65%, the chlorophyll and carotenoid contents decreased significantly, and the leaves showed a whitening phenotype, providing technical support for the functional research of key genes in the ground melon. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0020] Figure 1 for CtPDS Electrophoresis of PCR amplification products of genes;

[0021] Figure 2 This is the phylogenetic tree of CtPDS protein of Cucurbita sutchuenensis;

[0022] Figure 3 The amino acid sequence comparison results of CtPDS of Cucurbita sutchuenensis and PDS proteins of several other species;

[0023] Figure 4 Plant phenotypic changes and CtPDS Results of qPCR analysis of genes in leaves;

[0024] Figure 5 The results of chlorophyll and carotenoid content determination of different strains are shown in Figure 2.

[0025] Figure 6 The gene silencing results of different Agrobacterium bacterial cultures. DETAILED DESCRIPTION

[0026] The present invention provides a phytoene dehydrogenase from cucurbita oleracea, characterized in that the amino acid sequence is as shown in SEQ ID NO.1, and is specifically as follows:

[0027] SEQ ID NO.1:

[0028] .

[0029] The present invention provides a gene encoding the phytoene dehydrogenase described in the above technical solution. CtPDS Gene, CtPDS The nucleotide sequence of the gene is shown in SEQ ID NO.2, and is as follows:

[0030] SEQ ID NO.2:

[0031]

[0032] The present invention has discovered the amino acid sequence and coding gene of phytoene dehydrogenase from ground melon CtPDS Sequence, silence CtPDS The gene can reduce the chlorophyll and carotenoid content in the leaves of the ground melon, causing the leaves to appear albino, providing technical support for the functional genomics research of the ground melon.

[0033] Based on the above advantages, the present invention provides a method for silencing the above technical solution. CtPDS Application of genes in reducing the chlorophyll content and / or carotenoid content in leaves of Gastrodia elata.

[0034] The present invention provides a method for silencing the above technical solution. CtPDS The target nucleic acid molecule of the gene, the nucleotide sequence of the target nucleic acid molecule is shown in SEQ ID NO.13. The target nucleic acid molecule provided by the present invention can effectively silence CtPDS The gene silencing efficiency reaches 56%~65%.

[0035] Based on the above advantages, the present invention provides a method for silencing the above technical solution. CtPDS A VIGS viral vector containing a gene, wherein the VIGS viral vector comprises the target nucleic acid molecule described in the above technical solution.

[0036] As an embodiment, the backbone vector of the VIGS viral vector includes a pTRV2 vector.

[0037] As an embodiment, the target nucleic acid molecule is located in the pTRV2 vector Kpn I and Xba I restriction site.

[0038] Based on the above advantages, the present invention provides a method for silencing the above technical solution. CtPDS Genetically engineered bacteria, the engineered bacteria comprising the VIGS virus vector described in the above technical solution.

[0039] As one embodiment, the initial bacteria of the engineered bacteria include Agrobacterium; as another embodiment, the Agrobacterium includes Agrobacterium tumefaciens; as another embodiment, the Agrobacterium tumefaciens may be Agrobacterium tumefaciens GV3101.

[0040] The present invention provides a method for silencing the above technical solution. CtPDS The gene-infecting bacterial solution comprises the engineered bacteria described in the above technical solution.

[0041] As an embodiment, the infection solution also includes an engineering bacterium containing an auxiliary vector and an infection solution; as an embodiment, the auxiliary vector includes a pTRV1 vector; as an embodiment, the infection solution includes: 10 mmol / L magnesium chloride, 10 mmol / L 2-morpholineethanesulfonic acid and 200 μmol / L acetosyringone. As an embodiment, the initial bacteria of the engineering bacterium containing an auxiliary vector include Agrobacterium; as another embodiment, the Agrobacterium includes Agrobacterium tumefaciens; as another embodiment, the Agrobacterium tumefaciens can be Agrobacterium tumefaciens GV3101.

[0042] As an embodiment, the OD of the infection solution is 600 As another embodiment, the OD of the infection solution is 0.8 to 1.0. 600 The value is 1.0.

[0043] The present invention provides a method for silencing the above technical solution. CtPDS The method comprises: injecting the infective bacterial solution described in the above technical solution into the apical meristem of the ground squash seedlings.

[0044] As an embodiment, the Melon seedlings may be Melon seedlings cultured from seeds to the cotyledon stage.

[0045] As an embodiment, the Melon officinalis seedlings injected with the infectious bacterial solution are cultured in a light incubator at 22° C., 50% humidity and a photoperiod of 16 h (light): 8 h (dark).

[0046] The infection methods that have been reported so far (such as infecting cotyledons, vacuuming seeds, and vacuuming seedlings) are not suitable for ground melons. Not only can they not be successfully infected, but they can also cause the death of seedlings. The method provided by the invention injects the infection solution into the apical meristem of ground melon seedlings, which can effectively silence the CtPDS Gene, providing technical support for the functional research of key genes of ground melon.

[0047] In order to further illustrate the present invention, the following is a description of the present invention in conjunction with the accompanying drawings and embodiments. CtPDS The gene and its VIGS viral vector and silencing method are described in detail, but they should not be understood as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] 1. Sample processing:

[0050] The seeds of Cynanchum thesioides were disinfected with 0.1% sodium hypochlorite for 10 minutes, rinsed with distilled water and cultured at a constant temperature of 28°C. After germination, they were sown in a substrate and cultured normally in a 28°C / 23°C (day / night) light incubator until the cotyledon stage for infection; the substrate consisted of peat, vermiculite and perlite, and the volume ratio of peat, vermiculite and perlite was 2:1:1. The seeds of Cynanchum thesioides were deposited in Inner Mongolia Agricultural University and published in the literature [Transcriptome-wide identification of WRKY transcription factors and their expression profiles under different stress in Cynanchum thesioides (DOI 10.7717 / peerj.14436)].

[0051] 2. CtPDS Gene cloning:

[0052] After RNA was extracted from the leaves of the ground cucumber using an RNA extraction kit, the RNA was reverse transcribed into cDNA. PDS Gene amplification.

[0053] PCR amplification system: 2×TransStart FastPfu Fly Reaction Mix (Beijing Quanshijin Biotechnology Co., Ltd.) 25μL, primer CtPDS-F 1μL, primer CtPDS-R 1μL, cDNA 1μL, TransStart FastPfu FlyDNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.) 1μL and ddH2O 21μL.

[0054] PCR amplification program: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 62°C for 5 s, extension at 72°C for 15 s, 30 cycles; final extension at 72°C for 1 min; storage at 4°C.

[0055] The nucleotide sequences of the primer CtPDS-F and the primer CtPDS-R are as follows:

[0056] Primer CtPDS-F: 5′-ATGTATCAGTTCGGACAAGT-3′ (SEQ ID NO. 3);

[0057] Primer CtPDS-R: 5′-TCAGGCAATGCTTGCCTCTG-3′ (SEQ ID NO. 4).

[0058] The PCR amplification product was detected by 1.0% agarose gel electrophoresis to confirm the correctness and uniqueness of the band, and a target band of about 1700 bp was obtained ( Figure 1 , where 53~62℃ are the products obtained at different annealing temperatures). The band size is in line with expectations. Then use the gel recovery kit to recover the PCR product. Refer to the instructions for the recovery steps. The recovered product is connected to the pMD18-T vector according to the steps and methods in the instructions, and transformed into DH5a competent cells. After resistance screening, pick the positive single colony, use primers CtPDS-F and primers CtPDS-R for PCR detection, and send the positive colony to the company for sequencing. After sequencing, CtPDS The full-length CDS sequence of the gene is 1749 bp (shown in SEQ ID NO.2).

[0059] 3. Bioinformatics analysis of CtPDS protein:

[0060] Will CtPDS The sequencing results of the gene were analyzed by bioinformatics. First, the open reading frame (ORF) of the gene and the translated protein sequence (shown in SEQ ID NO.1) were analyzed using the NCBI online software ORF finder. The PDS protein sequences of other species similar to the LiPDS protein sequence were searched and downloaded using the NCBI database online software blast. The DNAMAN 6.0 software was used to perform multiple sequence alignment analysis on the PDS protein sequences of different species to find out the relatively conservative domains. The MEGA X software was used to perform a phylogenetic tree analysis on the CtPDS protein and the PDS proteins of other species. The results are shown in Figure 2 and Figure 3 , Figure 3 The different numbers in the figure represent the PDS amino acid sequences of different varieties, from top to bottom: CtPDS for Cucurbita chinensis, CrPDS for Catharanthus roseus, SetPDS for Cassia seed, PaPDS for Prosopis chinensis, HbPDS for Hevea brasiliensis, RcPDS for Ricinus communis, AcPDS for Kiwi fruit, NtPDS for Tobacco, StPDS for Potato, and SiPDS for Sesame.

[0061] The results showed that the CtPDS protein was highly similar to that of Catharanthus roseus ( Figure 2 The amino acid sequence homology of the CtPDS protein of the ground melon and several other species is also high, indicating that it is relatively conservative in evolutionary development ( Figure 3 ).

[0062] 4. Construction of VIGS vector:

[0063] The sequence shown in SEQ ID NO.13 was selected as the target sequence, and the cDNA described in step 2 was used as a template to perform PCR amplification using primers pTRV2-PDS-F and pTRV2-PDS-R to obtain the target gene fragment; the nucleotide sequence of the primers is as follows:

[0064] pTRV2-PDS-F (SEQ ID NO.5):

[0065] 5'-aaggttaccgaattctctagaCAGGTTTGGCAGGTTTGTCC-3';

[0066] pTRV2-PDS-R (SEQ ID NO.6):

[0067] 5'-gagacgcgtgagctcggtaccATGCCTTGCTTACTCATCCAGTC-3';

[0068] Among them, 5'-aaggttaccgaattc-3' (SEQ ID NO.17) and 5'-gagacgcgtgagctc-3' (SEQID NO.18) are the homology arms of the vector sequence; 5'-tctaga-3' is Kpn I restriction site sequence, 5'-ggtacc-3' Xba I restriction site sequence.

[0069] Restriction enzymes Kpn I and Xba I. Double-enzyme digestion was performed on the pTRV2 plasmid and the target gene fragment, respectively, to obtain a linearized pTRV2 plasmid (9663 bp) and a target gene fragment containing restriction sites.

[0070] The linearized pTRV2 plasmid and the target gene fragment containing the restriction site were connected using a homologous recombination kit and transformed into DH5a competent cells.

[0071] After resistance screening in LB solid medium containing 50 mg / L kanamycin, positive single colonies were picked and PCR tested using vector primers (pTRV2-F and pTRV2-R). The product obtained by PCR amplification of the pTRV2-CtPDS recombinant plasmid with the inserted fragment successfully connected was 1052 bp in length.

[0072] pTRV2-F (SEQ ID NO.7): 5'-CCCACATATTCGCACGTA-3';

[0073] pTRV2-R (SEQ ID NO.8): 5'-CCCCCAACAATCTCTTAGC-3';

[0074] 5. Agrobacterium inoculation:

[0075] 1) The pTRV1 plasmid and the pTRV2-PDS recombinant plasmid were respectively transformed into GV3101 Agrobacterium;

[0076] 2) GV3101 Agrobacterium carrying pTRV1 plasmid and pTRV2-PDS recombinant plasmid were cultured in LB medium with kanamycin (50 μg / mL) and rifampicin (25 μg / mL) at 28°C and 180 r / min overnight. The cells were collected by centrifugation, and the invasion dye was added to suspend the cells. The OD of the bacterial solution was adjusted. 600 to 1.0, incubate in the dark for 2-4 hours to obtain pTRV1 Agrobacterium resuspension and pTRV2-CtPDS Agrobacterium resuspension; the infection solution is composed of the following concentrations: MgCl2 10mmol / L, 2-morpholineethanesulfonic acid (MES) 10mmol / L and acetosyringone 200μmol / L.

[0077] 3) Take equal volumes of pTRV1 Agrobacterium resuspension and pTRV2-CtPDS Agrobacterium resuspension and mix them thoroughly to obtain the infection solution for injection infection; at the same time, replace the pTRV2-CtPDS Agrobacterium resuspension with the pTRV2 empty vector Agrobacterium resuspension as the control group (CK). The ground melon seedlings cultured in the light incubator to the cotyledon stage were used as the material to be infected, and the apical meristem of the seedlings was injected with a disposable 1mL syringe without a needle. Before injection infection, a slight wound can be made (gently poke it with a 1mL syringe needle), and then the bacterial solution is injected into the apical meristem. The infected plants were cultured in a light incubator at 22℃, 50% humidity and a photoperiod of 16h (light): 8h (dark). After the leaves of the ground melon plants injected with pTRV2-CtPDS showed albinism, symptomatic samples were collected for silencing efficiency detection.

[0078] 6. Determination indicators:

[0079] The leaves of the ground melon with obvious albinism symptoms 15 days after virus inoculation were collected, and the total RNA of the leaves was extracted and reverse transcribed into cDNA. qRT-PCR was performed using the SYBR Green method to analyze the CtPDS The relative expression of genes. Actin The gene was used as an internal reference gene, and real-time fluorescence quantitative PCR primers (qPDS-F and qPDS-R) were designed. The nucleotide sequences of the primers are shown below:

[0080] qPDS--F (SEQ ID NO.9): 5'-GTCCACAGCAAAGTATTTAGCAGATG-3';

[0081] qPDS--R (SEQ ID NO.10): 5'-GTCTCATACCAGTCTCCATCATCATC-3';

[0082] Actin-F (SEQ ID NO. 11): 5'-AATGAGAGGTTCCGTTGCCC-3';

[0083] Actin-R (SEQ ID NO. 12): 5'-GTTGAACCACCACTGAGCAC-3'.

[0084] The relative expression level was calculated according to 2 −∆∆Ct The calculations were performed using the SPSS software. The graphs were drawn using GraphPad prism software. CtPDS The changes of chlorophyll after silencing were investigated. The chlorophyll and carotenoid contents were determined by ethanol extraction method from the CK and silencing treatment groups. The determination method was based on the reference [Li Hesheng, Principles and Techniques of Plant Physiology and Biochemistry Experiments [M]. Beijing: Higher Education Press, 2000].

[0085] 7. Results and analysis:

[0086] The pTRV2-CtPDS vector was used to infect the leaves of the ground melon seedlings with Agrobacterium tumefaciens, and it was found that the local melon plants PDS After the gene was silenced, the leaves of the plants turned chlorotic and bleached (see Figure 4 (A~C) preliminarily indicated that the VIGS vector was successfully constructed.

[0087] The results of qRT-PCR are shown in Figure 4 D and E in which CtPDS-1~CtPDS-8 are different CtPDS The results showed that compared with the wild-type ground melon (TRV2), the expression level of the PDS gene in the leaves of 8 individual plants in the experimental group was significantly reduced, and the silencing efficiency was as high as 65%.

[0088] The results of chlorophyll and carotenoid content determination of different strains are shown in Figure 5 , among which CtPDS-1~CtPDS-8 are different CtPDS Silence strains, TRV2 is the pTRV2 empty control group, compared with TRV2, ** is P <0.01. The results showed that compared with the pTRV2 empty control group, theCtPDS The gene can reduce the chlorophyll and carotenoid content in the leaves of the ground melon, and the degree of reduction is quite significant.

[0089] Comparative Example 1

[0090] A method similar to Example 1, the only difference being that in step 5, an invading dye solution is added to suspend the bacteria and the OD of the bacterial solution is adjusted. 600 to 0.60 or 0.80. Comparison of the effects of different concentrations of Agrobacterium on the growth of ground cucumber PDS The effect of gene silencing on the strain rate is shown in Figure 6 , compared with the OD=0.6 group, ** P <0.01.

[0091] The results showed that within a certain range, Agrobacterium inoculation had no significant effect on VIGS efficiency. 600 =1.00, PDS The gene silencing rate was the highest, at 65%, and the OD 600 =0.60 and OD 600 =0.80, the silence proportions were 46% and 56% respectively.

[0092] Comparative Example 2

[0093] A silencing method similar to Example 1, except that the injection method in step 5 (3) is replaced by a seed vacuum method, as follows:

[0094] The seeds with 1 cm long sprouts were placed in a centrifuge tube containing the infective bacterial solution, the pressure was -100 kPa, and the vacuum was drawn for 1 minute. This was repeated 1 to 2 times, and the treated ground melon seeds were planted in sterile vermiculite.

[0095] 20 days after infection, the ground melon grew true leaves, but there were no obvious changes, indicating that this method was not successful in infection.

[0096] Comparative Example 3

[0097] A silencing method similar to Example 1, except that the injection method in step 5) is replaced by the seedling vacuum method, as follows:

[0098] The ground melon plant with two cotyledons and two pairs of true leaves was taken out from the sterile vermiculite, cleaned with distilled water, placed in a 50 ml centrifuge tube containing the infectious bacterial solution, placed in a vacuum dryer and evacuated at a pressure of -100 kPa for 10 minutes. After treatment, the plant was taken out, cleaned, and replanted in a nutrient pot.

[0099] The results showed that the vacuum method could only cause a large number of seedlings to die, but failed to successfully infect the plants.

[0100] Comparative Example 4

[0101] A silencing method similar to Example 1, except that the injection method in step 5) is replaced by cotyledon injection, as follows:

[0102] Select the cotyledon stage melon plants with uniform growth and strong growth, absorb the infection solution with a 1 ml syringe, gently cut a wound on the back of the melon leaves, and inject the solution into the melon leaves along the wound with a needle-free syringe.

[0103] 7 days after infection, leaves were found to have fallen off at the injection site, and 30 days after infection, new leaves showed no obvious changes, indicating that the leaf injection method could not successfully infect the plants.

[0104] Comparative Example 5

[0105] A silencing method similar to Example 1, except that the sequence shown in SEQ ID NO.14 is selected as the target sequence, and the primers pTRV2-PDS-F and pTRV2-PDS-R are replaced with primers pTRV2-PDS-F1 and pTRV2-PDS-R1. The specific nucleotide sequence is as follows:

[0106] SEQ ID NO.13:

[0107] 5'-CAGGTTTGGCAGGTTTGTCCACAGCAAAGTATTTAGCAGATGCAGGCCATAAACCTGTGTTATTAGAAGCCAGGGATGTCCTTGGAGGAAAGGTTGCTGCATGGAAAGATGATGATGGAGACTGGTATGAGACTGGATTGCACATATTTTTTGGGGCCTACCCAAATGTGCAGAACCTATTTGGAGAGCTAGGCATTAATGATCGGCTTCAGTGGAAAGAACACTCTATG ATATTTGCAATGCCAAATAAGCCTGGAGAATTCAGTAGATTTGATTTTGCTGAGGCTTTGCCTGCACCATTAAACGGAATTTGGGCCATCTTGAAGAACAGTGAAATGCTCACCTGGCCAGAGAAAGTCAAGTTTGCTGTTGGACTCCTTCCAGCAATTCTTGGTGGACAGGCTTATGTTGAAGCACAGGATGGTATAACTGTCAAAGACTGGATGAGTAAGCAAGGCAT-3';

[0108] SEQ ID NO.14:

[0109] 5'-TGCAAATTCTGTTATCCTGAGATCAAGAAGGGGTGCAAGACCTTTAAAGGTTGTCTGCATTGACTACCCAAGACCAGAGCTTGAGAATACTGTGAACTATTTGGAAGCTGCTTCTCTGTCTTCCTCATTTCGTTCTTCTCCACGTCCAAG TAAACCGCTGAAGGTGGTTGTTGCTGGTGCAGGTTTGGCAGGTTTGTCCACAGCAAAGTATTTAGCAGATGCAGGCCATAAACCTGTGTTATTAGAAGCCAGGGATGTCCTTGGAGGAAAGGTTGCTGCATGGAAAGATGATGATGGAGA-3';

[0110] pTRV2-PDS-F1 (SEQ ID NO.15):

[0111] 5'-aaggttaccgaattctctagaTGCAAATTCTGTTATCCTGAGATCA-3';

[0112] pTRV2-PDS-R1 (SEQ ID NO. 16):

[0113] 5'-gagacgcgtgagctcggtaccTCTCCATCATCATCTTTCCATGC-3'.

[0114] The results are as follows: The VIGS vector constructed by selecting the target sequence shown in SEQ ID NO.14 cannot be silenced CtPDS Gene.

[0115] In summary, the silence provided by the present invention CtPDS The target nucleic acid molecule, VIGS silencing system and silencing method of the gene can effectively reduce the CtPDS The expression level of the gene can be measured, and the chlorophyll and carotenoids in the leaves of the ground melon can be increased, providing important technical support for the functional verification of the ground melon gene.

[0116] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A phytoene dehydrogenase from Cucurbita oleracea, characterized in that: The amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the phytoene dehydrogenase according to claim 1 PdS A gene characterized by Said PdS The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. Silence of claim 2 PdS Application of genes in reducing the chlorophyll content and / or carotenoid content in leaves of Gastrodia elata.

4. A silent claim 2 PdS A target nucleic acid molecule of a gene, characterized in that The nucleotide sequence of the target nucleic acid molecule is shown in SEQ ID NO.

13.

5. A silent claim as described in claim 2 PdS A VIGS viral vector containing a gene, characterized in that The VIGS viral vector comprises the target nucleic acid molecule of claim 4.

6. The VIGS viral vector according to claim 5, characterized in that The backbone vector of the VIGS viral vector includes a pTRV2 vector.

7. A silent claim as described in claim 2 PdS A genetically engineered bacterium, characterized in that The engineered bacteria include the VIGS viral vector described in claim 5 or 6.

8. A silent claim as described in claim 2 PdS The gene-infecting bacterial solution is characterized in that The infectious bacterial solution includes the engineered bacteria described in claim 7.

9. The infecting bacterial solution according to claim 8, characterized in that: The infection bacterial solution also includes an engineered bacterium containing an auxiliary vector; the auxiliary vector includes a pTRV1 vector; the OD of the infection bacterial solution is 600 The value is 0.8~1.

0.

10. A silent claim 2 PdS A genetic method, characterized in that include: The infective bacterial solution of claim 8 or 9 is injected into the apical meristem of the ground squash seedlings.

Images