Molecular marker for identifying wheat stem rot resistant genetic locus and application thereof

Abstract

The invention provides a molecular marker for identifying a wheat stalk rot resistant genetic locus and application thereof, and belongs to the technical field of wheat disease resistance breeding and molecular biology. The molecular marker 4AS-AX-111108057 which is closely linked with the wheat stalk rot resistance genetic locus Qfcr. Hebau-4AS is developed by virtue of 360 parts of wheat materials which have 15K SNP chip data at home and abroad and in combination with a Chinese spring reference sequence. By utilizing the molecular marker, different wheat can be accurately and rapidly detected, early molecular assisted selection of stem rot resistant germplasm materials is realized, and the wheat disease-resistant breeding efficiency is improved. The method solves the problem that the detection difficulty of the wheat stem rot resistance gene in the prior art is large, and is suitable for the field of molecular genetic breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat disease resistance breeding and molecular biology technology, and in particular relates to a dCAPS molecular marker and application thereof for detecting a wheat stem base rot resistance genetic locus Qfcr.hebau-4AS, and specifically relates to the screening and identification of closely linked SNP loci of stem base rot resistance of 360 common wheat germplasm resources at home and abroad, and the development and application of the dCAPS molecular marker thereof. Background Art

[0002] Common wheat (Triticum aestivum) is an important food crop worldwide. Its disease resistance and stable yield are of great significance to world food security and agricultural development. With the large-scale rotation of wheat and corn, the return of straw to the field, and the changes in the soil microenvironment, the damage of wheat crown rot has been increasing year by year, seriously threatening wheat yield and quality. Wheat crown rot (Fusarium crown rot, FCR) is a soil-borne disease caused by Fusarium spp. that occurs in many arid and semi-arid planting areas in the world. It was first discovered in Australia in 1951 (Magee C, Commonwealth Phytopathological News, 1957). It has occurred in countries such as Australia, Canada, China, New Zealand, North Africa, South Africa and the United States (Kazan K et al., Molecular Plant Pathology, 2018; Kumar J et al., Molecular Plant Pathology, 2002). Breeding disease-resistant varieties is still the most economical and environmentally friendly means to reduce the damage of crown rot. However, due to the control of relatively complex quantitative genetic loci (QTL), the genetic research on wheat resistance to stem rot is still relatively lagging, and disease-resistant germplasm resources are also in urgent need of exploration. Subsequently, my country began to screen wheat germplasm resources and disease-resistant genes for stem rot resistance. At present, our group has systematically sorted out the progress of genetic research on wheat resistance to stem rot. There are about 92 reported wheat stem rot resistance loci / genes, distributed on 19 chromosomes (Su Jun et al., Frontiers in Genetics, 2021).

[0003] Molecular markers usually refer to DNA molecular markers, which refer to the differences in DNA sequences between individuals or species, are close to or closely linked to the target gene expressing a certain trait, and do not affect the expression of the target gene. According to the detection method and development history, DNA molecular markers are divided into three categories: the first generation of molecular marker technology is based on molecular hybridization technology, such as restriction endonuclease fragment length polymorphism (RFLP); the second generation of molecular marker technology is based on PCR technology, such as random amplified polymorphic DNA markers (RAPD) and simple sequence repeats (SSR); the third generation of molecular marker technology is based on DNA sequences, such as single nucleotide polymorphisms (SNP) (Amiteye et al., 2021). With the application of second-generation sequencing and third-generation sequencing technologies, research on SSR and SNP molecular markers has gradually occupied a major position in plant research. Molecular marker-assisted selection breeding is one of the most important uses of molecular markers. Selecting phenotypes based on the genotypes of molecular markers can overcome the time-consuming and labor-intensive shortcomings of traditional breeding.

[0004] A simple method for detecting SNPs is to use restriction amplified polymorphic sequence (CAPS) markers or derived CAPS markers (dCAPS). Both methods combine PCR amplification with restriction digestion, using restriction endonucleases to identify the target SNP site sequence and perform digestion, followed by electrophoresis typing and identification. CAPS markers can be developed for SNP sequences with naturally occurring restriction sites, while dCAPS can be developed for SNPs with non-naturally occurring restriction sites by artificially introducing mutant bases. CAPS and dCAPS molecular markers have the characteristics of co-dominance, site specificity, simple operation, rapid detection, low cost, and independence from precision instruments and equipment, and can be used for rapid genotyping, positioning, genetic diversity analysis, and variety identification of plants.

[0005] Currently, there are few studies and reports on dCAPS molecular markers related to wheat stem rot resistance. Therefore, there is an increasing need to develop dCAPS molecular markers related to wheat stem rot and use them to accurately and rapidly identify stem rot resistance in wheat and its hybrid progeny. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a molecular marker for identifying wheat stem base rot resistance genetic loci and its application. The present invention uses 360 wheat materials at home and abroad with 15K SNP chip data, combined with the Chinese Spring reference sequence, to develop a molecular marker 4AS-AX-111108057 that is closely linked to the wheat stem base rot resistance genetic locus. The molecular marker can be used to accurately and quickly detect different wheats, realize the early molecular assisted selection of stem base rot resistance germplasm materials, and improve the efficiency of wheat disease resistance breeding. The present invention solves the problem of difficulty in detecting wheat stem base rot resistance genes in the prior art, and is suitable for the field of molecular genetic breeding.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] One of the purposes of the present invention is to provide an enzyme-amplified polymorphic sequence dCAPS molecular marker for detecting the wheat stem rot resistance genetic site Qfcr.hebau-4AS, the dCAPS molecular marker nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, the SNP site used to develop it is the 349299114th position on wheat chromosome 4A, and the polymorphism is G / A.

[0009] SEQ ID NO.1:

[0010] AGCTTTTGAAGTGAAGGTTGCATTC G GTGAATGGATAGCTGAGGAGGTCAC

[0011] SEQ ID NO.2:

[0012] AGCTTTTGAAGTGAAGGTTGCATTC A GTGAATGGATAGCTGAGGAGGTCAC

[0013] The second object of the present invention is to provide a specific primer pair for detecting the dCAPS molecular marker, wherein the specific primer sequences are shown in SEQ ID NO.3 to SEQ ID NO.4.

[0014] Forward primer: AGCTTTTGAAGTGAAGGTTGCACTC (SEQ ID NO.3)

[0015] Reverse primer: TTAACATAGACATCCGAGGAGACCG (SEQ ID NO. 4)

[0016] The third object of the present invention is to provide a synthetic primer kit for detecting the wheat stem rot resistance genetic locus Qfcr.hebau-4AS, which contains the specific primer pair.

[0017] Preferably, the synthetic primer kit also contains restriction endonuclease BseMII.

[0018] A fourth object of the present invention is to provide a method for screening and / or identifying strains containing or not containing the wheat stem rot resistance genetic locus Qfcr.hebau-4AS, the method being based on the dCAPS molecular marker and specifically comprising the following steps:

[0019] (1) Extracting the wheat genomic DNA to be tested;

[0020] (2) using the wheat genomic DNA to be tested as a template, and performing a PCR amplification reaction using the specific primer pair shown in SEQ ID NO.3 and SEQ ID NO.4;

[0021] (3) digesting the PCR amplification product with restriction endonuclease BseMII, and performing agarose gel electrophoresis on the digestion product;

[0022] (4) If the enzyme digestion product contains two main bands of 218 bp and 25 bp, and there is a sheet-like band in the range of 0-100 bp, then the wheat does not contain the stem rot resistance genetic locus Qfcr.hebau-4AS; if the enzyme digestion product contains only one main band of 243 bp, then the wheat contains the stem rot resistance genetic locus Qfcr.hebau-4AS.

[0023] Preferably, the PCR amplification reaction system is: 1 μL of genomic template with a concentration of 100 ng / μL, 1 μL of upstream primer with OD=0.1, 1 μL of downstream primer with OD=0.1, 7.5 μL of 2×RapidTaq Master Mix and 4.5 μL of ddH2O.

[0024] More preferably, in the method, the spotting volume in agarose gel electrophoresis is 5 μL, and the electrophoresis conditions are 65 V, 110 mA, and 50 min.

[0025] Preferably, the PCR amplification conditions are: pre-denaturation at 94°C for 5 min, cycle parameters are denaturation at 94°C for 30 s, annealing at 63.8°C for 30 s, extension at 72°C for 15 s, 35 cycles, and full extension at 72°C for 10 min.

[0026] More preferably, in the method, the spotting volume in agarose gel electrophoresis is 5 μL, and the electrophoresis conditions are 65 V, 110 mA, and 50 min.

[0027] The above PCR amplification efficiency is high, the electrophoresis results have few mixed bands, and the system is relatively optimized.

[0028] A fifth object of the present invention is to provide an application of the dCAPS molecular marker, the SNP site, the specific primer pair, the synthetic primer kit or the method in wheat breeding.

[0029] The sixth object of the present invention is to provide an application of the dCAPS molecular marker, the SNP site, the specific primer pair, the synthetic primer kit or the method in detecting, screening and / or identifying the presence or absence of the wheat stem rot resistance genetic site Qfcr.hebau-4AS.

[0030] The seventh object of the present invention is to provide an application of the dCAPS molecular marker, the SNP site, the specific primer pair, the synthetic primer kit or the method in molecular marker-assisted breeding for wheat resistance to stem rot.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The dCAPS molecular marker of the present invention can be used to quickly and accurately detect wheat stem base rot resistance lines (the time is short, and the results can be obtained within a few hours), greatly improving the detection accuracy and shortening the detection time, and can accelerate the disease breeding process of wheat stem base rot resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The Manhattan plot of the genome-wide association analysis of the genetic loci for resistance to stem rot of 360 domestic and foreign wheat materials in Example 1 of the present invention;

[0034] Figure 2 The agarose gel electrophoresis results of PCR amplification of 7 disease-resistant materials and 7 susceptible materials of 360 domestic and foreign wheats using dCAPS primers in Example 2 of the present invention, wherein: M is DL2000 Marker, R is disease-resistant material, S is susceptible material, and when the molecular marker is 4AS-AX-111108057, the length of the amplified product is 243 bp;

[0035] Figure 3 The agarose gel electrophoresis results of the PCR products of the 7 disease-resistant materials and the 7 disease-susceptible materials in Example 2 of the present invention after being digested with the corresponding restriction endonucleases, wherein: M is a DL2000 Marker, R1-R7 represent the electrophoresis results of the PCR products of the materials resistant to stem base rot after digestion, and S1-S7 represent the electrophoresis results of the PCR products of the materials susceptible to stem base rot after digestion;

[0036] Figure 4The results of agarose gel electrophoresis after PCR amplification of other wheat materials WATAN-7 / SEKHRAH-2 (R1'), ATTILA 50Y / / ATTILA / BCN / 3 / KAPSW / SHUHA-17 (R2'), Qingfeng No. 1 (R3'), ROANE (R4'), Yangmai 17 (R5'), Xiaoyan 22 (R6'), Xinchun No. 8 (R7'), Wannian No. 2 (S1'), HUBARA-5 / ANGI-1 (S2'), Heng 136 (S3'), Yumai 48 (S4'), Hengguan 35 (S5'), Yangmai 18 (S6'), Xinyang 12 (Xianmai No. 12) (S7') in Example 3, wherein: M is DL2000 Marker, R' is disease-resistant material, S' is disease-susceptible material (other wheat materials are divided into R' and S' according to the enzyme digestion results). When the molecular marker is 4AS-AX-111108057, the length of the amplified product is 243 bp;

[0037] Figure 5 It is the agarose gel electrophoresis result of the PCR products of the susceptible material and the disease-resistant material in Example 3 of the present invention after being digested with the corresponding restriction endonucleases, wherein: M is the D2000 Marker, R' represents the electrophoresis result of the PCR product of the material resistant to stem base rot after digestion, and S' represents the electrophoresis result of the PCR product of the material susceptible to stem base rot after digestion. DETAILED DESCRIPTION

[0038] The following examples will further illustrate the specific steps and features of the invention, which are only used for illustration and are not intended to limit the present invention. The methods used in the present invention are conventional methods in the art unless otherwise specified. The reagents and materials involved in the present invention are commercially available unless otherwise specified.

[0039] The present invention is further described in detail below with reference to the embodiments and drawings:

[0040] Example 1 Obtaining tightly linked SNP loci for wheat resistance to stem rot

[0041] Taking Fusariumpseudograminearum as the pathogen, the method of inoculating wheat grain culture medium after indoor plug tray planting was adopted to identify the disease resistance of 360 domestic and foreign wheat materials in the greenhouse of Hebei Agricultural University. First, the wheat seeds and 32-hole plug trays were disinfected. Then, the nutrient soil and vermiculite were mixed in a ratio of 2:1, and the 32-hole plug trays were covered with the mixed nutrient soil. Then a 2-3 cm small hole was dug in each hole. Eight seeds with full grains were selected for each wheat variety and placed in the 32-hole plug tray in a straight line. F. graminearum was inoculated at the base of the wheat stem. Eight seeds of each wheat germplasm were mixed with three pieces of wheat grain culture medium inoculated with F. graminearum. Controls were placed in two appropriate holes in the middle and labels were inserted to record the variety number and planting date. Then, each hole was evenly covered with nutrient soil, and the 32-hole plug tray was placed on a tray, and water was poured to allow it to absorb water naturally to keep the soil in the plug tray moist. The material was placed in a greenhouse and cultured under a controlled temperature of 25°C and a 13h light / 11h dark cycle. The wheat was allowed to grow naturally for about 10 days. When the wheat seedlings grew to one heart and one leaf, a second inoculation was performed. Three pieces of wheat grain culture medium inoculated with F. graminearum were sprinkled on the base of the wheat stem and covered with soil, waiting for the wheat to become diseased. The grading of seedling identification in this study adopted the 0-9 grade grading method (Li X et al., Journal of Phytopathology, 2008). The resistance to stem base rot was evaluated for 360 common wheat germplasm resources at home and abroad, and it was found that only about 6.39% of the wheat materials showed a high level of resistance to stem base rot.

[0042] Combined with the existing 15K SNP chip data of the above materials, a genome-wide association study (GWAS) was conducted on the genetic loci of wheat resistance to stem rot. The Manhattan plot of the genome-wide association analysis of the genetic loci of wheat resistance to stem rot in 360 domestic and foreign wheat materials is shown in the figure below: Figure 1 As shown. Finally, 10 high-confidence linked SNP sites were obtained, of which 5 SNPs were adjacently distributed in the physical segment of chromosome 4AS with a length of about 36.58Mb, named as wheat stem rot resistance genetic locus Qfcr.hebau-4AS. Haplotype analysis was performed on the 5 SNPs, and dCAPS molecular marker primers were designed to amplify the SNPs significantly associated with the stem rot resistance genetic locus Qfcr.hebau-4AS in this region. According to the amplification results, one SNP suitable for the development of dCAPS markers was finally screened out: 4AS-AX-111108057, which is located at the physical position of 349299114bp, with a reference genome base of G and a mutant base of A, and a P value of 9.56E-04. These mutations are significantly different in disease-resistant and disease-susceptible wheat. Therefore, based on the whole genome association analysis, it is predicted that the SNP site 4AS-AX-111108057 is significantly associated with wheat stem rot resistance.

[0043] Example 2 Development of tightly linked dCAPS molecular markers for wheat stem rot resistance

[0044] 1. Design of dCAPS Primers

[0045] According to the SNP site provided in Example 1, adjacent sequences were extracted from the Chinese Spring genome, and dCAPS primer pairs were designed using dCAPS Finder2.0 (http: / / helix.wustl.edu / dcaps / ):

[0046] Forward primer: AGCTTTTGAAGTGAAGGTTGCACTC (SEQ ID NO.3)

[0047] Reverse primer: TTAACATAGACATCCGAGGAGACCG (SEQ ID NO. 4)

[0048] The PCR amplification product based on this primer pair is 243 bp, and its sequence is shown in SEQ ID NO.1 or SEQ ID NO.2. The 26th position of the sequence is G / A, which is a polymorphic site. Resequencing data analysis revealed that this site has two genotypes, G and A, where the genotype A can be cleaved by enzymes, while the genotype G cannot be cleaved by enzymes.

[0049] SEQ ID NO.1:

[0050] AGCTTTTGAAGTGAAGGTTGCATTC G GTGAATGGATAGCTGAGGAGGTCAC

[0051] SEQ ID NO.2:

[0052] AGCTTTTGAAGTGAAGGTTGCATTC A GTGAATGGATAGCTGAGGAGGTCAC

[0053] 2. Extraction and PCR amplification of sample genomic DNA

[0054] Seven susceptible materials were selected (S1-S7 were Yumai 47 (Fengyou 3), PRL / 2*PASTOR / 3 / KS82W409 / SPN / / TAM106 / TX78V3630, NIKIFOR / / KROSHKA, ZUBKOV / MV14-2000, MON / IMU / / ALD / PVN / 3 / BORL95 / 4 / OASIS / 2*BORL95 / 5 / KS920946-B-16-1-1 / OVL, FRET2 / KIRITATI / 3 / KS940786-17-2 / JAG / / TREGO / 4 / KS Genomic DNA was extracted from young leaves of wheat (94U415 / CRR(OK06629), KINGBIRD / GREER'S') and seven disease-resistant materials (R1-R7 were Yumai 21, Xumai 9128, Yumai 63, Shumai 482, URUP, SUNCO / 2*PASTOR / / TX91D6913 / B1551W / 3 / DUSTER / OK99711(OK07214), SUNCO.6 / / TNMU / TUI / 3 / TX91D6991 / B1551 / 4 / GREER'S') for subsequent dCAPS molecular marker development experiments;

[0055] DNA extraction method:

[0056] 1. Sample one wheat leaf in the greenhouse, cut it into small pieces, and place it in a 2mL centrifuge tube (if not extracted immediately, store it at -80℃);

[0057] 2. Add a grinding bead to each centrifuge tube, cool it in liquid nitrogen, and then put it into the freezer grinder (pay attention to balancing). Set the temperature of the freezer grinder to -50℃, set the frequency to 70Hz, the working time to 70S, the interval time to 8S, and the number of cycles to 3 times. After grinding, take it out, check whether it is completely ground, and record it;

[0058] 3. Add 600 μL of DNA extraction buffer to each tube (to fully expose the DNA of the ground tissue), shake thoroughly, and place in a 65°C water bath for 30 minutes;

[0059] 4. Take it out and place it on ice for 15 minutes, cool it to room temperature, add 300 μL of 6 mol / L ammonium acetate, mix well, and place it in a 4°C refrigerator for 15 minutes;

[0060] 5. Centrifuge at 12000 rpm for 5 min and take 600 μL of supernatant;

[0061] 6. Add 360 μL of isopropanol to a new 1.5 mL centrifuge tube, take 600 μL of the supernatant from the previous step and add it to mix well, let the DNA precipitate, and place it in a 4°C refrigerator for 5 minutes;

[0062] 7. Centrifuge at 12000rpm for 15min to precipitate the DNA and aspirate the supernatant (this step should not take too long to prevent DNA loss);

[0063] 8. Add 500 μL of 75% alcohol to clean the DNA, bounce the DNA from the bottom of the tube to clean it;

[0064] 9. Centrifuge at 12000 rpm for 1 min and discard the supernatant;

[0065] 10. Repeat steps 8 and 9 once;

[0066] 11. Aspirate the supernatant, place the 1.5 mL centrifuge tube in the clean bench, open the lid, blow dry;

[0067] 12. Use 100μL of sterile water to dissolve the DNA. Leave it at room temperature for half a day until the DNA at the bottom dissolves at room temperature.

[0068] The extracted sample DNA was diluted to a concentration of 100 ng / μL as a template, and the PCR reaction system (15 μL) was constructed according to the following conditions: 1 μL of genomic template, 1 μL of upstream primer with OD = 0.1, 1 μL of downstream primer with OD = 0.1, 7.5 μL of 2× Rapid Taq Master Mix, and 4.5 μL of ddH2O.

[0069] The PCR amplification program for 4AS-AX-111108057 was as follows: pre-denaturation at 94°C for 5 min, cycle parameters were denaturation at 94°C for 30 s, annealing at 63.8°C for 30 s, extension at 72°C for 15 s, for 35 cycles, and full extension at 72°C for 10 min.

[0070] After amplification, the amplified products were stored at 4°C. The amplified products were tested by 1% agarose gel electrophoresis and photographed under a UV gel imaging system. Figure 2 shown.

[0071] Depend on Figure 2 It can be seen that all samples of 4AS-AX-111108057 obtained an amplification product of 243 bp.

[0072] 3. Identification of material amplification products

[0073] The genomic DNA extracted above was amplified using TIANGEN's 2×Taq PCR Mix, and the primers used were the above-mentioned dCAPS molecular marker primer pair. The amplification system (15 μL) was: 2×Taq PCR Mix 7.5 μL, template DNA 1 μL, upstream primer 1 μL with OD=0.1, downstream primer 1 μL with OD=0.1, and ddH2O 4.5 μL. The amplification procedures were consistent with the above-mentioned amplification procedures.

[0074] Some PCR amplification products were selected and sent to the sequencing department of Bioengineering for sequencing. The results showed that there were differences in the 4AS-AX-111108057 sequences of the resistant and susceptible materials. The resistant materials had genotype G, and the susceptible materials had genotype A.

[0075] IV. Enzyme Digestion

[0076] The PCR product of 4AS-AX-111108057 obtained in step 2 of this example was digested with restriction endonuclease BseMII from Thermo Fisher, and the digestion system (15 μL) was as follows: 7 μL of PCR product, 1 μL of 10×TangoBuffer, 0.5 μL of Aat II, and 6.5 μL of ddH2O. The digestion conditions were: 55°C and 3 h of digestion time.

[0077] The above enzyme digestion products were subjected to 3% polyacrylamide gel electrophoresis, with a sample volume of 15 μL and electrophoresis conditions of 65 V, 100 mA, and 50 min. Figure 3 ) were subjected to electrophoresis respectively.

[0078] comprehensive Figure 2 and Figure 3 It was found that the PCR product (R) of the resistant material marked with 4AS-AX-111108057 and the PCR product (S) of the susceptible material were both 243 bp. After BseMII digestion, the agarose gel electrophoresis results of the resistant material (R1-R7) had a main band of 243 bp; the agarose gel electrophoresis results of the susceptible material (S1-S7) had a main band of 218 bp (the main band was obviously smaller than 243 bp) and a short band of 25 bp, and there was a sheet-like band in the range of 0-100 bp.

[0079] The results showed that when the genotype was A, that is, the susceptible genotype, the amplified product could be digested by enzyme, and after digestion there was a main band of 218bp and a short band of 25bp (the short band was not obvious, the main band of 218bp was smaller than the band of 243bp after digestion of the resistant material, and there was a piece of band in the range of 0-100bp); when the genotype was G, that is, the resistant genotype, under the same conditions, BseMII could not digest its PCR product, and after digestion there was only a main band of 243bp.

[0080] The above results show that the AX-111108057 genotypes of the resistant and susceptible materials are consistent with the genome and resequencing data. Amplification using the dCAPS molecular marker primers in the patent application of this invention, combined with the enzyme digestion results of BseMII, can accurately distinguish the different genotypes of the resistant and susceptible materials.

[0081] Example 3 Verification Experiment

[0082] Other wheat materials other than the 14 research materials, including WATAN-7 / SEKHRAH-2 (R1'), ATTILA 50Y / / ATTILA / BCN / 3 / KAPSW / SHUHA-17 (R2'), Qingfeng 1 (R3'), ROANE (R4'), Yangmai 17 (R5'), Xiaoyan 22 (R6'), Xinchun 8 (R7'), Wannian 2 (S1'), HUBARA-5 / ANGI-1 (S2'), Heng 136 (S3'), Yumai 48 (S4'), Hengguan 35 (S5'), Yangmai 18 (S6'), and Xinyang 12 (Xianmai 12) (S7'), were selected to verify the dCAPS molecular markers. The method was consistent with parts 3 and 4 of Example 2. The amplification results are shown in Figure 2. Figure 4 As shown, the enzyme digestion results are as follows Figure 5 As shown, the experimental results are consistent with the conclusions.

[0083] In summary, the dCAPS molecular marker designed for this SNP site in the present invention can be effectively used for the molecular identification of wheat varieties with different resistance to stem rot. The development of the dCAPS molecular marker can significantly shorten the breeding period and reduce the cost of breeding work, which is of great significance in the use of wheat germplasm resources to cultivate wheat varieties resistant to stem rot.

[0084] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A restriction endonuclease-amplified polymorphic sequence dCAPS molecular marker for detecting the wheat stem rot resistance genetic locus Qfcr.hebau-4AS, characterized in that: The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, the SNP site used to develop it is the 349299114th position on the wheat 4A chromosome, and the polymorphism is G / A.

2. A specific primer pair for detecting the dCAPS molecular marker described in claim 1, characterized in that: The primer sequences are shown in SEQ ID NO.3 to SEQ ID NO.

4.

3. A synthetic primer kit for detecting wheat stem rot resistance genetic locus Qfcr.hebau-4AS, characterized in that: It contains the specific primer pair described in claim 2.

4. The synthetic primer kit according to claim 3, characterized in that It also contains the restriction endonuclease BseMII.

5. A method for screening and / or identifying strains containing or not containing the wheat stem rot resistance genetic locus Qfcr.hebau-4AS, characterized in that: The method is based on the dCAPS molecular marker described in claim 1, and specifically comprises the following steps: (1) Extracting wheat genomic DNA to be tested; (2) using the wheat genomic DNA to be tested as a template, and performing a PCR amplification reaction using the specific primer pair shown in SEQ ID NO.3 and SEQ ID NO.4; (3) digesting the PCR amplification product with restriction endonuclease BseMII, and performing agarose gel electrophoresis on the digestion product; (4) If the enzyme digestion product contains two main bands of 218 bp and 25 bp, and there is a sheet-like band in the range of 0-100 bp, then the wheat does not contain the stem rot resistance genetic locus Qfcr.hebau-4AS; if the enzyme digestion product contains only one main band of 243 bp, then the wheat contains the stem rot resistance genetic locus Qfcr.hebau-4AS.

6. The method according to claim 5, characterized in that The PCR amplification reaction system is: 1 μL of genomic template with a concentration of 100 ng / μL, 1 μL of upstream primer with an OD=0.1, 1 μL of downstream primer with an OD=0.1, 7.5 μL of 2×RapidTaq MasterMix and 4.5 μL of ddH2O.

7. The method according to claim 6, characterized in that The PCR amplification conditions were as follows: pre-denaturation at 94°C for 5 min, cycle parameters of denaturation at 94°C for 30 s, annealing at 63.8°C for 30 s, extension at 72°C for 15 s, 35 cycles, and full extension at 72°C for 10 min.

8. Use of the dCAPS molecular marker of claim 1, the SNP site of claim 1, the specific primer pair of claim 2, the synthetic primer kit of any one of claims 3 to 4, or the method of any one of claims 5 to 7 in wheat breeding.

9. Use of the dCAPS molecular marker described in claim 1, the SNP site described in claim 1, the specific primer pair described in claim 2, the synthetic primer kit described in any one of claims 3 to 4, or the method described in any one of claims 5 to 7 in detecting, screening and / or identifying the presence or absence of the wheat stem rot resistance genetic locus Qfcr.hebau-4AS.

10. Use of the dCAPS molecular marker described in claim 1, the SNP site described in claim 1, the specific primer pair described in claim 2, the synthetic primer kit described in any one of claims 3 to 4, or the method described in any one of claims 5 to 7 in molecular marker-assisted breeding for wheat resistance to stem base rot.

Images