Rice LOCOs10g35180 gene and application thereof in regulation and control of male sterility of rice
Through the CRISPR-Cas9 gene editing technology, the LOC_Os10g35180 gene was mutation, and the problems of long breeding cycle and single species during the male sterile breeding of rice were solved, efficient and stable male sterile rice breeding was achieved, and breeding efficiency and variety were improved. Reduced labor intensity.
Patent Information
- Application Number
- CN202411477448.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-22
- Publication Date
- 2025-01-07
AI Technical Summary
In the process of regulating male sterility in the prior art, there are problems such as long breeding cycle, low efficiency, single species and high labor intensity, which is difficult to meet the demand for high efficiency, stability and diversity of hybrid rice breeding.
Through CRISPR-Cas9 gene editing technology, site-directed mutation of LOC_Os10g35180 gene is regulated, delayed degradation of tapetum cells, abnormal development of pollen outer wall, achieve the acquisition of male sterile rice, and simplify the breeding process.
It significantly shortens the breeding cycle, improves breeding efficiency, enriches the types of sterile lines, reduces labor intensity, improves the economic benefits of breeding, and promotes the development of rice genetic engineering breeding.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and specifically relates to a rice LOC_Os10g35180 gene and an application thereof in regulating rice male sterility. Background Art
[0002] my country is a major rice producer, and rice is a major food crop. The development of hybrid rice is an important way to increase food production and solve food security issues. With the development of the times, the production model of hybrid rice is also constantly improving, from three-line matching (sterile line, restorer line, and maintainer line) to two-line hybridization (sterile line and restorer line), and now to the third generation of hybrid rice with genetically engineered male sterile lines as genetic tools, hybrid seed production has become more stable, convenient and efficient. Hybrid rice breeding will continue to face the challenges of population growth, reduced arable land area and environmental degradation, and the demand for related research is still urgent.
[0003] Anther is the male reproductive organ of rice, which contains two anther chambers, followed by pollen sacs and pollen grains. The normal development of anther is crucial to rice flowering and seed formation. The regulation of anther fertility involves multiple levels such as genes, hormones and the environment, and is the most critical link in hybrid rice production. How to regulate anthers and control the production of pollen grains is an important regulatory method for breeding male sterile rice.
[0004] Genes that affect rice male sterility can be divided into two categories according to the period of their action. One category is genes related to meiosis, anther tapetum degradation and pollen wall formation during pollen development, and the other category is genes related to pollen grain hydration germination and pollen tube elongation. The LOC_Os10g35180 gene encodes an ATP-binding cassette transporter OsABCG26. This protein is specifically expressed in rice anthers and pistils, and cooperates with OsABCG15 to regulate rice male reproduction. It is mainly responsible for the transport of lipid molecules from tapetum cells to anther wall layers, thus playing a role in the formation of rice anther cuticle and pollen exine, and plays an important role in pollen-pistil interaction by affecting pollen tube elongation. The osabcg26 mutant has normal vegetative reproduction, but abnormal floral organ development, showing male sterility, small and short anthers, and defects in tapetum cells, lipid wulbeta bodies, pollen exine and anther cuticle. Summary of the invention
[0005] The present invention provides a rice LOC_Os10g35180 gene and an application thereof in regulating rice male sterility. A male sterile line is obtained by site-directed mutation of the LOC_Os10g35180 gene using CRISPR-Cas9 gene editing technology, thereby shortening the breeding cycle and providing theoretical guidance for developing new rice male sterile lines.
[0006] The present invention is achieved through the following technical solutions:
[0007] A method for preparing male sterile rice using the LOC_Os10g35180 gene, wherein male sterile rice is obtained by regulating the delayed degradation of tapetum cells, promoting abnormal development of pollen exines, absence of an inner exine layer, and collapse of a columnar layer; the nucleotide sequence of the gene LOC_Os10g35180 is shown in SEQ ID NO.1.
[0008] The method of the present invention uses the LOC_Os10g35180 gene to prepare male sterile rice, which is achieved by site-specific editing of the LOC_Os10g35180 encoding gene using the CRISPR-Cas9 gene editing system. Specifically, the following steps are included:
[0009] (1) using the CRISPR / Cas9 system, selecting target sites according to the LOC_Os10g35180 gene; the target sites are Target1 and Target2;
[0010] The DNA sequence of Target1 is: ACGTGCTCCAGGGGCTCACGGGG;
[0011] The DNA sequence of Target2 is: AGACCATCTCATACTCGGCGCGG;
[0012] (2) constructing a CRISPR / Cas9 recombinant vector containing the target site sequence fragment; first using BsaI to digest the original vector WMC025 to obtain a linearized vector; then using primers LOC_Os10g35180-CZF and LOC_Os10g35180-CZR to perform PCR amplification on the T vector WMZ006 to obtain a purified PCR product; then recombining the obtained linearized vector backbone and the purified PCR product to obtain a complete target CRISPR / Cas9 recombinant vector;
[0013] The DNA sequence of the primer LOC_Os10g35180-CZF is:
[0014] CGCGCTGTCGCTTGTGTGCGTGCTCCAGGGGCTCACGGTTTTAGAGCTAGAAAT;
[0015] The DNA sequence of the primer LOC_Os10g35180-CZR is:
[0016] CTATTTCTAGCTCTAAAACCGCCGAGTATGAGATGGTCCGCCACGGATCATCTGCA;
[0017] (3) using Agrobacterium-mediated technology to introduce the obtained CRISPR / Cas9 recombinant vector into rice callus to obtain transgenic seedlings;
[0018] (4) Screening positive plants among the transgenic seedlings; extracting DNA from the young leaves of the plants, and then using primers HYG-4F and HYG-4R for PCR amplification, followed by electrophoresis detection. The plants with electrophoresis bands are positive plants, thus obtaining male sterile rice.
[0019] The sequence of HYG-4F is: CGACAGCGTCTCCGACCTGAT;
[0020] The HYG-4R sequence is: ATGTTGGCGACCTCGTATTGG.
[0021] The identification method of male sterile rice prepared by LOC_Os10g35180 gene is to design primers with the sequences of two editing sites for PCR amplification, sequence the amplified products, and select homozygous mutants with loss-of-function mutations at any target site as mutant plants. The primers used for PCR amplification are LOC_Os10g35180-A1-F1 and LOC_Os10g35180-A1-R1;
[0022] LOC_Os10g35180-A2-F1; LOC_Os10g35180-A2-R1;
[0023] The LOC_Os10g35180-A1-F1 sequence is: AGATGAAGAAGCAGGGAG;
[0024] The sequence of LOC_Os10g35180-A1-R1 is: GTGCGAAATGACAGAATG;
[0025] The LOC_Os10g35180-A2-F1 sequence is: AGTTACCTCCAGGCTCCA;
[0026] The sequence of LOC_Os10g35180-A2-R1 is: TGCTGACCCTCCTCTTCT.
[0027] The LOC_Os10g35180 gene of the present invention can be applied to rice genetic engineering breeding.
[0028] The LOC_Os10g35180 gene of the present invention can be used in regulating rice male sterility.
[0029] Compared with the prior art, the advantages and beneficial effects of the present invention are:
[0030] 1. Shorten the breeding cycle and improve breeding efficiency. The present invention uses CRISPR-Cas9 gene editing technology to site-directed mutate the LOC_Os10g35180 gene to directly obtain male sterile rice, avoiding the multi-generation self-pollination and backcrossing process of traditional hybrid breeding, significantly shortening the breeding cycle and improving breeding efficiency.
[0031] 2. Provide new gene resources and enrich the types of sterile lines: LOC_Os10g35180 gene editing successfully created a new male sterile rice line, enriched the types of rice male sterile lines, provided more options for hybrid rice breeding, and helped to cultivate new high-yield and high-quality rice varieties.
[0032] 3. The identification method is simple, and the results are stable and reliable: The male sterile rice identification method of the present invention detects and identifies the primers LOC_Os10g35180-A1-F1, LOC_Os10g35180-A1-R1; LOC_Os10g35180-A2-F1; LOC_Os10g35180-A2-R1 through positive plant sequence amplification and sequencing, which is simple to operate, and the results are stable and reliable, and is suitable for large-scale application in laboratories and fields, ensuring the accuracy and success rate of breeding.
[0033] 4. Reduce emasculation work and lower labor intensity: Male sterile rice has very few pollen grains and does not require emasculation, which reduces the labor intensity in the breeding process, saves human resources and time costs, and improves the economic benefits of breeding.
[0034] 5. Promote the development of genetic engineering breeding: The research of this invention has promoted the development of rice genetic engineering breeding. Through the precise regulation of rice traits through gene editing technology, it has brought revolutionary changes to crop breeding and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 The diagram shows the structure of the LOC_Os10g35180 gene and the target point mutation of gene knockout positive plants.
[0036] Figure 2 This is the physical map of the gene editing vector and the schematic diagram of the recombination.
[0037] Figure 3 The electrophoresis gel images of the target gene clone, where 1-3: gene LOC_Os10g35180 target site amplification WMZ006 product 586bp; M: DNA marker (2000). Figure 4 This is the physical map of the gene editing vector and the schematic diagram of the recombination.
[0038] Figure 5It is the electrophoresis diagram of colony PCR, where 1-12: single colony selection of LOC_Os10g35180 gene to verify the recombinant plasmid 1092bp; M: DNA marker (2000).
[0039] Figure 6 This is a diagram of callus induction culture.
[0040] Figure 7 This is a diagram of rooting culture.
[0041] Figure 8 Electrophoresis diagram of positive plant detection, where 1-24: positively detected seedlings; positive: positive control obtained by amplifying the plasmid.
[0042] Fig. 9 This is the peak diagram of the sequencing of the editing target.
[0043] Fig.10 This is a comparison of anther morphology between the editing group and the control group, with the control group on the left and the editing group on the right.
[0044] Fig.11 This is the pollen staining picture of the editing team.
[0045] Fig.12 This is a comparison of rice ear morphology between the editing group and the control group. DETAILED DESCRIPTION
[0046] The present invention is further described in detail below by way of examples. These examples are only used to illustrate the present invention and do not limit the protection scope of the present invention.
[0047] Example
[0048] 1 Materials and methods
[0049] 1.1 Test materials
[0050] Rice varieties, strains, vector systems, enzymes, and reagents tested.
[0051] Escherichia coli DH5α competent cells and Agrobacterium tumefaciens EHA105 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.;
[0052] BSaⅠ enzyme and other enzymes and various test kits were purchased from Nanjing Novozyme Biotechnology Co., Ltd. (China);
[0053] Vector WMC025, T vector WMZ006, and transformation receptor Zhonghua 11-wimi-japonica rice were provided by Weimi Biotechnology (Hainan) Co., Ltd., and other materials were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. and other companies.
[0054] 1.2 Gene sequence acquisition
[0055] Gene cloning primers
[0056] In the present invention, the primers QC1-F, QC4-R, HYG-F1, and HYG-R1 are provided by Weimi Biotechnology (Hainan) Co., Ltd. and are the fixed detection primers for the vector WMC025.
[0057] Table 1 List of PCR amplification primers
[0058]
[0059] 1.3 Target selection and sgRNA design analysis
[0060] Gene target primers
[0061] Target design principles: 1) The knockout site is in the coding (CDS) region and preferably at the front end of the protein or in an important functional domain region; 2) Try to cover a higher proportion of transcripts; 3) There is no off-target or the off-target is located in the intergenic region; 4) Prefer targets with higher editing efficiency; 5) The sequence has a relatively balanced GC content and is not prone to forming secondary structures.
[0062] Based on the above principles, the CRISPR-P website ( http: / / crispr.hzau.edu.cn / CRISPR2 / ) is used for design, and targets with high target scores, low off-target rates, and appropriate positions are selected. For the LOC_Os10g35180 gene, two targets ACGTGCTCCAGGGGCTCACGGGG and AGACCATCTCATACTCGGCGCGG are selected. They have low repeatability and low off-target rates (the highest off-target rates of the targets are 0.217 and 0.383 respectively) on the genome of Zhonghua 11-wimi-japonica rice, and their positions are靠前 (at 266-288 bp and 497-519 bp of this gene respectively), and the GC content is moderate, which are suitable as targets for gene knockout. The specific target positions and partial mutations are as Figure 1 shown.
[0063] Sequence NO.1 of LOC_Os10g35180:
[0064]
[0065] 1.4 CRISPR / Cas9 vector construction
[0066] (1) Vector construction primers
[0067] WMC025 contains the lethal gene CCDB, and adding CCDB to the vector can avoid insufficient enzyme digestion that leads to a large amount of uncut plasmid being transferred into E. coli. A linearized vector can be obtained after digestion with BSaⅠ enzyme.
[0068] Table 2 Vector backbone enzyme digestion system
[0069]
[0070] After enzyme digestion at 37°C according to the system in Table 2, the stock solution was directly recovered using the DC 301 PCR gel recovery kit, and finally 40 μl EB elution solution was added to obtain the linearized vector, such as Figure 2 shown.
[0071] LOC_Os10g35180-CZF and LOC_Os10g35180-CZR were used as primers to amplify T vector WMZ006 to obtain the target gene. The amplification system is shown in Table 3.
[0072] Table 3 PCR amplification system
[0073]
[0074] The PCR amplification was performed with this system, with a pre-denaturation at 95°C for 3 minutes; then a denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for a total of 30 cycles, and a final extension at 72°C for 5 minutes, and finally slowly cooled to 16°C to obtain the target fragment. After the reaction was completed, 5 μl of the PCR product was taken for agarose gel electrophoresis, and a band of 586 bp was obtained, such as Figure 3 Then, the stock solution was directly recovered using the DC 301 PCR gel recovery kit to obtain the purified PCR product.
[0075] The linearized vector backbone obtained above and the purified PCR product were recombined. The recombinant system is shown in Table 4. The recombinant process is as follows: Figure 4 shown.
[0076] Table 4 Vector recombination system
[0077]
[0078] The above system was placed at 50°C for 15 minutes; then cooled to 4°C for several minutes to form two tandem promoter-target-grna expression cassettes, thereby obtaining a complete target vector, which was then transformed with DH5α E. coli competent cells and cultured at 37°C until the next day. The next day, the obtained E. coli plate was tested for bacteria, and QC1-F / QC4-R was used as primers. The 12 selected monoclonal clones were used as templates to amplify 20 μl of the system. The 1092 bp band was obtained as the correct plaque. The colony PCR electrophoresis diagram is shown in the figure below. Figure 5 As shown, the successful construction of the target site can be confirmed by Sanger sequencing of the plaque.
[0079] Figure 5 Zhong 1-24: LOC_Os10g35180 gene single colony selection verification recombinant plasmid 1092bp; M: DNA marker (2000), by Figure 5 It can be seen that the bands numbered 1-24 are relatively bright and clear, indicating the accuracy of the detection.
[0080] The correct plaques were propagated, and after the plasmid was extracted using a plasmid extraction kit, Agrobacterium was transformed using EHA05 competent cells and cultured at 28°C for 2 days.
[0081] 1.5 Genetic transformation
[0082] (1) Agrobacterium infection
[0083] Prepare the infection solution, use a pipette to absorb the infection solution to wash off the Agrobacterium on the plate, and obtain the Agrobacterium suspension for co-cultivation and transformation of rice.
[0084] Select a sufficient amount of callus tissue (in good condition, bright yellow in color, round and hard in texture, and preferably with a particle diameter of about 3mm), place it in a 100ml sterile conical flask, add an appropriate amount of Agrobacterium suspension (make sure there is enough bacterial liquid in contact with the material), and place it at room temperature for infection for 20 minutes, shaking it from time to time. Pour out the bacterial liquid, place the callus tissue on a sterile filter paper to absorb the excess bacterial liquid, and then transfer it to a solid co-culture medium covered with a layer of sterile filter paper, and culture it in the dark at 26℃ for 3 days. Figure 6 shown.
[0085] (2) Screening
[0086] After 3 days of co-culture, the callus tissue needs to be cleaned. Use a 1ml blue pipette tip to sow the callus on the co-culture medium into a sterilized triangular flask, add sterile water to rinse both sides, and rinse once with sterile water containing 500ul / L carbenicillin for the third time. After the excess water is sucked off by the pipette, the callus is transferred to sterile filter paper and the water on the callus is blown dry by the wind of the clean bench. The blowing time is controlled at about 30 minutes. After the callus is blown dry, it is transferred to the screening medium for screening culture. The culture conditions are 28-30 degrees and dark culture. The screening time is 3-4 weeks.
[0087] (3) Differentiation
[0088] After one month of screening, bright yellow positive callus can be seen growing. At this time, the positive callus can be picked and placed on the differentiation medium for differentiation and regeneration. 16 positive callus are placed on each differentiation dish and placed in a 28-30 degree greenhouse for light culture. Green spots will emerge from the callus in about 10 days, and seedlings will differentiate after about 10 days.
[0089] (4) Rooting
[0090] When the differentiated seedlings grow to about 2-3cm and have obvious roots, they can be transferred to the rooting medium to grow. The rooting medium should be poured into a relatively high bottle or tube, such as Figure 7 As shown, the seedlings will have enough space to grow taller after rooting. The rooting culture conditions are 28-30 degrees and sterile light culture.
[0091] 1.6 Editing plant identification
[0092] About 1 cm of young leaves were cut from the selected seedlings, and DNA was extracted using the CTAB method. The DNA samples were amplified using HYG-4F / HYG-4R. The electrophoresis band of 639 bp obtained by electrophoresis at a power of 180 V was a positive seedling, and the product amplified using the plasmid as a template was the positive control.
[0093] Table 5 Positive detection amplification system
[0094]
[0095] The PCR amplification was performed with this system, with a pre-denaturation at 95°C for 3 minutes; then a cycle of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C, for a total of 30 cycles, with a final extension at 72°C for 5 minutes, and finally slowly cooling to 16°C to obtain the target fragment. The electrophoresis results are as follows Figure 8 shown.
[0096] Figure 8 In the electrophoresis diagram of positive plant detection, 1-24 are all positive test seedlings, and positive is the positive control obtained by amplifying the plasmid, which is used as the criterion for judging whether the plasmid has been transferred into the plant. Figure 8 It can be seen that the seedlings No. 1-24 used for detection all showed positive results, indicating that the method of the present invention is accurate in detection and has stable results.
[0097] Then, the DNA extracted from the CTAB was used as a template, and LOC_Os10g35180-A1-F1, LOC_Os10g35180-A1-R1; LOC_Os10g35180-A2-F1, LOC_Os10g35180-A2-R1 were used as primers. The 20 μl system was amplified according to the TD5 program. The amplified product was sent to a sequencing company for sequencing to obtain the editing target sequencing peak map to determine the editing status of the plant gene target site. Fig. 9 shown.
[0098] Table 6 TD5 amplification program
[0099]
[0100]
[0101] According to the results of Sanger sequencing, editing occurred at the SG1 / SG2 site, proving that the target site was effective. A single peak indicates that the gene mutated to a homozygous mutation at the target site (i.e., the same mutation occurred at the same site on both chromosomes), and a double peak indicates that the gene mutated to a heterozygous mutation at the site (i.e., different mutations occurred at the same site on both chromosomes or only one chromosome mutated at the site).
[0102] Because a mutation in either of the two targets SG1 / SG2 can be considered as editing, only SG1 (ACGTGCTCCAGGGGCTCACGGGG) was tested for the LOC_Os10g35180 gene when detecting edited seedlings. Fig. 9 Only the sequenced part is shown. A total of 12 plants were tested, among which in plant A, Fig. 9 -A indicates that the plant lacks a single base C cytosine at the SG1 site, and the offspring are stable homozygous for the fragment deletion.
[0103] 1.7 Comparison between edited plants and normal plants
[0104] (1) Comparison of rice anther morphology
[0105] The positive rice plants obtained in 1.6 (edited group) and the rice plants not treated with editing (control group) were cultivated under the same conditions, and the pollen conditions of the two groups of plants were observed when they bloomed. Fig.10 .
[0106] from Fig.10It can be seen that the anthers of the control group on the left are very full and light yellow. The one on the right is the edited plant obtained by the method of the present invention, whose anthers and pollen are abnormally developed and appear whitish. The pollen is then stained for detection (such as Fig.11 As shown in the figure, the pollen content was very low, making it difficult to pollinate normally, and male sterile plants were obtained, indicating that the LOC_Os10g35180 gene has the function and role of regulating rice male sterility.
[0107] (2) Comparison of rice ear morphology
[0108] The positive rice plants obtained in 1.6 (edited group) and the rice plants not treated with editing (control group) were cultivated under the same conditions, and the rice ears of the two groups of rice plants were observed when they were ripe. Fig.12 .
[0109] Fig.12 The left side is the wild-type control plant, and the right side is the edited plant. Fig.12 It can be seen that there is no obvious difference in ear shape between the two, but the ears of the edited plants are shriveled, and the spikelets cannot bear fruit normally and are aborted.
[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A method for preparing male sterile rice using the LOC_Os10g35180 gene, characterized in that: By regulating the delayed degradation of tapetum cells, the abnormal development of pollen exine is promoted, the inner layer of the exine is absent, and the columnar layer collapses, thereby obtaining male sterile rice; the nucleotide sequence of the gene LOC_Os10g35180 is shown in SEQ ID NO.
1.
2. A method for preparing male sterile rice using the LOC_Os10g35180 gene according to claim 1, characterized in that: The LOC_Os10g35180 encoding gene was edited at the site using the CRISPR-Cas9 gene editing system.
3. The method for preparing male sterile rice using the LOC_Os10g35180 gene according to claim 2, characterized in that: The following steps are involved: (1) using the CRISPR / Cas9 system, selecting target sites according to the LOC_Os10g35180 gene; the target sites are Target1 and Target2; The DNA sequence of Target1 is: ACGTGCTCCAGGGGCTCACGGGG; The DNA sequence of Target2 is: AGACCATCTCATACTCGGCGCGG; (2) constructing a CRISPR / Cas9 recombinant vector containing the target site sequence fragment; first using BsaI to digest the original vector WMC025 to obtain a linearized vector; then using primers LOC_Os10g35180-CZF and LOC_Os10g35180-CZR to perform PCR amplification on the T vector WMZ006 to obtain a purified PCR product; then recombining the obtained linearized vector backbone and the purified PCR product to obtain a complete target CRISPR / Cas9 recombinant vector; The DNA sequence of the primer LOC_Os10g35180-CZF is: CGCGCTGTCGCTTGTGTGCGTGCTCCAGGGGCTCACGGTTTTAGAGCTAGAAAT; The DNA sequence of the primer LOC_Os10g35180-CZR is: CTATTTCTAGCTCTAAAACCGCCGAGTATGAGATGGTCCGCCACGGATCATCTGCA; (3) using Agrobacterium-mediated technology to introduce the obtained CRISPR / Cas9 recombinant vector into rice callus to obtain transgenic seedlings; (4) Screening positive plants among the transgenic seedlings; extracting DNA from young leaves of the plants, and then using primers HYG-4F and HYG-4R for PCR amplification, followed by electrophoresis detection. Plants with electrophoresis bands are positive plants, thereby obtaining male sterile rice; The sequence of HYG-4F is: CGACAGCGTCTCCGACCTGAT; The HYG-4R sequence is: ATGTTGGCGACCTCGTATTGG.
4. A method for identifying male sterile rice produced by LOC_Os10g35180 gene, characterized in that: Primers were designed based on the sequences of the two editing sites for PCR amplification, the amplified products were sequenced, and homozygous mutants with loss-of-function mutations at any target site were selected as mutant plants.
5. The method for identifying male sterile rice prepared by the LOC_Os10g35180 gene according to claim 4, characterized in that: The primers used for the PCR amplification are LOC_Os10g35180-A1-F1, LOC_Os10g35180-A1-R1; LOC_Os10g35180-A2-F1; LOC_Os10g35180-A2-R1; The LOC_Os10g35180-A1-F1 sequence is: AGATGAAGAAGCAGGGAG; The sequence of LOC_Os10g35180-A1-R1 is: GTGCGAAATGACAGAATG; The LOC_Os10g35180-A2-F1 sequence is: AGTTACCTCCAGGCTCCA; The sequence of LOC_Os10g35180-A2-R1 is: TGCTGACCCTCCTCTTCT.
6. Use of the LOC_Os10g35180 gene according to claim 1 in rice genetic engineering breeding.
7. Use of the LOC_Os10g35180 gene according to claim 1 in regulating rice male sterility.