Molecular marker for rapidly identifying transverse diameter of cucumber fruit, identification method and application

Abstract

The invention discloses a molecular marker for rapidly identifying the transverse diameter of a cucumber fruit, an identification method and application, and belongs to the technical field of cucumber fruit shape identification. The invention provides two molecular markers T6-1 and W6-4 which are closely linked with the transverse diameter of a cucumber fruit, the T6-1 and the W6-4 are located in a chromosome 6, and the physical distance is 141.89 kb; the small-transverse-diameter fruits are exchanged between the molecular markers T6-1 and W6-4, the genotype of the molecular markers T6-1 and W6-4 in a long-fruit inbred line is set as AA, the genotype of the molecular markers W6-1 and W6-4 in a round-fruit inbred line is set as BB, the bands of the molecular markers T6-1 and W6-4 in the small-transverse-diameter fruits are set as AB or BA, and the bands of the molecular markers T6-1 and W6-4 in the large-transverse-diameter fruits are set as BB; by adopting the molecular marker and the identification method provided by the invention, the transverse diameter of the cucumber fruit in the commercial melon period can be rapidly detected in the seedling stage, the identification time is greatly shortened, the identification cost is saved, and the identification result is not influenced by environmental factors and is stable and reliable; the method has important significance in simplifying cucumber shape breeding work and promoting cucumber shape breeding process.

Description

Technical Field

[0001] The invention relates to the technical field of cucumber fruit shape identification, and in particular to a molecular marker for rapidly identifying the transverse diameter of cucumber fruits, an identification method and an application thereof. Background Art

[0002] Cucumber (Cucumissativus L.) has a crisp taste and is rich in various vitamins needed by the human body. It has the effects of beautifying and anti-aging. It is deeply loved by consumers of all ages. It is an important economic crop of the genus Muskmelon in the Cucurbitaceae family and is widely planted around the world. Among them, my country is the world's largest cucumber planting and producing country.

[0003] As people's living standards improve, the demand for high-quality vegetables is increasing, and the importance of vegetable appearance quality is also increasing. Fruit shape is an important appearance quality trait of cucumbers, which is usually determined by the fruit shape index, which is the fruit longitudinal diameter / fruit transverse diameter. The fruit shape of cucumbers will have a significant impact on the commerciality and yield of cucumbers, and will also affect their grading in the market.

[0004] Fruit shape is a quantitative genetic trait, with major effect genes and multiple minor effect genes acting synergistically. Unlike quality traits, cucumber fruit shape is not only affected by genetic factors, but also by external environmental conditions such as temperature and humidity, soil conditions, pests and diseases, and pollination. This further increases the difficulty of locating genes related to fruit shape. At present, most studies on cucumber fruit shape remain at the level of rough positioning, and only a small number of related genes have been successfully cloned. Therefore, the development of molecular markers that are closely linked to fruit shape can realize the identification of cucumber fruit shape at the seedling stage, which is of great significance for simplifying cucumber fruit shape breeding and promoting the breeding process of cucumber fruit shape. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker, identification method and application for rapid identification of the transverse diameter of cucumber fruit, so as to realize the seedling identification of cucumber fruit shape, greatly shorten the identification time and cost, and thus help simplify the cucumber fruit shape breeding work and promote the cucumber fruit shape breeding process.

[0006] To achieve the above object, the present invention provides a molecular marker for rapidly identifying the transverse diameter of cucumber fruit, the molecular markers being T6-1 and W6-4; the upstream primer sequence of the molecular marker W6-4 is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2; the upstream primer sequence of the molecular marker T6-1 is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.14.

[0007] Preferably, molecular markers T6-1 and W6-4 are located on chromosome 6, T6-1 is located at 15.18 Mb, W6-4 is located at 15.32 Mb, and the physical distance is 141.89 kb.

[0008] Preferably, an exchange occurs between the molecular markers T6-1 and W6-4 in fruits with a small transverse diameter, and the genotypes of the molecular markers T6-1 and W6-4 in the long-fruit inbred line are set to AA, and the genotypes of the round-fruit inbred line are set to BB. The bands of the molecular markers T6-1 and W6-4 in fruits with a small transverse diameter are AB or BA, and in fruits with a large transverse diameter are BB.

[0009] Preferably, a fruit with a thin transverse diameter refers to a fruit with a fruit shape index greater than 1.10, and a fruit with a thick transverse diameter refers to a fruit with a fruit shape index less than 1.10.

[0010] Preferably, the fruit shape index = fruit longitudinal diameter / fruit transverse diameter, the fruit longitudinal diameter is the length from the connection between the cucumber stalk and the fruit to the top of the fruit, and the fruit transverse diameter is the diameter of the cucumber fruit at the center.

[0011] A method for rapidly identifying the transverse diameter of cucumber fruit, using the above molecular markers for identification, the steps are as follows:

[0012] S1. Extracting genomic DNA from the cucumber plants to be tested;

[0013] S2, using the DNA solution obtained in step S1 as a template, preparing a reaction system and performing PCR amplification;

[0014] S3. Perform electrophoresis on the amplified product, read the electrophoresis band information, and determine whether the fruits of the cucumber plant to be tested in the commercial period are thin-diameter fruits or thick-diameter fruits.

[0015] Preferably, the reaction system in step S2 is prepared according to the instructions attached to the Taq enzyme.

[0016] Preferably, the PCR amplification program in step S2 is 94°C, 5 min; 94°C, 30 s, Tm, 30 s, 72°C, 10 s, 35 cycles; 72°C, 10 s; 72°C, 10 min, Tm is 50-60°C.

[0017] The invention relates to an application of a molecular marker for rapidly identifying the transverse diameter of cucumber fruit as described above in the breeding of cucumber fruit shape varieties.

[0018] Therefore, the molecular marker, identification method and application for rapid identification of cucumber fruit transverse diameter provided by the present invention have the following specific technical effects:

[0019] (1) The present invention provides two molecular markers closely linked to the transverse diameter of cucumber fruits, namely, T6-1 and W6-4. T6-1 and W6-4 are located on chromosome 6, with a physical distance of 141.89 kb. Fruits with thin transverse diameters exchange between molecular markers T6-1 and W6-4. The genotypes of molecular markers T6-1 and W6-4 in long-fruit inbred lines are set to be AA, and the genotypes of round-fruit inbred lines are set to be BB. The bands of molecular markers T6-1 and W6-4 in fruits with thin transverse diameters are AB or BA, and in fruits with thick transverse diameters, they are BB.

[0020] (2) By using the molecular markers and identification method provided by the present invention, the horizontal diameter of cucumber fruits in the commercial melon period can be quickly detected at the seedling stage, which greatly reduces the identification time and saves the identification cost. In addition, the identification results are not affected by environmental factors and are stable and reliable. This is of great significance for simplifying the cucumber fruit shape breeding work and promoting the cucumber fruit shape breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0022] Figure 1 These are fruit phenotype photos of the parents CNS21 and RNS7 on the day of flowering (a), at the commercial melon stage (b), and at the mature melon stage (c) in Example 1 of the present invention;

[0023] Figure 2 It is a technical roadmap for constructing a cucumber chromosome segment replacement line in Example 1 of the present invention;

[0024] Figure 3 It is a replacement fragment information diagram of the BC4F2 population in Example 1 of the present invention;

[0025] Figure 4 The positions of the interval defined by the molecular markers M6-4 to M6-6 on the chromosome in Example 2 of the present invention (a), the photos of the fruits of CSSL6-3 on the day of flowering (b), the commercial melon period (c), and the ripe melon period (d), and the photos of the fruits of RNS7 on the day of flowering (e), the commercial melon period (f), and the ripe melon period (g); the scale bars in the figures are all 1 cm;

[0026] Figure 5The statistical results are as follows: fruit length (a), fruit diameter (b), and fruit shape index (c) of CSSL6-3 and RNS7 on the flowering day, fruit length (d), fruit diameter (e), and fruit shape index (f) of commercial melons, and fruit length (g), fruit diameter (h), and fruit shape index (i) of mature melons in Example 2 of the present invention;

[0027] Figure 6 It is a growth curve diagram of the fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of CSSL6-3 and RNS7 in Example 2 of the present invention;

[0028] Figure 7 These are fruit photos of RNS7 on the day of flowering (a), commercial melon stage (b), and ripe melon stage (c) and Csfd6.3-NIL on the day of flowering (d), commercial melon stage (e), and ripe melon stage (f) in Example 3 of the present invention; the scale bars in the figures are all 3 cm;

[0029] Figure 8 The statistical results of the fruit length (a), fruit diameter (b), and fruit shape index (c) of Csfd6.3-NIL and RNS7 on the flowering day, the fruit length (d), fruit diameter (e), and fruit shape index (f) of the commercial melon period, and the fruit length (g), fruit diameter (h), and fruit shape index (i) of the mature melon period in Example 3 of the present invention;

[0030] Fig. 9 It is a growth curve diagram of fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of Csfd6.3-NIL and RNS7 in Example 3 of the present invention;

[0031] Fig.10 The diagram is a position diagram of the replacement fragment on the chromosome of the CSSL6-3 strain in Example 4 of the present invention (a), and a diagram of the relative positions of markers T6-1 and W6-4 on the chromosome and information of the replacement fragment in the exchange plant (b);

[0032] Fig.11 It is a partial electrophoresis diagram when using markers T6-1 (a) and W6-4 (b) to screen 1000 BC4F3 populations and 600 self-pollinated progeny populations in Example 4 of the present invention; wherein C is CNS21, R is RNS7, 1 is the 60-11-71 strain, 2 is the 60-11-60 strain, 3 is the 60-11-29 strain, 4 is the 60-11-19 strain, 5 is the 60-11-44 strain, 6 is the 60-11-46 strain, and 7 is the electrophoresis result of the 60-11-34 strain;

[0033] Fig.12These are photos of fruits of the commercial melons of strain 60-11-71 (a), strain 60-11-60 (b), strain 60-11-29 (c), strain 60-11-19 (d), strain 60-11-44 (e), strain 60-11-46 (f), and strain 60-11-34 (g) in Example 4 of the present invention; wherein the pink tags used as reference are all 2.5 cm×2.5 cm. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0035] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0036] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0037] The method steps not described in detail in the embodiment are conventional technical means in this field, wherein the parents and each strain are planted in the No. 9 solar greenhouse of the Horticultural Experiment Station of the South Campus of Shandong Agricultural University, and each exchange individual is numbered and listed, and each plant retains 2-3 melons, and the root melon is removed in time. Artificial pollination and listing are carried out on the day of flowering, and the horizontal and vertical diameters of the fruit are measured using a vernier caliper with a range of 150 mm. From the day of flowering (0DAA) to the ripe melon period (22DAA), the horizontal and vertical diameters of the fruit need to be counted every day. The commercial melon period refers to 12DAA, the vertical diameter of the fruit is the length value from the connection between the fruit handle and the fruit to the top of the fruit, and the horizontal diameter of the fruit is the measurement data of the center position of the fruit. Fruit shape index = fruit vertical diameter / fruit horizontal diameter (L / D). Data analysis and statistics are performed in Microsoft Excel 2019 using functions such as STDEV.S and TTEST.

[0038] The PCR and amplification systems in the examples were prepared according to the instructions attached to the Taq enzyme. The amplification conditions were: 94°C, 5 min; (94°C, 30 s; Tm, 30 s; 72°C, 10 s;) 35 cycles; 72°C, 10 s; 72°C, 10 min. Tm was 50-60°C, of ​​which Tm of T6-1 was 55°C and Tm of W6-4 was 50°C.

[0039] Embodiment 1

[0040] The specific steps for constructing cucumber chromosome segment replacement lines are as follows:

[0041] (1) Parental origin and trait information. The long-fruit inbred line CNS21 was used as the donor parent, and the round-fruit inbred line RNS7 was used as the recipient parent. The long-fruit inbred line CNS21 is a long-stick cucumber selected from the hybrid offspring of two North China types of cucumbers, and was donated by Associate Professor Cao Chenxing of the College of Horticultural Science and Engineering of Shandong Agricultural University. The round-fruit inbred line RNS7 is a nearly round cucumber applied for from the National Germplasm Resource Bank. The number of the National Germplasm Center is V05A0941. Both the long-fruit inbred line CNS21 and the round-fruit inbred line RNS7 have been self-pollinated for more than 10 generations and are homozygous.

[0042] Fruits of the long-fruited inbred line CNS21 and the round-fruited inbred line RNS7 on the day of flowering (a), at the commercial fruit stage (b), and at the mature fruit stage (c) Figure 1 As shown, CNS21 and RNS7 have obvious differences in fruit shape. During the commercial melon period, the fruit length (L) of RNS7 is about 5-6 cm, and the fruit shape index (fruit length / fruit transverse diameter, L / D) is about 1; the fruit length of CNS21 is 35-40 cm, and the fruit shape index is about 10.

[0043] (2) Genome resequencing of CNS21 and RNS was performed to obtain sites with insertion or deletion (InDel) of 25 to 40 bp between the parents. The sequences of the differential sites were found through the cucumber genome website (http: / / cucurbitgenomics.org / organism / 20), and fragments about 400 bp upstream and downstream of the sites were cut and preserved. InDel marker primers were designed using Primer 5 (www.premierbiosoft.com) and DNAMAN (https: / / www.lynnon.com) to ensure primer specificity. The primer length was 20 to 25 bp, the amplified fragment size was between 200 and 300 bp, and the molecular markers covered the entire genome.

[0044] (3) Construction of cucumber chromosome segment replacement lines, technical routes such as Figure 2 As shown, the long-fruit inbred line CNS21 and the round-fruit inbred line RNS7 were hybridized to obtain the F1 generation, and then RNS7 was used as the recurrent parent to hybridize with the F1 to obtain the BC1F1 population. Thereafter, RNS7 was still used as the recurrent parent to hybridize with the BC1F1 population to obtain the BC2F1 population, which was then hybridized with the BC2F1 population to obtain the BC3F1 population, which was then hybridized with the BC3F1 population to obtain the BC4F1 population. The BC4F1 population itself obtained the BC4F2 population. During this period, the molecular markers developed in step (2) were continuously used for screening to ensure that the replacement fragments covered the entire cucumber genome. The replacement fragment information of the BC4F2 population is shown in FIG. Figure 3As shown, the white area represents the homologous segment of the RNS7 allele, the black area represents the homologous segment of the donor CNS21 allele, and each horizontal axis represents a strain.

[0045] Embodiment 2

[0046] Determine the target fragment and examine the relevant strain characteristics, as follows:

[0047] (1) Determine the target fragment. During the cultivation of the BC4F2 population, a cucumber fruit transverse diameter (D) line was found to be smaller, named CSSL6-3. It was found that this line only contained a homozygous fragment of the long-fruited inbred line CNS21 in the interval of markers M6-4 (the upstream primer sequence is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2) to M6-6 (the upstream primer sequence is shown in SEQ ID NO.5, and the downstream primer sequence is shown in SEQ ID NO.6) on chromosome 6, with a physical distance of 2.16 Mb. The rest of the fragment was replaced by the fragment of the recipient parent RNS7 (such as Figure 4 The pictures of fruits of CSSL6-3 and RNS7 on the day of flowering, commercial melon stage, and mature melon stage are shown in Figure 1. Figure 4 As shown in the bg part.

[0048] (2) Fruit traits of CSSL6-3 at different developmental stages compared with RNS7. The fruit transverse diameter, fruit longitudinal diameter and fruit shape index at different fruit developmental stages (flowering day, commercial melon stage, and mature melon stage) were measured and the data were statistically analyzed. Figure 5 The results showed that on the day of flowering, there were no significant differences in the fruit diameters and fruit shape index between CSSL6-3 and RNS7 ( Figure 5 a~c parts). In the commercial melon period, the longitudinal diameters of the fruits of CSSL6-3 and RNS7 were 56.13±4.77mm and 53.29±4.62mm, respectively. CSSL6-3 was slightly higher than RNS7 but there was no significant difference. The transverse diameter of the fruit of CSSL6-3 was significantly lower than that of RNS7, which were 46.75±3.72mm and 53.27±4.88mm, respectively. The fruit shape index of CSSL6-3 (1.21) was significantly higher than that of RNS7 (1.00). This shows that in the commercial melon period, there is a significant difference in the transverse diameters of CSSL6-3 and RNS7 ( Figure 5 It was also found that the changes in fruit diameter, fruit diameter, and fruit shape index during the ripe melon period were similar to those during the commercial melon period ( Figure 5During the ripening period, there was no significant difference in the longitudinal diameter of the fruit between CSSL6-3 and RNS7, but the transverse diameter of the fruit of CSSL6-3 was significantly lower than that of RNS7, which were 77.49±6.78 mm and 88.58±7.73 mm, respectively. The fruit shape index of CSSL6-3 (1.02) was significantly higher than that of RNS7 (0.92).

[0049] (3) Compared with RNS7, the fruit growth changes of CSSL6-3 during the entire growth period. The vertical and horizontal diameters of the fruits of CSSL6-3 and RNS7 were measured from the day of flowering (0 DAA) to the ripe fruit stage (22 DAA), and the fruit shape index was calculated to draw a growth curve. Figure 6 As shown: Throughout the entire period of fruit development, the longitudinal diameter of the fruit of CSSL6-3 was slightly higher than that of RNS7, but the difference did not reach a significant level ( Figure 6 From the day of flowering to the ninth day, there was no significant difference in the fruit diameter between CSSL6-3 and RNS7. From the commercial melon stage, the fruit diameters of CSSL6-3 and RNS7 began to differ significantly; until the ripe melon stage ( Figure 6 (b), the fruit diameter of CSSL6-3 was significantly smaller than that of RNS7, and its fruit shape index was significantly greater than that of RNS7 during the commercial melon period, with the largest difference in fruit shape index at 12DAA ( Figure 6 (c) of the

[0050] Embodiment 3

[0051] The fragment interval determined in Example 2 was further narrowed, and the related strain traits were examined, as follows:

[0052] By screening and exchanging individuals, the interval was further narrowed and the Csfd6.3-NIL strain was obtained. The fruit phenotypes of Csfd6.3-NIL and RNS7 at different stages were identified and analyzed. Figure 7 As shown, similar to the results of the replacement line CSSL6-3, possibly due to the combined effects of genotype and environment, Csfd6.3-NIL in the commercial and mature melon periods showed a more slender phenotype than RNS7, with a shorter fruit diameter.

[0053] The fruit diameter, vertical diameter and fruit shape index of Csfd6.3-NIL and RNS7 at different stages of fruit development were compared. Figure 8 The results were similar to those of CSSL6-3. On the day of flowering, there were no significant differences in the fruit diameter, vertical diameter, and fruit shape index between Csfd6.3-NIL and RNS7 ( Figure 8a~c). In the commercial melon period, the longitudinal diameter of Csfd6.3-NIL fruit was 65.5±5.4mm, which was similar to that of RNS7 (65.2±7.4mm). The transverse diameters of Csfd6.3-NIL and RNS7 were significantly different, which were 55.2±7.9mm and 65.3±6mm, respectively. The fruit shape index of Csfd6.3-NIL (1.2±0.1) was significantly higher than that of RNS7 (1.0±0.03) ( Figure 8 d~f parts). At the ripening stage, the longitudinal diameters of Csfd6.3-NIL and RNS7 fruits were 76.8±7.35mm and 72.8±9.6mm, respectively, which did not reach significant difference; the transverse diameter of Csfd6.3-NIL fruit was 65.4±8.71mm, significantly lower than that of RNS7 (78.7±9.37mm); the fruit shape index of Csfd6.3-NIL (1.1±0.02) was significantly higher than that of RNS7 (0.98±0.03) ( Figure 8 g~i part).

[0054] The fruit growth of Csfd6.3-NIL and RNS7 during the whole period was measured. Fig. 9 As shown in the figure, the growth trend of the fruit's transverse and longitudinal diameters showed an "S" shape; there was no significant difference in the longitudinal diameter of the fruit between Csfd6.3-NIL and RNS7 during the entire growth and development period ( Fig. 9 Part a). At 0DAA-8DAA, there was no significant difference in the transverse diameter of the fruit between Csfd6.3-NIL and RNS7. After 9DAA, the transverse diameter of the fruit of RNS7 was significantly larger than that of Csfd6.3-NIL ( Fig. 9 Part b). At 10 DAA, the fruit shape index of Csfd6.3-NIL was significantly higher than that of RNS7. At 10-14 DAA, the fruit shape index of Csfd6.3-NIL and RNS7 reached an extremely significant difference ( Fig. 9 (c) of the

[0055] Embodiment 4

[0056] The specific steps for determining the molecular markers that are closely linked to the fruit diameter of commercial cucumbers are as follows:

[0057] Fifty cucumber seedlings with good growth were randomly selected from the BC4F2 generation population for planting, and their fruit phenotypes in the commercial period were identified. The fruit shape index greater than 1.10 was recorded as thin transverse diameter fruit, and less than 1.10 was recorded as thick transverse diameter fruit. The results are shown in Table 1. Among the 50 plants, 39 plants had thick transverse diameter fruits, and 11 plants had thin transverse diameter fruits. According to the chi-square test results, χ 2 =0.10, χ 20.05 (1) = 3.84, χ 2 < 2 0.05 (1), which is consistent with Mendel's 3:1 segregation law, indicating that the transverse diameter is controlled by a single recessive gene.

[0058] Table 1

[0059]

[0060] 1000 strains of the replacement line CSSL6-3 (BC4F3) population and 600 strains of its self-pollinated progeny population were used for positioning, and the original M6-4 (the upstream primer sequence is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2), M6-5 (the upstream primer sequence is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4) and M6-6 (the upstream primer sequence is shown in SEQ ID NO.5, and the downstream primer sequence is shown in SEQ ID NO.6) and the newly developed W6-1 (the upstream primer sequence is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8), W6-4 (the upstream primer sequence is shown in SEQ ID NO.9, and the downstream primer sequence is shown in SEQ ID NO.10), W6-5 (the upstream primer sequence is shown in SEQ ID NO.11, and the downstream primer sequence is shown in SEQ ID NO.12) and T6-1 (the upstream primer sequence is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.14) were used for positioning. NO.14), the genotype of each plant was determined by the size of the band amplified by PCR. The marker with the same band size as the dominant parent CNS21 was marked A, the marker with the same band size as the recessive parent RNS7 was marked B, and the band with the size of both the dominant parent CNS21 and the recessive parent RNS7 was marked H.

[0061] SEQ ID NO.1:GGGTGAATCTGAGCAAGA

[0062] SEQ ID NO.2:AACCATCTAAGCCTCTCG

[0063] SEQ ID NO.3:AAGATGTCAGACGGTGTG

[0064] SEQ ID NO.4:CACATGGTTTGGTGAAGG

[0065] SEQ ID NO.5:GGAAGTCTTCTGCGTTTG

[0066] SEQ ID NO.6:TGCGTGGTTAGGGTAAAG

[0067] SEQ ID NO.7: GAAACGCTTCTGGACTTT

[0068] SEQ ID NO.8:CGGTCCATAGACCAAACTCT

[0069] SEQ ID NO.9:TAATACCTTGGTAGCACTTT

[0070] SEQ ID NO.10:AAGCAAACAGACATTAGAAT

[0071] SEQ ID NO.11:GAACTATTGCCTCTTACGATAA

[0072] SEQ ID NO.12:AAAATGCGTGGCAACACTAATT

[0073] SEQ ID NO.13:CCCTTTCCTAACTCACATCT

[0074] SEQ ID NO.14:CAACCTTTATCCCATGCATGC

[0075] At the same time, the fruit phenotypes of the commercial melons were identified, and the fruit shape index of the fruits on each plant was analyzed and calculated. Through statistics, fruit shape indexes greater than 1.10 were recorded as thin horizontal diameter fruits, and those less than 1.10 were recorded as thick horizontal diameter fruits. It was found that the fruit shape indexes between the strains with genotypes of BBBBBHH and BBBBBAA were 0.99 and 1.20, respectively. Therefore, it is believed that there is a gene controlling the horizontal diameter of the fruit between markers T6-1 and W6-4, and there is no conflict with other genotypes and fruit shape indexes. The statistical results of genotypes, fruit shape indexes and phenotypes are shown in Table 2. The final analysis of the phenotypic results combined with the individual genotypes located the gene controlling the horizontal diameter of the fruit between markers T6-1 and W6-4, with a physical distance of 141.89kb ( Fig.10 ), the electrophoresis diagrams of molecular markers W6-4 (A) and T6-1 (B) are shown in Fig.11 The phenotype of the strains is shown in Fig.12 shown.

[0076] Table 2

[0077]

[0078]

[0079] Therefore, the present invention provides two molecular markers closely linked to the transverse diameter of cucumber fruits, namely, T6-1 and W6-4, which are located on chromosome 6 and have a physical distance of 141.89 kb. Fruits with thin transverse diameters are exchanged between the molecular markers T6-1 and W6-4, the genotypes of the molecular markers T6-1 and W6-4 in the long-fruit inbred line are set to be AA, and the genotypes of the round-fruit inbred line are set to be BB. The bands of the molecular markers T6-1 and W6-4 in fruits with thin transverse diameters are AB or BA, and in fruits with thick transverse diameters are BB. By adopting the molecular markers and identification method provided by the present invention, rapid detection of the transverse diameter of cucumber fruits in the commercial melon period can be achieved in the seedling stage, which greatly reduces the identification time and saves the identification cost, and the identification result is not affected by environmental factors and is stable and reliable. The present invention has important significance for simplifying the cucumber fruit shape breeding work and promoting the cucumber fruit shape breeding process.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A molecular marker for rapid identification of cucumber fruit diameter, characterized in that: The molecular markers are T6-1 and W6-4; the upstream primer sequence of the molecular marker W6-4 is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2; the upstream primer sequence of the molecular marker T6-1 is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.

14.

2. A molecular marker for rapid identification of cucumber fruit transverse diameter according to claim 1, characterized in that: The molecular markers T6-1 and W6-4 were located on chromosome 6, T6-1 was located at 15.18Mb, W6-4 was located at 15.32Mb, and the physical distance was 141.89kb.

3. The molecular marker for rapid identification of cucumber fruit diameter according to claim 1, characterized in that: The thin transverse diameter fruit exchanged between the molecular markers T6-1 and W6-4. The genotypes of the molecular markers T6-1 and W6-4 in the long-fruit inbred line were set to AA, and the genotypes of the round-fruit inbred line were set to BB. The bands of the molecular markers T6-1 and W6-4 in the thin transverse diameter fruit were AB or BA, and in the thick transverse diameter fruit were BB.

4. The molecular marker for rapid identification of cucumber fruit diameter according to claim 3, characterized in that: Fruits with a thin transverse diameter refer to fruits with a fruit shape index greater than 1.10, and fruits with a thick transverse diameter refer to fruits with a fruit shape index less than 1.

10.

5. The molecular marker for rapid identification of cucumber fruit transverse diameter according to claim 4, characterized in that: Fruit shape index = fruit longitudinal diameter / fruit transverse diameter. The fruit longitudinal diameter is the length from the connection between the cucumber stalk and the fruit to the top of the fruit, and the fruit transverse diameter is the diameter of the cucumber fruit in the middle.

6. A method for rapidly identifying the transverse diameter of cucumber fruit, characterized in that: The identification is performed using the molecular marker described in any one of claims 1 to 5, the steps being as follows: S1. Extracting genomic DNA from the cucumber plants to be tested; S2, using the DNA solution obtained in step S1 as a template, preparing a reaction system and performing PCR amplification; S3. Perform electrophoresis on the amplified product, read the electrophoresis band information, and determine whether the fruits of the cucumber plant to be tested in the commercial period are thin-diameter fruits or thick-diameter fruits.

7. A method for rapidly identifying the transverse diameter of cucumber fruits according to claim 6, characterized in that: The reaction system in step S2 was prepared according to the instructions attached to the Taq enzyme.

8. A method for rapidly identifying the transverse diameter of cucumber fruits according to claim 6, characterized in that: The PCR amplification program in step S2 is 94°C, 5 min; 94°C, 30 s, Tm, 30 s, 72°C, 10 s, 35 cycles; 72°C, 10 s; 72°C, 10 min, Tm is 50-60°C.

9. Use of a molecular marker for rapidly identifying the transverse diameter of cucumber fruit as claimed in any one of claims 1 to 5 in the breeding of cucumber fruit shape varieties.

Images