Fusarium oxysporum double-target rapid visual in-situ detection kit, detection method and application

Abstract

The invention relates to a fusarium oxysporum double-target rapid visual in-situ detection kit, a detection method and application, a crude extract of a sample obtained through physical crushing can be directly used for RAA isothermal amplification, amplification targets respectively correspond to a conserved sequence of a fusarium fungus ITS rRNA gene and a specific sequence of a fusarium oxysporum cytochrome P450 enzyme gene, and the specific sequence of the fusarium oxysporum cytochrome P450 enzyme gene corresponds to the specific sequence of the fusarium oxysporum cytochrome P450 enzyme gene. The RAA amplification product is used as a DNA target for a CRISPR / Cas12a detection system. Aiming at a conserved region of a fusarium oxysporum cytochrome P450 enzyme gene, the length of an amplified target sequence of the fusarium oxysporum cytochrome P450 enzyme gene is 120bp, and the used specific RAA primer and crRNA are respectively Fo-F / Fo-R and Fo-crRNA. The advantage of setting two detection targets and two different result reading strategies in the same onsite pathogen detection reaction is that the reliability and flexibility are enhanced, so that more accurate and timely decisions can be made under different onsite conditions.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and in particular to a dual-target rapid visualization in-situ detection kit for Fusarium oxysporum, a detection method and an application thereof. Background Art

[0002] Fusarium oxysporum is a soil-borne pathogenic fungus with a wide host range and high pathogenicity. It is listed as one of the top ten plant pathogenic fungi in the world. The fungus can infect more than 100 crops with important economic value, such as cotton, soybean, watermelon, banana, tomato and alfalfa, causing wilt and root rot. After infecting plants, they usually show symptoms of wilting, yellowing, withering and even death, which seriously affects crop yield and quality. At present, the most economical and effective prevention and control method for soil-borne diseases such as crop wilt and root rot caused by Fusarium oxysporum is the application of disease-resistant varieties. However, due to the high differentiation of pathogenicity of the pathogen, there are problems such as lack of variety resistance. However, the use of soil improvement, soil disinfection, application of chemical agents, application of biocontrol agents and other prevention and control measures cannot effectively control the occurrence of this soil-borne disease. Therefore, it is of great significance to correctly identify soil-borne diseases caused by Fusarium oxysporum, understand their occurrence and epidemic patterns, conduct rapid diagnosis in the early and early stages of the disease, and take effective prevention and control measures in a timely manner to effectively prevent and control the occurrence of soil-borne diseases and reduce production losses. In order to effectively monitor and warn the spread of wilt and root rot caused by Fusarium oxysporum, it is particularly important to establish a set of rapid detection technologies with high sensitivity, strong specificity and portability.

[0003] The morphological diversity and environmental changes of Fusarium pathogens make accurate identification difficult, and the process is highly dependent on expert experience and is time-consuming and labor-intensive. These methods also have difficulty distinguishing different types of Fusarium fungi in mixed samples. Relatively speaking, modern molecular biology methods based on genetic testing provide a faster and more accurate alternative, overcoming many limitations of traditional morphological and culture methods, thus showing higher efficiency and reliability in practical applications.

[0004] Among the visualization gene detection methods based on clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein (Cas) systems, Cas12a, as a CRISPR effector, has attracted much attention due to its unique mechanism. Cas12a can bind and cut the target double-stranded DNA (dsDNA) under the guidance of guide RNA (crRNA), and exhibits the activity of non-specific cutting of single-stranded DNA (ssDNA) after binding to the target, thus standing out among many CRISPR effectors. By utilizing this characteristic, ssDNA reporter molecules labeled with fluorescent groups, black hole quenchers or biotin can be used to determine the presence of target DNA through fluorescent signals or colloidal gold chromatography immunoassay strips. The visualization gene detection technology based on the CRISPR / Cas12a system is particularly suitable for application in resource-limited environments because of its advantages of high specificity, high sensitivity, low cost, rapidity and portability, and shows great potential in the agricultural field, especially in the field for real-time detection of plant pathogens and diseases.

[0005] Fusarium oxysporum can survive the winter and summer in the soil and uncomposted bacterial fertilizer in the form of mycelium, conidia, and thick-walled spores, and can survive for a long time. The thick-walled spores in the soil can survive for 8-10 years. It can be spread over long distances through infected seedlings, soil, etc., and spread rapidly in greenhouses through irrigation water, agricultural tools, etc. Detection of Fusarium oxysporum in soil, rainwater and plant rhizome tissues is the key to early diagnosis and effective prevention and control of diseases. Genetic detection technology based on the CRISPR / Cas12a system can enhance the sensitivity and specificity of detection by amplifying the target DNA sequence. The amplification of the target DNA sequence significantly increases the number of target gene fragments of the pathogen, so that it can be detected even in the early stage of pathogen infection, thereby reducing false negative results. This technology can accurately detect trace pathogens in complex plant tissue samples, which is crucial for early disease detection and on-site instant diagnosis, and helps to take prevention and control measures in a timely manner, reduce agricultural losses, and enhance the application value of this technology in a diversified agricultural environment. Through searching, the following patent disclosures related to the patent application of the present invention were found:

[0006] 1. The PCR-based molecular identification technology of Fusarium oxysporum in the prior art (such as patent publication CN116855632A, a primer for detecting Fusarium oxysporum and its detection method) is to use DNA polymerase and specific PCR primer pairs to specifically amplify the strain genome gDNA in a reaction buffer containing nucleotides. The amplification reaction includes denaturation (heating the reaction system to 94°C-98°C to unwind the DNA double strands and produce two single-stranded templates), annealing (lowering the temperature to 50°C-65°C so that the primers can complement the target DNA sequence to form a primer-template complex), and extension (increasing the temperature to the optimal working temperature of DNA polymerase 92°C, and the DNA polymerase synthesizes a new DNA chain along the primer-template complex). The above three steps (denaturation, annealing, and extension) are repeated 20-40 times to exponentially amplify the target DNA sequence, and finally keep it at the extension temperature for a period of time to ensure that all unfinished DNA chains in the last round of PCR are fully extended. Through these steps, PCR can amplify a sufficient number of target DNA fragments from a very small genomic gDNA sample, providing sufficient nucleic acid material for further detection or sequencing. However, it has the following defects: (1) It has high requirements for the sample size and purity of genomic gDNA; (2) It relies on expensive temperature control instruments and cannot be tested in the field, resulting in high detection costs; (3) It takes 0.5-1.0 hours to extract and purify genomic gDNA, 1.5-2.0 hours for PCR reaction, and 0.5-1.0 hours for gel electrophoresis imaging of the results. The experimental steps are cumbersome and the cycle is long.

[0007] 2. A rapid detection method for plant stem base rot pathogens based on RPA-CRISPR / Cas12a in the prior art (application number CN202410114306.3, unauthorized), using the nucleic acid replication mechanism of T4 bacteriophage, under the joint action of multiple enzymes and proteins, can complete the RPA amplification of the target gene within 30 minutes with the assistance of a simple heat source (37°C-43°C). The DNA enzyme activity of CRISPR Cas12a targeted recognition and cutting of the target gene (double-stranded DNA) completes the high specific recognition of the target gene at the single base level. After targeted cutting of double-stranded DNA, Cas12a is stimulated to obtain the activity of cutting non-target single-stranded DNA, realizing fluorescence detection. However, it has the following defects: (1) The detection target is for the Fusarium oxysporum stem base rot pathogen; we are targeting the Fusarium oxysporum species including stem base rot and root rot pathogens for detection. (2) This technology is based on the crude nucleic acid extraction technology of alkaline lysis, which increases the reagent cost; (3) The RPA isothermal amplification technology used in this technology was developed by the British company TwistDx. The use of imported reagents increases the detection cost. The RAA isothermal amplification technology we used is an upgraded version of RPA developed by a Chinese team. It retains all the technical advantages of RPA and is more cost-effective; (4) This technology is limited to fluorescence detection. When testing plant samples, since this patent uses a crude extraction method without nucleic acid purification, the crude extract may contain substances in plant cells such as chlorophyll. Chlorophyll will emit pink fluorescence under blue-violet light, which will interfere with the determination of the results.

[0008] 3. A one-tube detection system for tomato-specific CRISPR of Fusarium oxysporum in the prior art (application number CN202311777720.4, unauthorized), S1. Constructing a plasmid pUC57-Fol_SIX1 containing a conservative sequence of Fol_SIX1 of tomato-specific Fusarium oxysporum; S2. Combining the pUC57-Fol_SIX1 plasmid with template DNA to construct CRISPR-Cas protein and sgRNA; S3. Preparing Cas12bsgRNA by in vitro transcription and purification of CRISPR-Cas protein and sgRNA; S4. DNA binding, constructing a double-stranded RNA molecule of Cas12bsgRNA and Fol_SIX1-sgRNA; S5, introducing the double-stranded RNA molecule into cells, and performing in vitro transcription and purification of Cas12bsgRNA; S6, performing quantitative PCR detection on the transcription product to screen out the best LAMP primer; S7, combining the best LAMP primer with template DNA, and establishing a CRISPR one-tube detection system; S8, applying the CRISPR one-tube detection system to the tomato-specific CRISPR one-tube detection experiment of Fusarium oxysporum, which is fast, easy to operate, and has high detection sensitivity. However, it has the following defects: (1) The detection target is tomato-specific oxysporum; we target the species of Fusarium oxysporum, including but not limited to tomato-specific oxysporum. (2) Our dual detection of two targeted genes can avoid false negatives. (3) The main disadvantage of LAMP amplification (loop-mediated isothermal amplification) is not as good as RAA amplification in terms of its operational complexity and equipment dependence. Specifically, LAMP requires 6 pairs of primers, while RAA only requires 1 pair of primers; LAMP requires a constant temperature device at 65°C, while RAA can be amplified at human body temperature of 35°C-37°C. In addition, LAMP usually takes 30-60 minutes to complete amplification, while RAA can be completed within 20 minutes. The complexity and high cost of primer design also make LAMP operation more difficult, while RAA is simpler and suitable for rapid on-site detection. (4) Its detection time is about 45 minutes, and the detection sensitivity is less than 100 copies per reaction. Our sensitivity is even lower. The sensitivity of our CRISPR fluorescence detection system can reach 0.6 copies per 30μL reaction system after 1 hour of reaction, and the sensitivity of the CRISPR test strip detection system can reach 12 copies per 60μL reaction system after 30 minutes of reaction.

[0009] By comparison, the patent application of the present invention is essentially different from the above-mentioned patent publications. Summary of the invention

[0010] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a dual-target rapid visualization in situ detection kit, detection method and application of Fusarium oxysporum. In order to effectively deal with the hazards of Fusarium oxysporum, the present invention develops a field rapid visualization in situ detection method based on the conservative region of the ITS rRNA gene of the Fusarium genus and the specific gene of Fusarium oxysporum. From the broad-spectrum detection at the level of Fusarium genus to the specific detection of the target species, the monitoring scope is expanded, which is more advantageous than the single pathogen and single-point method. This method is particularly advantageous for operators without technical background and experience because it provides double-check results and minimizes the risk of false positives or false negatives due to human errors. Therefore, the present invention improves the accuracy and reliability of the results and makes it easier for agricultural practitioners to use.

[0011] The technical solution adopted by the present invention to solve the technical problem is:

[0012] A dual-target rapid visualization in situ detection kit for Fusarium oxysporum, comprising

[0013] RAA Primer Pair 1:

[0014] Fus-F: CTTTCAACAACGGATCTCTTGGTTCTGGCATC

[0015] Fus-R:GCAATGTGCGTTCAAAGATTCGATGATTCACT

[0016] Specific crRNA 1:

[0017] Fus-crRNA:

[0018] GGGAAUUUCUACUGUUGUAGAUGCUGCGUUCUUCAUCGAUGC

[0019] RAA primer pair 2:

[0020] Fo-F:TTGAGGTTTTGGGATCACCGCAAGAGCCGT

[0021] Fo-R:GGAGAATGGAGTGGATTGGACTATGAAGAC

[0022] Specific crRNA II:

[0023] Fo-crRNA:

[0024] GGGAAUUUCUACUGUUGUAGAUCAGAAGUUGACGCUGAAU.

[0025] In addition, it also includes procedures and primers for constructing crRNA 1 and crRNA 2

[0026] crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT

[0027] Fus-cr-R: GCATCGATGAAGAACGCAGCATCTACAACAGTAGAAATT

[0028] Fo-cr-R:ATTCAGCGTCAACTTCTGATCTACAACAGTAGAAATT.

[0029] Furthermore, a ssDNA reporter 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3' was included.

[0030] Moreover, the reaction system includes the RAA reaction system and the CRISPR / Cas12a reaction system.

[0031] Moreover, the RAA reaction system comprises: recombinase, 2x reaction buffer, 10 μM upstream primer and 10 μM downstream primer, RAA detection template, and 280 mM magnesium acetate.

[0032] Moreover, the CRISPR / Cas12a reaction system is: 1xNEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter molecule 5'FAM-TTATT-BHQ1-TTATT-Biotin 3', 1U / μLRNase inhibitor.

[0033] A dual-target rapid visualization in situ detection method for Fusarium oxysporum, wherein the reaction system includes RAA detection and CRISPR / Cas12a detection;

[0034] ⑴RAA detection: add 25 μL of 2x reaction buffer, 2 μL of 10 μM RAA primer pair 1 or RAA primer pair 2, 5 μL of RAA detection template and 2.5 μL of 280 mM magnesium acetate to the recombinant enzyme dry powder, mix the reaction mixture thoroughly, and immediately incubate at 35°C-43°C for 10-30 minutes to obtain RAA amplification products;

[0035] ⑵CRISPR / Cas12a detection:

[0036] 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 25nM-50nM FnCas12a, 125nM-1000nM specific crRNA 1 or specific crRNA 2, 50nM-250nM triple-labeled ssDNA reporter molecule; 5'FAM-TTATT-BHQ1-TTATT-Biotin 3' and 1U / μL RNase inhibitor;

[0037] ⑶ Real-time fluorescence naked eye observation: add 2 μL RAA amplification product, incubate at 39°C for 5-30 minutes; irradiate with 470nm LED light, observe the fluorescence results with naked eyes, and the presence of fluorescence indicates the presence of Fusarium oxysporum;

[0038] (4) Colloidal gold chromatography immunoassay test strip detection: add 2 μL RAA amplification product and react at 39°C for 30 minutes; mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube, insert Cas12 / 13 special nucleic acid detection test strip and incubate at room temperature for 3-5 minutes. If the control line is displayed, the detection is effective, the detection line appears when the sample contains Fusarium oxysporum, and the absence of the detection line means that the sample does not contain Fusarium oxysporum;

[0039] The primer pair used for the RAA amplification is:

[0040] RAA Primer Pair 1:

[0041] Fus-F: CTTTCAACAACGGATCTCTTGGTTCTGGCATC

[0042] Fus-R:GCAATGTGCGTTCAAAGATTCGATGATTCACT

[0043] Specific crRNA 1:

[0044] Fus-crRNA:

[0045] GGGAAUUUCUACUGUUGUAGAUGCUGCGUUCUUCAUCGAUGC

[0046] Primer pair 2:

[0047] Fo-F:TTGAGGTTTTGGGATCACCGCAAGAGCCGT

[0048] Fo-R:GGAGAATGGAGTGGATTGGACTATGAAGAC

[0049] Specific crRNA II:

[0050] Fo-crRNA:

[0051] GGGAAUUUCUACUGUUGUAGAUCAGAAGUUGACGCUGAAU;

[0052] Furthermore, the method for obtaining the template for RAA detection is as follows: a sample is placed in a centrifuge tube containing zirconium oxide beads, sterile water without nuclease is added to wet the sample and the zirconium oxide beads, and the cell lysate is obtained by oscillating with an oscillator for 10 minutes or grinding with a pestle to obtain a cell lysate as a template for RAA detection.

[0053] Furthermore, it also includes programs and primers for constructing crRNA 1 and crRNA 2, and the sequences of primer pairs crRNA-F / Fus-cr-R and crRNA-F / Fo-cr-R are:

[0054] crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT

[0055] Fus-cr-R: GCATCGATGAAGAACGCAGCATCTACAACAGTAGAAATT

[0056] Fo-cr-R:ATTCAGCGTCAACTTCTGATCTACAACAGTAGAAATT.

[0057] The advantages and positive effects achieved by the present invention are:

[0058] 1. The present invention provides a bead milling lysis method suitable for crude extraction of pathogen nucleic acids from plant, soil and rainwater samples. This method is inexpensive (no chemical reagents are required), reusable, easy to store and transport, and can achieve cell lysis of field samples to obtain a crude nucleic acid extract suitable for RAA amplification within 10 minutes.

[0059] 2. The RAA isothermal amplification technology used in the present invention is an upgraded version of RPA developed by a Chinese team. It retains all the technical advantages of RPA (low temperature and short time required) and is more cost-effective ( Figure 3 and Figure 5 ); Get rid of the dependence on imported test kits. Under the conditions optimized by this patent, the detection limit is as low as 10 -1 aM level.

[0060] 3. The present invention uses RAA amplification products as DNA targets for CRISPR / Cas12a detection systems. The Cas12a-crRNA complex recognizes the protospacer adjacent motif (PAM) in the amplicon and specifically binds to the target strand of crRNA. RAA specific amplification and specific recognition of the CRISPR / Cas12a system provide dual guarantees for the specificity of the system.

[0061] 3. The detection of the present invention utilizes a triple-labeled probe or a strategy of mixing two double-labeled probes, which can present two visual results for the same experiment. On the basis of saving detection costs and time costs, double verification of the same experimental results is completed, which enhances detection flexibility and result reliability, allowing more accurate and timely decisions to be made under different field conditions.

[0062] 4. The advantage of setting up two different gene targets for dual detection in the on-site detection reaction of the Fusarium oxysporum pathogen of the present invention is that it enhances the reliability of field detection results and helps to make more accurate and timely decisions.

[0063] 5. The sensitivity of the kit of the present invention can reach aM level, which meets the requirements of on-site rapid detection. At the same time, the detection method is simple to operate, does not require precision instruments, has a short cycle, high efficiency, and has high specificity and accuracy.

[0064] 6. Compared with conventional Fusarium detection, the kit of the present invention has the advantages of short time, easy operation, and can complete the detection in the field. The combination of RAA and CRISPR / Cas12a system makes the detection fast, efficient, sensitive and accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 Photos of the consumables required for the bead milling lysis method of the present invention; wherein A is a photo of zirconia beads of different diameters.

[0066] B is a schematic diagram of the consumables of the bead milling lysis method using zirconia beads and grinding pestle.

[0067] Figure 2 Feasibility analysis diagram of bead milling lysis method; Figure 2 A in the middle is the gel electrophoresis result of the genome extracted by different lysis methods for RAA amplification. Lane: 1. D2000 molecular weight standard (Tiangen ); 2. Negative control, i.e., the centrifugal column treatment results of wheat leaves not inoculated with Fusarium oxysporum; 3. Alkaline lysis method, i.e., using Kangwei Century The results of the commercial kit Cat.CW3011 on wheat leaves inoculated with Fusarium oxysporum; 4. The bead milling lysis method optimized by the present invention; 5. The centrifugal column method, i.e., using Tiangen The results of treating wheat leaves inoculated with Fusarium oxysporum using the commercial kit Cat.DP350. Figure 2 B in the figure shows the RAA amplification results with different oscillation cleavage times. Lane: 1. D2000 molecular weight standard (Tiangen ); 2.2 minutes; 3.5 minutes; 4.8 minutes; 5.10 minutes; 6. Centrifugal column method, i.e. using Tiangen The results of treating wheat leaves inoculated with Fusarium oxysporum using the commercial kit Cat.DP350.

[0068] Figure 3 The RAA reaction conditions of the present invention are optimized. Figure 3 (A) Under 39°C incubation, the longer the reaction time, the darker the amplified band, which means more products and higher efficiency. Figure 3 (B) Under incubation at 35℃-43℃, the higher the temperature, the darker the amplification band, which means more products and higher efficiency. At the same time, it is further confirmed that at the same temperature, the longer the reaction time, the darker the target band, which means the increase in the amount of product.

[0069] Figure 4 Specificity for RAA amplification. Figure 4 (A) Specificity of RAA primers Fus-F / Fus-R for detecting Fusarium fungi; Figure 4 (B) Specificity of RAA primers Fo-F / Fo-R for Fusarium oxysporum detection. Lane 1: Fusarium pseudoverticillium; Lane 2: Fusarium graminearum; Lane 3: Fusarium oxysporum; Lane 4: Rhizoctonia solani; Lane 5: Botrytis cinerea; Lane 6: Alternaria solani; Lane 7: negative control.

[0070] Figure 5 is the sensitivity of RAA amplification of the present invention.

[0071] Figure 6 Optimize the dosage of key components in the CRISPR / Cas12a system detection reaction.

[0072] Figure 7The specificity of the CRISPR test strip (i.e., RAA-Cas12a-LFS detection method) for detecting Fusarium fungi (Fus target detection) and Fusarium oxysporum (Fo target detection). Test strip NC: negative control; test strip 1: Fusarium oxysporum strain BD-7, which causes corn stalk rot; test strip 2: Fusarium oxysporum strain BD-108, which causes corn stalk rot; test strip 3: Fusarium oxysporum strain TJ-3, which causes tomato stem base rot; test strip 4: Fusarium oxysporum strain TJ-27, which causes tomato root rot; test strip 5: Fusarium oxysporum, which causes cucumber wilt; test strip 6: Fusarium pseudoverticillium; test strip 7: Fusarium graminearum; test strip 8: Rhizoctonia solani; test strip 9: Botrytis cinerea; test strip 10: Alternaria solani, test strip 11: Colletotrichum spinulosum.

[0073] Figure 8 The sensitivity of the CRISPR test strip (i.e., RAA-Cas12a-LFS assay) for detecting Fusarium (Fus target detection) and Fusarium oxysporum (Fo target detection).

[0074] Fig. 9 Chlorophyll interferes with the naked eye interpretation of fluorescence signals in CRISPR fluorescence detection (i.e., RAA-Cas12a-Fluo detection method).

[0075] Fig.10 Real-time visual results of CRISPR fluorescence detection (i.e., RAA-Cas12a-Fluo detection method).

[0076] Fig.11 is the sensitivity of CRISPR fluorescence detection (i.e., RAA-Cas12a-Fluo detection method).

[0077] Fig.12 Sensitivity of conventional PCR method for detecting Fusarium oxysporum.

[0078] Fig.13 This method was applied to detect Fusarium oxysporum in field experiments. DETAILED DESCRIPTION

[0079] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0080] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0081] In order to achieve on-site detection, the present invention has developed and optimized a physical lysis technology that does not require chemical reagents and centrifugal equipment, namely, the bead milling lysis method. This method can quickly obtain crude cell extracts that can be directly used for RAA amplification within 10 minutes.

[0082] In order to realize on-site detection, the ssDNA reporter molecules in the Cas12a detection reaction are labeled with FAM fluorescent groups, BHQ1 quenching groups and Biotin biotin groups (the specific sequence of the probe used in the present invention is: 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3'). After Cas12a recognizes and cuts the target, the non-specific cutting activity triggered by it can cause the FAM fluorescent reporter gene to emit a fluorescent signal (fluorescence, Fluo; Excitation / emission: 488nm / 520nm), which can be observed in real time with the naked eye under 470nm blue light irradiation, i.e. RAA-Cas12a-Fluo detection method. In addition, the FAM fluorescent group and Biotin biotin group released in the reaction can be detected by colloidal gold chromatography immunoassay test strips (lateral flowstrip, LFS), i.e. RAA-Cas12a-LFS detection method. The advantage of having two different result readout strategies in the same field pathogen detection reaction is that it enhances flexibility and reliability, allowing for more accurate and timely decision making under varying field conditions.

[0083] The kit of the present invention aims at the problem that the early symptoms of Fusarium oxysporum root rot are not obvious, and usually takes the characteristics of the disease occurrence of complex infection by multiple pathogens as the basis, and proposes a rapid naked eye visual qualitative detection kit and application in the field within 2 hours, providing a reliable method for early diagnosis and disease monitoring of Fusarium oxysporum in the field.

[0084] The application scenario of the kit of the present invention is the field, and the users are agricultural practitioners. In a non-experimental environment, the irregular operation of untrained professional testers may cause false positives or false negatives in field tests. The dual detection mechanism of the present invention for samples improves the reliability of field test results.

[0085] This method can quickly identify pathogens in the early stages of the disease, achieve timely prevention and control, and reduce crop losses. This detection method is easy to operate, highly sensitive, does not require complex equipment and professional technicians, is suitable for direct application in the field, helps to improve detection efficiency, reduce the use of chemical agents, protect the environment, and promote the sustainable development of agriculture.

[0086] The crude extract of the sample obtained by physical crushing can be directly used for RAA isothermal amplification. The amplification targets correspond to the conserved sequence of ITS rRNA gene of Fusarium spp. (GenBank MT530024) and the specific sequence of cytochrome P450 gene of F.oxysporum (GenBank OP795922). The RAA amplification product is used as a DNA target in the CRISPR / Cas12a detection system.

[0087] The present invention targets the conserved region of the ITS rRNA gene of the Fusarium fungus, and the amplified target sequence length is 112 bp. The specific RAA primers and crRNA used are Fus-F / Fus-R and Fus-crRNA, respectively, and the sequences are as follows:

[0088] The RAA primer pair used in the present invention is:

[0089]

[0090] Specific crRNA in the Cas12a detection reaction used in the present invention:

[0091]

[0092] The gene sequence used to identify Fusarium oxysporum in the present invention is a cytochrome P450 enzyme (cytochrome P450) gene, and the amplified target sequence length is 120bp. The specific RAA primers and crRNA used are Fo-F / Fo-R and Fo-crRNA, respectively, and the sequence is as follows:

[0093] The RAA primer pair used in the present invention is:

[0094]

[0095] Specific crRNA in the Cas12a detection reaction used in the present invention:

[0096]

[0097] The Cas12a-crRNA complex recognizes the PAM site within the amplicon and specifically binds to the target strand of crRNA, thereby enhancing the specificity of the detection and being able to identify single-base mismatches. In order to achieve on-site detection, the ssDNA reporter molecule in the Cas12a detection reaction is labeled with a FAM fluorescent group, a BHQ1 quenching group, and Biotin (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3').

[0098] When Cas12a recognizes and cuts the target, the nonspecific cleavage activity it triggers will cause the reporter molecule to break and emit a fluorescent signal, which can be observed in real time with the naked eye under 470nm blue light irradiation, namely the RAA-Cas12a-Fluo detection method. In addition, the FAM fluorescent group and Biotin biotin group released in the reaction can be detected by colloidal gold chromatography immunoassay strips, namely the RAA-Cas12a-LFS detection method. The advantage of setting up two different result reading strategies in the same on-site pathogen detection reaction is that it enhances flexibility and reliability, allowing more accurate and timely decisions under different field conditions.

[0099] The detection steps of the kit of the present invention are as follows:

[0100] 1. Crude extraction of sample nucleic acid:

[0101] The bead beating method using zirconium oxide beads and pestles is a simple physical cell lysis method that does not require organic reagents. Both zirconium oxide beads and pestles are commercially available and can be reused by cleaning and moist heat sterilization.

[0102] Specific operation: Under a sterile environment, weigh 450±50 mg of heat-sterilized zirconium oxide beads (about 20 zirconium oxide beads with a diameter of 2 mm) and place them in a sterile, enzyme-free 2 mL centrifuge tube for later use. At the same time, heat-sterilize the grinding rod for later use.

[0103] Bead grinding lysis method to obtain the template for RAA detection: When sampling in the field, take an appropriate amount of plant or soil sample (about 100 mg) and put it into the above-mentioned centrifuge tube containing zirconium oxide beads, add 500 μL of nuclease-free sterile water to soak the sample and zirconium oxide beads, use an oscillator to shake for 10 minutes or use a pestle to grind thoroughly to obtain cell lysate, and then take 5 μL as the template for RAA detection.

[0104] For liquid samples, such as fungal culture fluid or rainwater, irrigation water, etc., use a pipette to directly aspirate 500 μL into the above-mentioned centrifuge tube containing zirconium oxide beads, oscillate with an oscillator for 10 minutes or grind with a pestle to obtain cell lysate, and then take 5 μL as the template for RAA detection. Unless otherwise specified below, this method is used to obtain the template for RAA detection.

[0105] Comparison of methods for obtaining genomic DNA templates that meet the requirements of RAA amplification: Spraying 10 4 conidia / mL (spores per milliliter) of fresh Fusarium oxysporum liquid, cut the inoculated leaves with sterile scissors and put them into a centrifuge tube containing about 450 mg of zirconium oxide beads (20 zirconium oxide beads with a diameter of 2 mm), and then add 500 μL of nuclease-free sterile water. Grind thoroughly with the help of a grinding pestle ( Figure 2 A) or use an oscillator to shake for 2-10 minutes ( Figure 2 In B), 5 μL of cell lysate was used to perform RAA amplification of the Fusarium ITS rRNA gene target in order to achieve sufficient disruption. At the end of the reaction, 50 μL of a mixture of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) was added, followed by centrifugation at 12,000 rpm for 5 minutes to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on a 2% agarose gel.

[0106] pass Figure 2 It can be concluded that the bead beating lysis method used in the present invention can achieve the same effect as the alkaline lysis kit and the centrifugal column kit with higher requirements for reagents and consumables, and successfully obtain genomic DNA that meets the requirements of RAA amplification.

[0107] 2. RAA amplification:

[0108] The RAA reaction system is prepared to exponentially amplify the nucleic acid target through RAA technology.

[0109] RAA amplification utilizes crowd-testing The basic RAA kit, RAA primer design and reaction system follow the guidelines provided by its manufacturer, specifically: one tube of lyophilized recombinant enzyme was dissolved in 13.5 μL of distilled water, and then 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer, and 2 μL of 10 μM downstream primer were added. After the lyophilized recombinant enzyme was completely dissolved, 5 μL of sample lysate (obtained from the first step of bead beating lysis) and 2.5 μL of 280 mM magnesium acetate (this component is used to start the reaction) were added. After the reaction mixture was fully mixed, it was immediately incubated at 39°C for 30 minutes.

[0110] The RAA amplification product sequence contains a PAM region 5'-TTTN-3' that can be recognized and bound by Cas12a. Cas12a recognizes the PAM region under the guidance of crRNA and complements its downstream bases to achieve the purpose of accurately identifying the target DNA and cutting its target.

[0111] 2.1 For the conservative region reference sequence of the ITS rRNA gene of the genus Fusarium (GenBank: MT530024), the amplified target sequence length is 112 bp, and the specific RAA primers and crRNA used are Fus-F / Fus-R and Fus-crRNA, respectively, and the sequences are as follows:

[0112]

[0113] 2.2 Specific gene fragments for Fusarium oxysporum

[0114] The specific gene sequence used to identify Fusarium oxysporum is the cytochrome P450 gene (GenBank: OP795922), and the amplified target sequence length is 120 bp. The specific RAA primers and crRNA used are Fo-F / Fo-R and Fo-crRNA, respectively, and the sequences are as follows:

[0115]

[0116] 2.3 Optimization of RAA reaction conditions

[0117] Using full gold The commercial kit MagicPureFungi Genomic DNA kit was used to extract the gDNA of Fusarium oxysporum and quantified to 30 ng / μL using a spectrophotometer. Beijing, China) were diluted in 10-fold gradients to 30 pg / μL (10 3 The diluted samples were stored at -20°C until use.

[0118] RAA reaction time optimization (i.e. Figure 3 Middle A): Pass (RAA technology - Hangzhou Zhongce Biotechnology Co., Ltd. (hz-zc.cn) RAA kit was used to perform RAA amplification on 30pg / μL gDNA. Specifically, one tube of lyophilized recombinase was dissolved in 17.5μL of distilled water, and then 25μL of 2x reaction buffer, 2μL of 10μM upstream primer Fus-F, and 2μL of 10μM downstream primer Fus-R were added. Once the enzyme was completely dissolved, 1μL of Fusarium oxysporum gDNA and 2.5μL of 280mM magnesium acetate were added.

[0119] After the reaction mixture was fully mixed, it was immediately incubated at 39°C for 5 minutes, 10 minutes, 15 minutes, 20 minutes or 30 minutes. At the end of the reaction, 50 μL of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) was added, followed by centrifugation at 12000 rpm for 5 minutes to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on 2% agarose gel.

[0120]

[0121] RAA reaction temperature optimization (i.e. Figure 3 Middle B): Pass The RAA kit of (RAA Technology - Hangzhou Zhongce Biotechnology Co., Ltd. (hz-zc.cn)) performed RAA amplification on 30pg / μL gDNA. Specifically, a tube of lyophilized recombinant enzyme was dissolved in 17.5μL of distilled water, and then 25μL of 2x reaction buffer, 2μL of 10μM upstream primer Fus-F, and 2μL of 10μM downstream primer Fus-R were added. Once the enzyme was completely dissolved, 1μL of Fusarium oxysporum gDNA and 2.5μL of 280mM magnesium acetate were added. After the reaction mixture was fully mixed, it was immediately incubated at 35℃-43℃ for 10 minutes or 30 minutes. At the end of the reaction, 50μL of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) was added, followed by centrifugation at 12000rpm for 5 minutes to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on a 2% agarose gel.

[0122]

[0123] The recommended method of the RAA amplification method used in the present invention is to complete the exponential amplification of the target gene within 10-30 minutes at 35°C-43°C. In addition, in the early stage of infection (when the amount of Fusarium is small), more amplification products can be obtained by increasing the RAA incubation temperature and / or reaction time.

[0124] In the following experiments, unless otherwise specified, the cells were incubated at 39°C for 30 min.

[0125] 2.4 Specificity and sensitivity of RAA amplification

[0126] Specificity detection: Reaction conditions: Dissolve one tube of lyophilized recombinant enzyme in 13.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 5 μL of lysate of pure fungal culture (potato dextrose agar medium) (obtained by the first step of bead milling lysis method) and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. The negative control is sterile ddH2O. At the end of the reaction, add 50 μL of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) mixture, then centrifuge at 12000 rpm for 5 minutes to remove the enzyme components in the reaction, and the purified supernatant is analyzed by electrophoresis on 2% agarose gel.

[0127] Conclusion: If Figure 4 The RAA primers Fus-F / Fus-R for detecting Fusarium fungi shown in A can specifically recognize and exponentially amplify the identification gene target of Fusarium, showing a specific band at 112 bp, which is highly specific for Fusarium fungi, but cannot identify non-Fusarium fungi. Figure 4 The RAA primers Fo-F / Fo-R for detecting Fusarium oxysporum shown in B can only specifically identify Fusarium oxysporum, and no specific amplification bands of other genera, Fusarium pseudoverticillium and Fusarium graminearum are found at 120 bp. The RAA primers designed and constructed by the present invention have high specificity for target amplification of Fusarium fungi and Fusarium oxysporum.

[0128] Specificity detection: Purified Fusarium oxysporum gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) were diluted to 3000 pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(10 3 aM)、3pg / μL(10 2 aM)、0.3pg / μL(10 1 aM)、0.03pg / μL(10 0 aM)、0.003pg / μL(10 -1 aM) and 0.0003pg / μL (10 -2 aM).

[0129] Reaction conditions: Dissolve one tube of lyophilized recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer Fus-F, and 2 μL of 10 μM downstream primer Fus-R. Once the enzyme is completely dissolved, add 1 μL of the above Fusarium oxysporum gDNA and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. At the end of the reaction, add 50 μL of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) mixture, then centrifuge at 12000 rpm for 5 minutes to remove the enzyme components in the reaction, and analyze the purified supernatant by electrophoresis on 2% agarose gel.

[0130] Conclusion: If Figure 5 The primers designed by the present invention can be used at 0.003pg / μL (10 -1 The target band was seen at 10 μM, indicating that the detection limit of the RAA detection system was 0.003 pg / μL (10 -1 aM), proving that the RAA amplification system and conditions optimized by the present invention have high sensitivity. Target nucleic acid molecules at the aM level can be detected, which meets the sensitivity requirements of the World Health Organization for point-of-care molecular testing (POCT) technology.

[0131] 3. CRISPR / Cas12a system detection

[0132] Prepare a CRISPR / Cas12a reaction system, detect the DNA target amplified by RAA through the CRISPR / Cas12a system, and visualize the detection results through the ssDNA reporter molecule in the reaction system.

[0133] 3.1Cas12a enzymes include but are not limited to AsCas12a protein, BbCas12a protein, BoCas12a protein, FnCas12a protein, LbaCas12a protein, HkCas12a protein, OsCas12a protein and one or more of their mutants. The present invention preferably uses FnCas12a protein. The above enzymes can be purchased or purified by prokaryotic expression. The purification method of the present invention is based on (WANG, D., MA, D., HAN, J., KONG, L., LI, LY & XI, Z. 2018. CRISPR RNA Array-Guided Multisite Cleavage for Gene Disruption by Cas9 and Cpf1. ChemBioChem, 19, 2195-2205).

[0134] 3.2 Reaction buffer includes but is not limited to NEBuffer purchased from New England Biolabs (NEB) TM 2.1、NEBuffer TM 3.1, NEBuffer TM CutSmart or Cas commercial reaction buffer. Buffers include but are not limited to the above-mentioned ones, and all common ones in the art can complete the present invention. The buffer in the reaction system is conducive to maintaining the high activity of the Cas12 enzyme and improving the trans-cleavage activity of the Cas12 enzyme after it is activated during the reaction process. NEBuffer is preferred in the present invention TM 2.1.

[0135] 3.3crRNA is obtained by whole gene synthesis or in vitro transcription

[0136] In vitro transcription specific method: use HiFi DNA polymerase (TransGen, Beijing, China) anneals the ssDNA oligonucleotide corresponding to the reverse complement of the target DNA sequence (see the table below) to the backbone containing the T7 promoter for sequence extension. The PCR product was verified by 1.5% agarose gel electrophoresis and then used Oligo Clean & Concentrator TM Kit (Zymo Research, California, USA) was used for purification. The purified PCR product was used as a template and purified using TranscriptAid TMIn vitro transcription was performed using the T7 High Yield Transcription Kit (Thermo Scientific, Massachusetts, USA) according to the manufacturer's protocol. TM crRNA was purified and concentrated using a Zymo Research kit (Zymo Research, California, USA), quantified using a Nanodrop spectrophotometer, and stored at -80°C.

[0137] Table of oligonucleotides for crRNA construction

[0138]

[0139] crRNA-F / Fus-cr-R was used to synthesize Fus-crRNA, and crRNA-F / Fo-cr-R was used to synthesize Fo-crRNA.

[0140] DNA template synthesis reaction components of crRNA:

[0141] Element Volume (μL) crRNA-F (10 μM) 1.25 Fus-cr-R or Fo-cr-R (10 μM) 1.25 2×DNA polymerase mix 12.5 <![CDATA[ddH2O]]> 10

[0142] DNA template synthesis reaction procedure of crRNA:

[0143]

[0144] In vitro transcription reaction components based on crRNA-based DNA templates:

[0145]

[0146]

[0147] In vitro transcription reaction procedure based on crRNA DNA template: After incubation at 37°C for 2 hours, add 2μLDNaseⅠ (1U / μL), and incubate at 37°C for 20 minutes. Subsequently, recover by oligo clean&concentrator (Zymo), and obtain the corresponding crRNA. The specific sequence is shown in the table below, and stored at -80°C.

[0148] Table crRNA sequence

[0149]

[0150] 3.4 Single-stranded DNA (ssDNA) reporter molecules are labeled with a fluorescent group carboxyfluorescein (FAM), a quencher group black hole quencher (BHQ) including one or more of black hole quencher 1 (BHQ-1), black hole quencher 2 (BHQ-2) or black hole quencher 3 (BHQ-3), and biotin, i.e., 5'FAM-NNNNN-BHQ1-NNNNN-Biotin 3' (the base N represents A, T, C or G)

[0151] In addition, the same effect can be achieved by mixing FQ dual-labeled ssDNA probe (FAM-NNNNN-BHQ1) and FB dual-labeled ssDNA probe (FAM-NNNNN-Biotin). The corresponding reaction is:

[0152]

[0153] The triple labeled probe 5'FAM-TTATT-BHQ1-TTATT-Biotin 3' was used in the experiment.

[0154] 3.5 Reaction system: 30 μL Cas12a reaction solution contained 1× NEBuffer 2.1 buffer (New England Biolabs, Beijing, China), 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter molecule and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China).

[0155] Add 2 μL of fresh RAA product (without purification) to the Cas12a detection reaction, mix well, incubate at 39°C, and irradiate with 470nm LED light to observe the fluorescence results with the naked eye.

[0156] Unless otherwise stated, the subsequent reaction system is based on the description referred to as "RAA-Cas12a-Fluo assay" above.

[0157] At the end of the RAA-Cas12a-Fluo experiment, mix the two parallel fluorescence reactions in one centrifuge tube to obtain 60 μL of reaction solution. Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were inserted and incubated at room temperature for 3-5 minutes. If two lines appeared on the test strip, it was a positive result, while a single control line was a negative result. This method is called the "RAA-Cas12a-FLS assay".

[0158] 3.6 CRISPR test strip detection technology / RAA-Cas12a-FLS reaction system optimization

[0159] Cas12a concentration optimization: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 25nM, 50nM, 100nM, 150nM or 200nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter (5'FAM-TTATT-BHQ1-TTATT-Biotin 3') and 1U / μLRNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of fresh RAA amplification product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3-5 minutes.

[0160] Results: Figure 6 As shown, Cas12a protein above 50 nM inhibited CRISPR test strip detection, and the reaction concentration range was 25 nM-50 nM. 50 nM Cas12a protein was preferred in subsequent experiments.

[0161] Optimization of crRNA concentration: 30 μL Cas12a reaction solution contained 1× NEBuffer 2.1 buffer, 50 nM FnCas12a, 125 nM, 250 nM, 500 nM, 750 nM or 1000 nM crRNA, 200 nM triple-labeled ssDNA reporter (5'FAM-TTATT-BHQ1-TTATT-Biotin 3') and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China).

[0162] Incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3-5 minutes.

[0163] Results: Figure 6 As shown, as the crRNA concentration increases, the color of the detection line deepens, which means the reaction efficiency is higher. The reaction concentration range is 125nM-1000nM. 500nM crRNA is preferred in subsequent experiments.

[0164] Optimization of triple-labeled ssDNA reporter molecule concentration: 30 μL Cas12a reaction solution contains 1×NEBuffer2.1 buffer, 50nM FnCas12a, 500nM crRNA, 50nM, 100nM, 150nM, 200nM or 250nM triple-labeled ssDNA reporter molecules and 1U / μl RNase inhibitor (Thermo Scientific, Beijing, China). Incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3-5 minutes.

[0165] Results: Figure 6 As shown, as the concentration of ssDNA reporter molecules increases, the color of the detection line becomes darker, which means the reaction efficiency is higher. The reaction concentration range is 50nM to 250nM. 200nM ssDNA reporter molecules are preferred in subsequent experiments.

[0166] 3.7 Specificity of CRISPR test strips (i.e., RAA-Cas12a-LFS assay) for detecting Fusarium (Fus target assay) and Fusarium oxysporum (Fo target assay)

[0167] The RAA-specific amplification product is used as the DNA template of the CRISPR / Cas12a detection system. The Cas12a-crRNA complex recognizes the PAM site in the amplicon and specifically binds the target strand to the crRNA. Therefore, CRISPR / Cas12a detection further enhances the specificity of the detection experiment based on RAA-specific amplification. Based on literature reports, its specificity can even reach the recognition of single-base mismatches.

[0168] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 13.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer, and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 5 μL of lysate of pure fungal culture (potato dextrose agar medium) (obtained by the first step of bead beating lysis method) and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter (5'FAM-TTATT-BHQ1-TTATT-Biotin 3') and 1 U / μL RNase inhibitor (ThermoScientific, Beijing, China). Add 2 μL of fresh RAA amplification product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3-5 minutes.

[0169] Conclusion: If Figure 7 The RAA primers Fus-F / Fus-R for detecting Fusarium fungi shown in the figure can specifically recognize and exponentially amplify the identification gene target of Fusarium, and are specifically recognized by the Cas12a / Fus-crRNA complex in the CRISPR system, with high specificity for Fusarium fungi (test strips 1-7), but cannot recognize non-Fusarium fungi (test strips 8-11). Figure 7 The RAA primers Fo-F / Fo-R for detecting Fusarium oxysporum shown can only specifically identify Fusarium oxysporum, and are specifically identified by the Cas12a / Fo-crRNA complex in the CRISPR system, with high specificity for Fusarium oxysporum (test strips 1-5), but cannot identify other genera of fungi or other species of Fusarium (test strips 6-11). The visual detection of Fusarium fungi and Fusarium oxysporum designed and constructed by the present invention has high specificity.

[0170] 3.8 Sensitivity of CRISPR test strips (i.e., RAA-Cas12a-LFS assay) for detecting Fusarium (Fus target assay) and Fusarium oxysporum (Fo target assay)

[0171] Purified Fusarium oxysporum gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) were diluted to 3000 pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(10 3 aM)、3pg / μL(10 2 aM)、0.3pg / μL(10 1 aM)、0.03pg / μL(10 0 aM)、0.003pg / μL(10 - 1 aM) and 0.0003pg / μL (10 -2 aM).

[0172] Reaction system: (1) RAA reaction: Dissolve one tube of lyophilized recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 1 μL of the above-mentioned Fusarium oxysporum gDNA and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter molecule (5'FAM-TTATT-BHQ1-TTATT-Biotin3') and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of unpurified fresh RAA product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3-5 minutes.

[0173] Result determination: If the control line and the test line appear at the same time, it indicates that the test sample contains the target bacterial DNA amplification product; if only the control line appears, it indicates that the test sample does not contain the target bacterial DNA amplification product or the target bacterial DNA concentration is too low.

[0174] Conclusion: If Figure 8 The detection of Fus target can be performed in 10 1 The target band was seen at aM, indicating that the detection sensitivity for Fusarium was 10 1 aM, that is, 12 copies per 60μL reaction system; the detection of Fo target can be 2The target band was seen at aM, indicating that the detection sensitivity of Fusarium oxysporum was 10 2 aM, that is, 120 copies per 60μL reaction system. This proves that the system and conditions of our optimized CRISPR test strip detection technology have high sensitivity.

[0175] 3.9CRISPR fluorescence detection technology / RAA-Cas12a-Fluo reaction establishment

[0176] Although CRISPR test strip detection technology has advantages such as easy portability and storage, as an endpoint detection method, it means that the process of displaying and judging the results is also the termination of the reaction.

[0177] The longer the CRISPR / Cas12a detection time, the lower its detection limit will be, which is beneficial for the detection of low-concentration targets (see Fig.10 and Fig.11 ). However, in actual detection, in order to save time, it is often hoped that the detection is completed as quickly as possible. This creates a contradiction. The detection of the present invention utilizes a triple-labeled probe or a strategy of mixing two double-labeled probes, which can present two visual results for the same experiment. On the basis of saving detection costs and time costs, double verification of the same experimental results is completed.

[0178] During the CRISPR reaction, the reaction results are determined by observing the fluorescence brightness in real time through 470nm blue LED illumination. When significant fluorescence appears, the reaction is immediately paused, and the test strip is used to reconfirm and judge the experimental results. The advantage of using the test strip for re-judgment is that on the one hand, it can solve the subjective misjudgment of fluorescence brightness by operators without testing experience, and on the other hand, it can avoid the interference of other molecules in the sample that fluoresce under blue-violet light on the judgment of experimental results, such as chlorophyll ( Fig. 9 ).

[0179] The crude nucleic acid extraction method of the present invention is used to crush the wheat leaves inoculated with Fusarium oxysporum to obtain the crude nucleic acid extract. The target gene is further amplified using the RAA amplification technology described in the present invention. CRISPR fluorescence detection is performed using the RAA amplification product as a target. (-) represents the negative control, i.e., wheat leaves without Fusarium oxysporum, (+) represents the addition of 2 μL of RAA amplification product for CRISPR fluorescence detection, and (++) represents the addition of 4 μL of RAA amplification product for CRISPR fluorescence detection. And compared with the detection results of the purified Fusarium oxysporum gDNA extract.

[0180] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 13.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 5 μL of sample lysate (obtained from the first step of bead beating lysis) and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is fully mixed, incubate at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter molecule and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add an appropriate amount of RAA amplification product and incubate at 39°C for 30 minutes. Irradiate with 470 nm LED light and observe fluorescence with the naked eye.

[0181] Conclusion: If Fig. 9 The chlorophyll in the crude extract of the leaves shown emits red fluorescence under blue light, which affects the judgment of the results, so double verification is required during field testing.

[0182] 3.9.1 Is the detection system optimized by CRISPR test strip detection technology suitable for CRISPR fluorescence detection?

[0183] CRISPR fluorescence detection reaction system: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter molecules and 1 U / μL RNase inhibitor (ThermoScientific, Beijing, China). Add 2 μL RAA amplification product of Fusarium oxysporum gDNA and incubate at 39°C for 30 minutes. Irradiate with 470 nm LED light and observe fluorescence with naked eyes. The negative control is the product of RAA amplification using ddH2O as the detection sample.

[0184] Conclusion: Fluorescence can be observed with the naked eye for both bacteria 5 minutes after the reaction begins.

[0185] 3.9.2 Sensitivity of CRISPR fluorescence detection

[0186] Purified Fusarium oxysporum gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) were diluted to 3000 pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(103 aM)、3pg / μL(10 2 aM)、0.3pg / μL(10 1 aM) and 0.03pg / μL (10 0 aM).

[0187] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 1 μL of the above-mentioned Fusarium oxysporum gDNA and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate it immediately at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter molecule and 1U / μL RNase inhibitor (ThermoScientific, Beijing, China). 2 μL of fresh unpurified RAA product was added, and the fluorescence intensity was monitored in real time at 39°C using the CFX 96 real-time PCR detection system (BioRad, California, USA). The fluorescence intensity was detected every 1 minute. At the same time, the fluorescence intensity of the reaction was observed under 470 nM LED blue light.

[0188] NC: negative control, sterile ddH2O was used instead of gDNA diluent.

[0189] Conclusion: If Fig.11 The CRISPR fluorescence detection technology shown in the figure can reach a sensitivity of 1aM level at 39°C for 1 hour. 3 aM) Naked eye observation results of RAA-Cas12a-Fluo detection reaction of Fusarium oxysporum gDNA Fig.10 It was shown that positive fluorescence signals of its Fus target and Fo target could be observed within 5 minutes.

[0190] 4 Compared with the traditional PCR method:

[0191] Reference primers and literature:

[0192]

[0193]

[0194] PCR reaction system and reaction conditions:

[0195] Overall system 20.0μL 2xDNA polymerase 10.0μL Upstream primer ITS1 0.5μL Downstream primer ITS2 0.5μL Genome template 1.0μL Sterile water Double distilled water 8.0μL

[0196] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 45 s, 30 cycles, and 72°C final extension for 5 min.

[0197] Conclusion: If Fig.12 The traditional PCR method for detecting Fusarium oxysporum requires precise temperature control equipment and an amplification time of more than 1 hour. It also has high requirements for the purity and concentration of Fusarium oxysporum gDNA, which means greater nucleic acid extraction costs and time (half an hour to one hour).

[0198] In a laboratory environment that meets the above conditions, the sensitivity of PCR for detection of Fusarium oxysporum is 30pg / μL (10 3 aM), which is 1000 times that of the CRISPR fluorescence detection technology / RAA-Cas12a-Fluo of the present invention, and 100 times that of the CRISPR test strip detection technology / RAA-Cas12a-LFS.

[0199] In summary, the detection method for Fusarium oxysporum of the present invention has higher sensitivity, shorter time, simpler operation and lower cost.

[0200] 5. Field experiment

[0201] Fusarium oxysporum was cultured on potato dextrose agar (PDA) at 28°C for 5-7 days until the hyphae were fully grown and covered the medium. The fungal hyphae plugs obtained from the PDA medium were cultured in sodium carboxymethylcellulose (CMC) medium at 28°C for 2-4 days. Before inoculation, the fresh Fusarium spore suspension was washed and diluted with 0.85% NaCl solution. The spore suspension and its dilution were quantified using a hemocytometer, and the quantitative results of the bacterial suspension were further verified by plate colony counting.

[0202] 10 5 Up to 10 1 500 μL of each spore dilution with a spore concentration of 100 μg / mL was taken and centrifuged at 12,000 rpm for 5 minutes. All the supernatant was aspirated with a pipette to leave the spores on the tube wall. Subsequently, 500 μL of rainwater, 100 mg of soil or 100 mg of wheat leaves were added to each tube and diluted to 500 μL with nuclease-free water. Rainwater, soil or wheat leaf samples without the addition of Fusarium oxysporum spores were used as negative controls.

[0203] The crude extract was extracted using the bead mill lysis method optimized by the present invention, and 5 μL of the crude extract was subjected to target-specific amplification for 30 minutes using the RAA reaction conditions optimized by the present invention. 2 μL of the RAA amplification product was reacted for 1 hour using the CRISPR test strip detection method optimized by the present invention, and the test strip was tested, and the test results were immediately photographed.

[0204] Conclusion: By simulating in-situ field detection, we used the technology of the present invention to test spiked samples in a non-laboratory environment, and the negative control (NC) was a sample without fungal spores. Fig.13 As shown in the figure, the detection limit of the Fus target of the method of the present invention for Fusarium oxysporum in rainwater samples is 10conidia / mL, and the detection limit of the Fo target is 10 3 conidia / mL; the Fus target detection limit for Fusarium oxysporum in soil samples was 10 4 conidia / mL, the detection limit of Fo target is 10 5 conidia / mL; the Fus target detection limit for Fusarium oxysporum in wheat samples was 10 2 conidia / mL, the detection limit of Fo target is 10 3 conidia / mL.

[0205] Explanation: (1) The detection sensitivity of Fus target is higher than that of Fo target. The difference in detection sensitivity of the two targets is related to the efficiency of RAA amplification primers and the length and sequence of crRNA; (2) The detection sensitivity of rainwater samples is higher than that of plant samples and soil samples. This is because the complex substances contained in soil and plant samples have a significant impact on the efficiency of nucleic acid amplification. Here, the purpose of improving detection sensitivity can be achieved by purifying the sample nucleic acid. However, the purification process will also increase the cost of detection (for example, magnetic bead purification method) and detection time.

[0206] If Fusarium oxysporum is detected in rainwater, drainage should be carried out as soon as possible to avoid siltation of rainwater, and fungicides such as Benzovindiflupyr, Carbendazim, and Fluazinam should be applied as soon as weather permits to prevent Fusarium oxysporum.

[0207] If Fusarium oxysporum is detected in the soil, soil disinfection can be carried out, using hot water or chemical agents to reduce the survival of pathogens. Crop rotation can break the life cycle of pathogens and reduce the accumulation of pathogens in the soil. Increasing soil organic matter and improving soil microbial diversity can enhance soil health.

[0208] If Fusarium oxysporum is detected in plants, the infected plants should be isolated immediately to prevent the spread of the disease, and the specific type of Fusarium oxysporum should be further confirmed in the laboratory. According to the test results, spray with appropriate fungicides. And consider choosing disease-resistant varieties for planting to enhance resistance.

[0209] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A dual-target rapid visualization in situ detection kit for Fusarium oxysporum, characterized in that: Includes RAA primer pair 1: Fus-F: CTTTCAACAACGGATCTCTTGGTTCTGGCATC Fus-R:GCAATGTGCGTTCAAAGATTCGATGATTCACT Specific crRNA 1: Fus-crRNA: GGGAAUUUCUACUGUUGUAGAUGCUGCGUUCUUCAUCGAUGC RAA primer pair 2: Fo-F:TTGAGGTTTTGGGATCACCGCAAGAGCCGT Fo-R:GGAGAATGGAGTGGATTGGACTATGAAGAC Specific crRNA II: Fo-crRNA: GGGAAUUUCUACUGUUGUAGAUCAGAAGUUGACGCUGAAU.

2. The dual-target rapid visualization in situ detection kit for Fusarium oxysporum according to claim 1, characterized in that: Also included are procedures and primers for constructing crRNA 1 and crRNA 2 crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT Fus-cr-R: GCATCGATGAAGAACGCAGCATCTACAACAGTAGAAATT Fo-cr-R:ATTCAGCGTCAACTTCTGATCTACAACAGTAGAAATT.

3. The dual-target rapid visualization in situ detection kit for Fusarium oxysporum according to claim 1, characterized in that: Includes the ssDNA reporter molecule 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3'.

4. The dual-target rapid visualization in situ detection kit for Fusarium oxysporum according to claim 1, characterized in that: The reaction system includes RAA reaction system and CRISPR / Cas12a reaction system.

5. The dual-target rapid visualization in situ detection kit for Fusarium oxysporum according to claim 4, characterized in that: The RAA reaction system comprises: recombinase, 2x reaction buffer, 10 μM upstream primer and 10 μM downstream primer, RAA detection template, and 280 mM magnesium acetate.

6. The dual-target rapid visualization in situ detection kit for Fusarium oxysporum according to claim 4, characterized in that: The CRISPR / Cas12a reaction system is: 1xNEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter molecules 5'FAM-TTATT-BHQ1-TTATT-Biotin 3', 1U / μL RNase inhibitor.

7. A dual-target rapid visualization in situ detection method for Fusarium oxysporum, characterized in that: The reaction system includes RAA detection and CRISPR / Cas12a detection; ⑴RAA detection: add 25 μL of 2x reaction buffer, 4 μL of 10 μM RAA primer pair 1 or RAA primer pair 2, 5 μL of RAA detection template and 2.5 μL of 280 mM magnesium acetate to the recombinant enzyme dry powder, mix the reaction mixture thoroughly, and immediately incubate at 35°C-43°C for 10-30 minutes to obtain RAA amplification products; ⑵CRISPR / Cas12a detection: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 25nM-50nM FnCas12a, 125nM-1000nM specific crRNA 1 or specific crRNA 2, 50nM-250nM triple-labeled ssDNA reporter molecule; 5'FAM-TTATT-BHQ1-TTATT-Biotin 3' and 1U / μL RNase inhibitor; ⑶ Real-time fluorescence naked eye observation: add 2 μL RAA amplification product, incubate at 39°C for 5-30 minutes; irradiate with 470nM LED light, observe the fluorescence results with naked eyes, and the presence of fluorescence indicates the presence of Fusarium oxysporum; (4) Colloidal gold chromatography immunoassay test strip detection: add 2 μL RAA amplification product and react at 39°C for 30 minutes; mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube, insert Cas12 / 13 special nucleic acid detection test strip and incubate at room temperature for 3-5 minutes. If the control line is displayed, the detection is effective, the detection line appears when the sample contains Fusarium oxysporum, and the absence of the detection line means that the sample does not contain Fusarium oxysporum; The primer pair used for the RAA amplification is: RAA Primer Pair 1: Fus-F: CTTTCAACAACGGATCTCTTGGTTCTGGCATC Fus-R:GCAATGTGCGTTCAAAGATTCGATGATTCACT Specific crRNA 1: Fus-crRNA: GGGAAUUUCUACUGUUGUAGAUGCUGCGUUCUUCAUCGAUGC RAA primer pair 2: Fo-F:TTGAGGTTTTGGGATCACCGCAAGAGCCGT Fo-R:GGAGAATGGAGTGGATTGGACTATGAAGAC Specific crRNA II: Fo-crRNA: GGGAAUUUCUACUGUUGUAGAUCAGAAGUUGACGCUGAAU; 8. The dual-target rapid visual in-situ detection method for Fusarium oxysporum according to claim 7, characterized in that: Method for obtaining template for RAA detection: take a sample into a centrifuge tube containing zirconium oxide beads, add nuclease-free sterile water to soak the sample and zirconium oxide beads, and use an oscillator to shake for 10 minutes or grind with a pestle to obtain cell lysate as a template for RAA detection.

9. The dual-target rapid visual in-situ detection method for Fusarium oxysporum according to claim 7, characterized in that: It also includes programs and primers for constructing crRNA 1 and crRNA 2. The sequences of primer pairs crRNA-F / Fus-cr-R and crRNA-F / Fo-cr-R are: crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT Fus-cr-R: GCATCGATGAAGAACGCAGCATCTACAACAGTAGAAATT Fo-cr-R:ATTCAGCGTCAACTTCTGATCTACAACAGTAGAAATT。

Images