Molecular marker for detecting gibberellic disease resistant QTL QFhb-yaas-4AL and application

Abstract

The invention discloses a molecular marker for detecting a gibberellic disease resistant QTL (Quantitative Trait Loci) QFhb-yaas-4AL and application of the molecular marker. Genotype data are obtained by utilizing a Wheat16K wheat high-throughput gene chip, a QTL locus QFhb-yaas-4AL which is derived from a resistant material and is related to the resistance of the gibberellic disease is detected, and a KASP marker and a detection primer group thereof are developed and are used for efficiently screening the resistance of the gibberellic disease. The primer group disclosed by the invention is used for performing PCR amplification on wheat genome DNA, whether a gene with high gibberellic disease resistance of a resistant material is carried or not can be directly judged through KASP typing, the detection method is simple to operate, the detection result is very intuitive, the detection effect is obvious and effective, and the primer group can be widely applied to the field of genetic engineering. When the molecular marker is used for screening, the working efficiency of molecular marker-assisted selection of wheat breeding with high and low gibberellic disease resistance can be greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat disease resistance breeding, and relates to a molecular marker for detecting a QTL QFhb-yaas-4AL for resistance to scab and an application thereof. Background Art

[0002] Fusarium head blight (FHB) is a fungal disease caused by Fusarium graminearum and other Fusarium species. After the wheat ears become diseased, they will lose water and dry up, which is commonly known as rotten wheat heads. They occur more severely in warm and humid areas such as the middle and lower reaches of the Yangtze River wheat area and the spring wheat area in Northeast China. Wheat infection with fusarium head blight will affect grain filling and reduce grain weight, which will directly affect yield. In general, the average yield reduction is 5%-15% in the year of occurrence, and the yield reduction can be as high as 20%-50% in the year of epidemic. The increase in shriveled and imperfect grains will also reduce the protein, gluten content and flour yield of wheat grains, further affecting the processing quality. In addition, the diseased wheat grains contain toxic substances such as deoxynivalenol (DON), which seriously endangers the health of humans and animals. In 2015, 2016, and 2018, the Huanghuai wheat area successively suffered from the above epidemics, which seriously affected wheat production and endangered food security.

[0003] Wheat resistance to fusarium head blight mainly includes five types: infection resistance type (Type I), expansion resistance type (Type II), grain resistance type (Type III), disease resistance type (Type IV) and toxin accumulation type (Type V). At present, there are many studies on the expansion resistance (Type II). The commonly used identification method is the single flower drip method, that is, the fusarium head blight pathogen is inoculated into the middle floret of the wheat ear by hand. Under moisturizing conditions, the diseased spikelet rate is investigated after a certain period of time (the number of susceptible spikelets / total number of spikelets * 100%), and the resistance level is evaluated by the diseased spikelet rate. Wheat fusarium head blight is a complex quantitative trait controlled by multiple genes. Over the years, domestic and foreign researchers have identified nearly 250 fusarium head blight resistance genes / QTLs on 21 chromosomes of wheat through association analysis and other methods. After in-depth research, it was found that the resistance of 7 fusarium head blight resistance genes (QTLs) is relatively stable and has a large effect value, namely Fhb1~Fhb7. Among them, Fhb1 and Fhb2 are derived from chromosomes 3B and 6B of common wheat Sumai No. 3, respectively. Fhb3 is derived from chromosome 7Lr#1S of the closely related species Leymus dasyphylla. Fhb4 and Fhb5 are derived from chromosomes 4B and 5A of common wheat Wangshuibai. Fhb6 is derived from the closely related species Elymus 1E(ts)#1S. Fhb7 is derived from chromosome 7E of the closely related species Thinopyrum longipedum. Fhb1, Fhb2 and Fhb4, Fhb5, Fhb8, and Fhb9 are all derived from common wheat. The former is related to wheat expansion resistance (Type II), and the latter is related to invasion resistance (Type I). Among them, Fhb1 is currently recognized as the most effective QTL for resistance to Fusarium head blight at home and abroad, and its resistance performance is stable. Fhb3, Fhb6, and Fhb7 are derived from closely related species of wheat, and are relatively less studied and used.

[0004] At present, the prevention and control of wheat fusarium head blight mainly adopts chemical agents, which can reduce the severity of the disease to a certain extent. However, in the years when fusarium head blight recurs, such measures are generally ineffective. At the same time, chemical control will increase the cost of wheat production and have a very adverse impact on the environment. Therefore, chemical control and other means cannot effectively solve the harm of fusarium head blight. Long-term practice has proved that the cultivation and promotion of disease-resistant varieties is the most effective way to solve the harm of fusarium head blight. In the 1940s, Chinese scientists began to improve local disease-resistant varieties, and have made significant progress, breeding a number of varieties with good resistance. For example, the medium-resistant fusarium head blight variety Wannian No. 2 was bred from the more seriously diseased Nanda 2419. The Jiangsu Lixiahe Agricultural Science Institute bred Yangmai No. 1 and Yangmai No. 3 from Afu (Funo). Afterwards, Suzhou Agricultural Science Institute used Afu and Taiwan wheat as parents and adopted hybrid breeding methods to breed the disease-resistant wheat variety Sumai No. 3, which showed high resistance in multi-point fusarium head blight resistance identification for many years and is currently recognized as one of the best sources of resistance to fusarium head blight in the world. The wheat line Ning 7840, which was bred by the Jiangsu Academy of Agricultural Sciences with Afu, Anhui 11 and Sumai 3 as parents, has good resistance to ergot in many years of multi-point ergot resistance identification. Compared with Sumai 3, Ning 7840 has been significantly improved in agronomic traits, but it has not been widely promoted in production due to its high plant height and average yield potential. Cheng Shunhe et al. proposed that in the work of improving the ergot resistance of varieties using conventional methods, if the source of resistance has not been broken through, a group of varieties with certain resistance can be used as parents first. In the process of selecting offspring, attention should be paid to high yield while taking into account the screening of comprehensive resistance such as resistance to ergot. Based on this breeding route, the medium-resistant variety Yangmai 158 was bred and widely promoted and applied, which initially solved the problem of combining large-scale high yield with ergot resistance. Since then, a group of similar varieties have been bred in the wheat areas of the middle and lower reaches of the Yangtze River, such as Ningmai 9, Yangmai 14 and Yangmai 17. Subsequently, several wheat varieties with good resistance were bred using Yangmai 158 and Ningmai 9 as the backbone parents, such as Huamai 5 (Yangmai 158 / ph82-2-2), Ningmaizi 119 (Italian soft wheat / Ningmai 13 2 ) and Shengxuan 6 (Ningmai 8 / Ningmai 9), etc. Although these efforts did not produce varieties immune to scab, they greatly improved the scab resistance of wheat varieties in the middle and lower reaches of the Yangtze River.

[0005] Genome-wide association study (GWAS) is to identify and locate genes by identifying and genotyping target traits and using statistical methods to detect the association between the two. It has been widely used in the genetic study of quantitative traits of various crops such as wheat, rice and corn. Commonly used association analysis models are mixed linear model (MLM) and general linear model (GLM). Mixed linear model (MLM model) uses principal component analysis (PCA) and kinship matrix (K) as covariates to calculate the linear regression relationship between genotype and phenotype; general linear model (GLM model) uses population structure (Q) or principal component (PCA) as covariates. With the continuous development of high-throughput SNP marker typing technology and high-throughput sequencing technology, the cost of wheat genotyping has gradually decreased. At the same time, the gradual improvement of the phenotypic identification system has promoted the increasingly accurate phenotypic data. The combination of the two has made genome-wide association study (GWAS) more and more widely used in genetic studies of various complex traits of wheat such as fusarium head blight, spike germination, stripe rust, yield and quality. This analysis method can be used to identify a large number of related genes / QTLs that control complex traits by obtaining individual genotype data and years of phenotypic data. It has become an important tool in crop genetic improvement research.

[0006] The genetic mechanism of wheat fusarium head blight is relatively complex, and phenotypic identification is cumbersome and easily affected by the environment, which greatly limits the genetic improvement of wheat fusarium head blight resistance. With the continuous deepening of the positioning and cloning of fusarium head blight resistance genes (QTLs) and the research on molecular markers, the application of molecular marker-assisted selection technology has become more and more extensive in the process of breeding disease-resistant varieties. Compared with conventional breeding, molecular breeding can perform rapid and accurate screening in low generations, significantly improving the selection efficiency of fusarium head blight resistant varieties and shortening the breeding cycle. Therefore, it is of great significance to collect wheat variety resources in the middle and lower reaches of the Yangtze River, and to mine new fusarium head blight resistance genes / QTLs through whole genome association analysis, and to convert them into selectable molecular markers to create excellent fusarium head blight resistance germplasm resources for wheat fusarium head blight resistance breeding. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects in the prior art and provide a molecular marker for detecting the resistance to fusarium head blight QTL QFhb-yaas-4AL and its application. The present invention uses the Wheat16K wheat high-throughput gene chip to obtain genotype data, detects a major effect QTL locus QFhb-yaas-4AL related to fusarium head blight resistance from a disease-resistant variety, and develops a KASP marker and primer set based on this, which is used to efficiently screen the resistance to fusarium head blight.

[0008] On the one hand, the present invention provides a KASP molecular marker linked to the major QTL QFhb-yaas-4A L for wheat fusarium rust resistance, and the nucleotide sequence of the KASP molecular marker is shown in SEQ ID No.4.

[0009] On the other hand, the present invention provides a primer set for detecting whether the 23rd allele variation in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the wheat genome is CC, TT, or C and T.

[0010] The primer set contains two upstream primers and one downstream primer;

[0011] The upstream primer is designed according to the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is C, and the 3' terminal deoxyribonucleotide of the other upstream primer is T;

[0012] The downstream primer is designed according to the downstream sequence of the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome.

[0013] Furthermore, the nucleotide sequence of one of the upstream primers is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.3.

[0014] Furthermore, the 5' end of one of the upstream primers is connected to a fluorescent label sequence FAM, and the 5' end of the other upstream primer is connected to a fluorescent label sequence HEX.

[0015] On the other hand, the present invention also provides a detection kit containing the primer set.

[0016] On the other hand, the present invention also provides the use of the primer set or the kit in any of the following:

[0017] (A) identifying or assisting in identifying wheat resistance to fusarium head blight;

[0018] (B) Comparing the resistance of wheat grains to Fusarium head blight;

[0019] (C) breeding or selecting wheat plants, strains, lines or varieties that are relatively resistant to ergot;

[0020] (D) breeding or selecting wheat plants, strains, lines or varieties that are relatively less resistant to ergot;

[0021] (E) preparing a product for comparing the resistance of wheat to fusarium head blight;

[0022] (F) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to ergot;

[0023] (G) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively weak resistance to Fusarium head blight.

[0024] On the other hand, the present invention also provides any of the following methods:

[0025] Method A: A method for detecting whether the 23rd allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T, comprising the following steps (A1) or (A2):

[0026] (A1) Direct sequencing;

[0027] (A2) using the primer set or the kit to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat gene to be tested is CC, TT, or C and T as follows:

[0028] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a homozygous C;

[0029] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as blue, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 of chromosome 4A in the wheat genome to be tested is a homozygous T;

[0030] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is shown as green, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a hybrid of C and T;

[0031] Method B: A method for comparing the resistance of wheat to fusarium head blight, comprising the following steps:

[0032] (B1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T;

[0033] (B2) determining the fusarium head blight resistance of the wheat to be tested as follows: the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is T is stronger than the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is C or a heterozygote of C and T;

[0034] Method C: A method for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to scab, comprising the following steps:

[0035] (C1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T;

[0036] (C2) selecting a wheat plant to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome is T as a parent for breeding, and selecting a wheat plant in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome is T in each breeding generation, and finally obtaining a wheat plant or strain or variety with relatively strong ergot disease;

[0037] Method D: A method for breeding or screening wheat plants, strains, lines or varieties with relatively weak resistance to ergot disease, comprising the following steps:

[0038] (D1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T;

[0039] (D2) selecting a wheat plant to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A of the genome is homozygous for C as a parent for breeding, and selecting wheat plants in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A of the genome is homozygous for C in each breeding generation, and ultimately obtaining wheat plants, strains, lines or varieties with relatively weak resistance to ergot disease.

[0040] Furthermore, in the method B, the method C and the method D, the method for detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T is the method A.

[0041] On the other hand, the present invention also provides the use of the primer set or the method in wheat molecular marker-assisted breeding.

[0042] Compared with the prior art, the present invention uses Wheat16K wheat high-throughput gene chip to obtain genotype data, detects a major QTL site QFhb-yaas-4AL related to fusarium resistance from a disease-resistant variety on chromosome 4A, and further develops a KASP marker and a special primer set KASP-4AL-Fhb. Experiments have shown that the KASP molecular marker of the present invention can be used for molecular marker-assisted selection breeding of the major QTL QFhb-yaas-4AL for wheat fusarium resistance. The present invention provides a good tool for the effective use of the QTL site QFhb-yaas-4AL for fusarium resistance in breeding. This marker can quickly screen wheat fusarium resistance, provide convenience for screening wheat materials carrying excellent allelic variations, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the specific implementation manner of the present invention or the technical solution in the prior art, the drawings required for describing the specific implementation manner are briefly introduced below.

[0044] Figure 1 Manhattan plot of association analysis for 244 wheat varieties based on 16K microarray.

[0045] Figure 2 This is a quantile plot (QQ plot) of 244 wheat varieties based on 16K chip association analysis.

[0046] Figure 3 The results of the KASP marker amplification test for the ergot resistance genotypes of 244 varieties and 63 wheat lines in Example 1 and Example 2 were verified. DETAILED DESCRIPTION

[0047] The embodiments of the technical solution of the present invention will be described in detail below in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and the protection scope of the present invention cannot be limited by this. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs.

[0048] Example 1 Screening for stable SNP loci significantly associated with fusarium resistance and verification

[0049] In this example, 244 varieties approved in Jiangsu Province were used as materials. The natural populations were planted in the fusarium identification field of the Wantou Experimental Base in the Lixiahe area of ​​Jiangsu Province and the Gaoyou Experimental Base for two consecutive growing seasons in 2021 and 2022. A randomized block design was used. Two rows of 30 seeds were planted in the Wantou Experimental Base for each variety, with a row length of 1.3m and a row spacing of 0.26m. There were two replicates and conventional field management. Traditional wheat fusarium resistance inoculation was further conducted in the field in 2021 and 2022. Prepare a suspension of fusarium spores (1×10 5 -5×10 5 Spore mL -1 ), single flower drip inoculation method was used. At the beginning of wheat flowering, 12 μL of spore liquid was drawn with a syringe and injected into any small flower of the 4th row of spikelets from the top spikelet to the bottom of the wheat ear. 15 spikelets were inoculated for each variety. After inoculation, artificial misting was used for moisture retention (mist spraying for 5 minutes every half an hour). 21 days after inoculation, the number of diseased spikelets in the inoculated ear was investigated and the diseased spikelet rate was calculated. Diseased spikelet rate = number of diseased spikelets / total number of spikelets × 100%.

[0050] Gaoyou Experimental Base planted one row of each variety, 30 seeds per row, 1.0m long, 0.26m between rows, one replicate, and conventional field management. Further in 2022, traditional wheat fusarium resistance inoculation was carried out in the field to prepare fusarium spore suspension (1×10 5 -5×10 5 Spore mL -1 ), single flower drip inoculation method was used. At the beginning of wheat flowering, 12 μL of spore liquid was drawn with a syringe and injected into any floret of the 4th row of spikelets from the top spikelet to the bottom of the wheat ear. Ten spikelets of each variety were inoculated, and the bags were used to keep moist for 3 days after inoculation. The number of diseased spikelets in the inoculated spikelets was investigated 21 days after inoculation, and the diseased spikelet rate was calculated. Diseased spikelet rate = number of diseased spikelets / total number of spikelets × 100%.

[0051] The above disease resistance investigation and identification standards are in accordance with the "Agricultural Industry Standard of the People's Republic of China NY / T2954-2016: Technical Procedures for Identification of Resistance to Fusarium Scab of Wheat Regional Trial Varieties".

[0052] The PVP-40 method was used to extract genomic DNA, and the 16K SNP chip developed by Boridi was used to obtain genotype data. The GWAS analysis of the MLM model was performed using Tassel software with principal component analysis (PCA) and kinship matrix (K) as covariates. In the results, markers with P≤0.001 (-log10 (p value) ≥3.0) were considered to be important markers significantly associated with the phenotype, and the sites within the 5Mb interval on the physical map were identified as the same candidate site. With reference to Meta-QTL, the sites stably associated with Fusarium resistance identified in this experiment were compared with the reported sites to determine whether they were new QTL sites.

[0053] The experiment obtained a relatively stable locus QFhb-yaas-4AL related to ergot resistance, which can explain 7.68-7.78% of the phenotypic variation.

[0054] Table 1 Stable scab resistance sites

[0055]

[0056] like Figure 1 and Figure 2 As shown, the present application locates a significant SNP site QFhb-yaas-4AL related to fusarium resistance through association analysis (GWAS), the physical location is 628023813b on chromosome 4A, and after comparison with the Meta-QTL interval, it is found that the site is a new fusarium resistance site. The flanking sequence of the site was further downloaded from the wheat genome website, and its flanking sequence is SEQ ID NO:4. Polymarker (http: / / polymarker.tgac.ac.uk / ) was used to design KASP primers, and the primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd. Finally, it was successfully converted into a KASP marker KASP-4AL-Fhb, and its corresponding variable site is C / T, that is, the 23rd position in the nucleotide sequence shown in SEQ ID No.4, TGAGTTATTCATTCCGCACATA[C / T]CACACACGCCACATGGTCATCA GGACTATCATACGTCTAGCATCAGGTAGATGCTCCAGTAGTGAG (SEQ ID NO.4).

[0057] In this embodiment, a KASP-4AL-Fhb primer set is designed for the SNP site. The primer set includes an upstream primer with a nucleotide sequence of 5'-TGAGTTATTCATTCCGCACATAc-3' (SEQ ID NO.1), another upstream primer with a nucleotide sequence of 5'-TGAGTTATTCATTCCGCACATAt-3' (SEQ ID NO.2), and a shared downstream primer with a nucleotide sequence of 5'-CTCACTACTGGAGCATCTACCTGA-3' (SEQ ID NO.3). Meanwhile, the 5' end of the upstream primer SEQ ID No.1 is connected to a fluorescent label sequence FAM, and the 5' end of the other upstream primer SEQ ID No.2 is connected to a fluorescent label sequence HEX. The 3' end of the upstream primer is the allelic variant base C / T of the site, and the downstream primer ensures the 4A chromosome specificity of PCR amplification.

[0058] Preparation of KASP labeled primer working solution:

[0059] Take 12 μL (100 μM) of each fluorescently labeled upstream primer (nucleotide sequence as shown in SEQ ID NO.1 and SEQ ID NO.2), take 30 μL (100 μM) of the fluorescently labeled downstream primer (nucleotide sequence as shown in SEQ ID NO.3), add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0060] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.08 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and add sterile ultrapure water to 5 μL;

[0061] PCR reaction program: Step 1, pre-denaturation at 95°C for 15 min; Step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95°C for 20 s, renaturation at 57°C for 1 min, for 32 cycles; Storage at 10°C. A blank control (NTC) without adding template DNA to the reaction system was also set up in the experiment, and one or more blank controls were set up for each plate.

[0062] Take wheat seedlings and use PVP-40 method to extract wheat genomic DNA

[0063] The wheat genomic DNA to be tested was used as a template, and PCR amplification was performed using the above KASP primer set and PCR reagents to obtain the PCR amplification product P. The CR reaction was carried out in S1000 TMThermal Cycler PCR instrument (Bio-Rad Laboratories Inc.) was used to scan the PCR amplification products and read the fluorescence value using a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm and the emission wavelength was 556 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. Genotyping was performed using Klusther Caller software (KBioscience), and the genotype of the fusarium resistance-related locus QFhfb-yaas-4AL was determined based on the analysis results.

[0064] 244 natural populations were amplified as above, and the test results are shown in the attached Figure 3 As shown. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis position (blue) in the fluorescence signal coordinate system of the typing results, which proves that the genotype of these wheats at the 36th base (SNP site) of the nucleotide sequence flanking the SNP site (such as SEQ ID NO.5) is C; and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the Y-axis position (red) in the coordinate system, which proves that the genotype of these wheats at the SNP site is T; The KASP test results of 244 varieties and the average diseased spikelet rate of fusarium head blight in the field trials in 2021 and 2022 are shown in Tables 2, 3 and Figure 2 shown.

[0065] Table 2 Average diseased spikelet rate and KASP typing results of fusarium head blight in 244 varieties

[0066]

[0067]

[0068]

[0069] Table 3 T test results of average diseased spikelet rate of varieties carrying different genotypes of QFhb-yaas-4AL locus

[0070]

[0071] Table 3 shows the genotypes and phenotypes of 244 varieties using a two-sample T test in Excel 2019. The results show that the average diseased spikelet rate of fusarium head blight in varieties with the QFhb-yaas-4AL locus genotype T was reduced by 24.69%, with a significant difference at the p<0.05 level, indicating that the primer set and genotype detection system of the KASP marker KASP-4AL-Fhb can be applied to molecular marker-assisted breeding for wheat fusarium head blight resistance (the statistical methods in Table 3 are conventional methods in this field, and the details can also be found in the literature "Gai Junyi, "Experimental Statistical Methods", China Agricultural Press, September 2000"). Figure 2 The results showed that the material typing results were good and the material typing was completely consistent with the chip detection data, indicating that the KASP marker was successfully developed and can be further used for breeding material detection.

[0072] Example 2 KASP primer set breeding application

[0073] Field test: In this example, 63 wheat test lines from the middle and lower reaches of the Yangtze River were planted in the Wantou Experimental Base of the Agricultural Science Institute in the Lixiahe area of ​​Jiangsu Province in 2022, and further used the traditional natural identification of wheat scab resistance in the field. 15 ears of each variety were surveyed, and the disease resistance survey and identification standards were in accordance with the "Agricultural Industry Standard of the People's Republic of China NY / T2954-2016: Technical Regulations for Identification of Resistance to Fusarium Head Blight of Wheat Regional Trial Varieties", and the average severity was calculated.

[0074] The KASP primer set obtained in Example 1 was used to genotype 63 wheat test lines planted in the Wantou Experimental Base in the middle and lower reaches of the Yangtze River by the Agricultural Science Institute of Lixiahe Region, Jiangsu Province in 2022. The average severity of the natural identification results of fusarium head blight in the field test in 2022 and the KASP test results are shown in Table 4 and Appendix Figure 2 The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered in the typing results. The fluorescence signal data were analyzed by Kluster Caller software and clustered in the same way as Yangmai No. 4, which proved that the genotype of these wheat lines at this site was T; if the fluorescence signal data of the amplified products of the wheat lines were analyzed by Kluster Caller software and clustered in the typing results, which were different from the Yangmai No. 4 typing results, it proved that the genotype of these wheat lines at this SNP site was C.

[0075] Table 4 Average severity and genotype detection results of 63 wheat lines

[0076]

[0077]

[0078] Table 5 Average severity T test results of tested strains carrying different genotypes

[0079]

[0080] The results of the two-sample T test in Table 5 using Excel 2019 show that in 2020, the average diseased spikelet rate of varieties with genotype T was 18.55% lower than that of varieties with genotype C. The T test result t=2.28, with a significant difference at the p<0.05 level, indicating that wheat with allele T has higher resistance to fusarium head blight than wheat with allele C. At the same time, it shows that the primer set and genotype detection system of the KASP marker KASP-4AL-Fhb can be applied to molecular marker-assisted selection breeding for wheat fusarium head blight resistance.

[0081] It can be concluded from the above experimental results that: by using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, the genotype at the site can be directly detected by KASP, the detection method is simple to operate, the detection result is very intuitive, the detection effect is obvious and effective, and the use of the molecular marker for screening can greatly improve the efficiency of molecular marker-assisted selection of wheat breeding with high and low resistance to ergot disease.

[0082] Unless otherwise specifically stated, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments may have different values.

Claims

1. A KASP molecular marker linked to the major QTL QFhb-yaas-4AL for wheat fusarium head blight resistance, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID No.

4.

2. A primer set for detecting whether the allele variation at position 23 in the nucleotide sequence shown in SEQ ID No. 4 of claim 1 is CC, TT, or C and T, characterized in that: The primer set contains two upstream primers and one downstream primer; The upstream primer is designed according to the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is C, and the 3' terminal deoxyribonucleotide of the other upstream primer is T; The downstream primer is designed according to the downstream sequence of the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome.

3. The primer set according to claim 2, characterized in that The nucleotide sequence of one upstream primer is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.

3.

4. The primer set according to claim 3, characterized in that: The 5' end of one of the upstream primers is connected to a fluorescent label sequence FAM, and the 5' end of the other upstream primer is connected to a fluorescent label sequence HEX.

5. A detection kit comprising the primer set according to any one of claims 2 to 4.

6. Use of the primer set according to any one of claims 2 to 4 or the kit according to claim 5 in any of the following: (A) identifying or assisting in identifying wheat resistance to fusarium head blight; (B) Comparing the resistance of wheat grains to fusarium head blight; (C) breeding or selecting wheat plants, strains, lines or varieties that are relatively resistant to ergot; (D) breeding or selecting wheat plants, strains, lines or varieties that are relatively less resistant to ergot; (E) preparing a product for comparing the resistance of wheat to fusarium head blight; (F) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to ergot; (G) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively weak resistance to Fusarium head blight.

7. Either of the following methods: Method A: A method for detecting whether the 23rd allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T, comprising the following steps (A1) or (A2): (A1) Direct sequencing; (A2) using the primer set of any one of claims 2 to 4 or the kit of claim 5 to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanned data, and then determining whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat gene to be tested is CC, TT, or C and T as follows: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a homozygous C; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as blue, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 of chromosome 4A in the wheat genome to be tested is a homozygous T; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is shown as green, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a hybrid of C and T; Method B: A method for comparing the resistance of wheat to fusarium head blight, comprising the following steps: (B1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T; (B2) determining the fusarium head blight resistance of the wheat to be tested as follows: the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is T is stronger than the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is C or a heterozygote of C and T; Method C: A method for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to scab, comprising the following steps: (C1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T; (C2) selecting a wheat plant to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome is T as a parent for breeding, and selecting a wheat plant in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome is T in each breeding generation, and finally obtaining a wheat plant or strain or variety with relatively strong ergot disease; Method D: A method for breeding or screening wheat plants, strains, lines or varieties with relatively weak resistance to ergot disease, comprising the following steps: (D1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T; (D2) selecting a wheat plant to be tested that is homozygous for C at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome as a parent for breeding, and selecting wheat plants that are homozygous for C at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome in each breeding generation, and ultimately obtaining wheat plants, strains, lines or varieties with relatively weak resistance to ergot disease.

8. The method according to claim 7, characterized in that: In the method B, the method C and the method D, the method for detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T is the method A.

9. Use of the KASP molecular marker according to claim 1, the primer set according to any one of claims 3 to 5, the kit according to claim 6, or the method according to any one of claims 7 to 8 in molecular marker-assisted breeding for wheat resistance to Fusarium head blight.

Images