Kit for jointly detecting six enteroviruses

Abstract

The invention discloses a kit for jointly detecting six enteroviruses, and belongs to the technical field of in-vitro diagnosis. The kit comprises detection primers and probes aiming at EV71, CVA16, CVA6, CVA10, CVA4 and EV, can be used for jointly detecting enterovirus 71, coxsackie virus group A 16, coxsackie virus group A 10, coxsackie virus group A 6, coxsackie virus group A 4 and universal enterovirus, and has relatively high specificity and sensitivity.

Description

Technical Field

[0001] The invention relates to the technical field of nucleic acid in vitro diagnosis, and in particular to a kit for jointly detecting six enteroviruses. Background Art

[0002] Hand, foot and mouth disease (HFMD) is a common infectious disease caused by a variety of enteroviruses. Severe cases and deaths mostly occur in children under 5 years old. my country has included HFMD in the management of Class C infectious diseases. Enterovirus universal, enterovirus 71 (EV71), Coxsackieviruses A16 (CVA16), Coxsackievirus A10 (CVA10), Coxsackievirus A6 (CVA6), and Coxsackievirus A4 (CVA4) are all major enterovirus serotypes that cause HFMD.

[0003] For the detection of the above viruses, in order to ensure accuracy and reduce interference, each virus is usually tested separately, which is time-consuming and requires a lot of samples, which brings inconvenience to the detection. Some studies have used triple direct fluorescent RT-PCR to simultaneously detect universal enterovirus, CVA16 and EV71, achieving a higher detection efficiency.

[0004] At present, due to factors such as the high similarity of the viruses and the easy interference between primers and probes, it is not possible to simultaneously detect different types of Coxsackievirus in a single tube.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide a kit for the joint detection of six enteroviruses in order to address the problem that the prior art cannot detect a large number of viruses at one time. The kit can simultaneously detect six highly pathogenic viruses with strong specificity and high detection efficiency.

[0007] The kit for the combined detection of six enteroviruses provided by the present invention includes detection primers and probes for EV71 (enterovirus 71), CVA16 (Coxsackievirus A group 16), CVA6 (Coxsackievirus A group 6), CVA10 (Coxsackievirus A group 10), CVA4 (Coxsackievirus A group 4), and EV (enterovirus universal), and the specific nucleotide sequences are as follows:

[0008] EV71 detection primers: SEQ ID NO.1-2, EV71 detection probe: SEQ ID NO.3;

[0009] CVA16 detection primers: SEQ ID NO.4-5, CVA16 detection probe: SEQ ID NO.6;

[0010] CVA6 detection primers: SEQ ID NO.7-8, CVA6 detection probe: SEQ ID NO.9;

[0011] CVA10 detection primers: SEQ ID NO.10-11, CVA10 detection probe: SEQ ID NO.12;

[0012] CVA4 detection primers: SEQ ID NO.13-14, CVA4 detection probe: SEQ ID NO.15;

[0013] EV detection primers: SEQ ID NO.16-17, EV detection probe: SEQ ID NO.18;

[0014] The 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0015] EV71 detection upstream primer: CCCTCACTCACGCTC (SEQ ID NO.1)

[0016] EV71 detection upstream primer: AGCAGCTTGGAGTGC (SEQ ID NO. 2),

[0017] EV71 detection probe: FAM-AACACACAGGTAAGCAGCCATCGA-BHQ1 (SEQ ID NO. 3);

[0018] CVA16 detection upstream primer: CAGGGGCG TCGTCAAA (SEQ ID NO.4),

[0019] CVA16 detection downstream primer: AAATTCCCAATGGCTG (SEQ ID NO.5),

[0020] CVA16 detection probe: VIC-GAGACTAGGTGTGTATTGAACCATCATT-BHQ1 (SEQ ID NO. 6);

[0021] CVA6 detection upstream primer: TGTGGAACACTTTTAC (SEQ ID NO.7),

[0022] CVA6 detection downstream primer: ATCACATCTATGGG (SEQ ID NO.8),

[0023] CVA6 detection probe: CY5-GTTGTGGAGGTGAAGGACTCG-BHQ2 (SEQ ID NO. 9);

[0024] CVA10 detection upstream primer: AGGGAGGCG AGTCAAC (SEQ ID NO.10),

[0025] CVA10 detection downstream primer: GGTATGGCTGAGACC (SEQ ID NO.11),

[0026] CVA10 detection probe: FAM-TAGAGTGTAC ATGAAGCTTA-BHQ1 (SEQ ID NO. 12);

[0027] CVA4 detection upstream primer: GCTCGAGA ATCGTTCC (SEQ ID NO. 13),

[0028] CVA4 detection downstream primer: GGTGACATAAAGGGCA (SEQ ID NO.14),

[0029] CVA4 detection probe: VIC-CCG CGACCAATCC GTCGGTT-BHQ1 (SEQ ID NO. 15);

[0030] EV detection upstream primer: GTCACA CACAACTCTC (SEQ ID NO.16),

[0031] EV detection downstream primer: GGTACTGGTCTCGTGA (SEQ ID NO.17)

[0032] EV detection probe: CY5-ACTATATTATAAAGTTGAATACAGGAAAA-BHQ2 (SEQ ID NO. 18);

[0033] Optionally or preferably, it also includes detection primers and probes for the internal standard gene RNASE P, the nucleotide sequence of the detection primers is shown in SEQ ID NO.19-20, and the nucleotide sequence of the detection probe is shown in SEQ ID NO.21; the 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0034] Internal standard gene RNASE P detection upstream primer: AGATTTGGACCTGCGAGCG (SEQ ID NO.19),

[0035] Internal standard gene RNASE P detection downstream primer: GAGCGGCTGTCTCCACAAGT (SEQ ID NO.20),

[0036] Internal standard gene RNASE P detection probe: ROX-TTCTGACCTGAAGGCTCTGCGCG-BHQ1 (SEQ ID NO. 21).

[0037] Optionally or preferably, the detection primers and probes for EV71, CVA16, and CVA6 are placed in the same tube, and the detection primers and probes for CVA10, CVA4, and EV are placed in the same tube; each tube contains detection primers and probes for the internal standard gene RNase P; the 5'-end fluorescent reporter groups of the detection probes in the same tube are different.

[0038] Optionally or preferably, the 5'-end fluorescent reporter group of the detection probe for EV71 and CVA10 is FAM, the 5'-end fluorescent reporter group of the detection probe for CVA16 and CVA4 is VIC, the 5'-end fluorescent reporter group of the detection probe for CVA6 and EV is cy5, and the 5'-end fluorescent reporter group of the detection probe for the internal standard gene is ROX.

[0039] Optionally or preferably, reverse transcriptase, Taq DNA polymerase and PCR reaction buffer are also included.

[0040] Optionally or preferably, positive control and negative control are also included, the positive control is the nucleic acid fragments of six viruses including EV71, CVA16, CVA6, CVA10, CVA4 and EV and the nucleic acid fragments of internal standard genes, and the negative control is DEPC water.

[0041] Optionally or preferably, in the positive control, the nucleic acid fragments of EV71, CVA16, CVA6 and the nucleic acid fragment of the internal standard gene are placed in the same tube, and the nucleic acid fragments of CVA10, CVA4, EV and the nucleic acid fragment of the internal standard gene are placed in the same tube.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The kit of the present invention designs upstream and downstream detection primers and detection probes for enterovirus 71, Coxsackie A group 16, 10, 6, 4 and universal enterovirus, and realizes qualitative detection of enterovirus nucleic acid by collecting fluorescent signals generated by PCR amplification, with high specificity and sensitivity. The minimum detection limits of EV71, CVA16, CVA10, CVA4 and EV are all 1 copies / μL, and the minimum detection limit of CVA6 is 10 copies / μL. In addition, the one-time diagnosis of six viruses greatly shortens the time for testing and confirming the virus, saving time and cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1The 10-fold dilution amplification curve (left) and standard curve (right) of EV71 are shown in Figure 1. 0 ~10 7 copies / μL RNA reference was used as template;

[0045] Figure 2 The 10-fold dilution amplification curve (left) and standard curve (right) of CVA16 are shown in Figure 1. 0 ~10 7 copies / μL RNA reference was used as template;

[0046] Figure 3 The 10-fold dilution amplification curve (left) and standard curve (right) of CVA6 are shown in Figure 1. 1 ~10 7 copies / μL RNA reference was used as template;

[0047] Figure 4 The 10-fold dilution amplification curve (left) and standard curve (right) of EV were shown. 0 ~10 8 copies / μL RNA reference was used as template. DETAILED DESCRIPTION

[0048] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0049] Example 1 Enterovirus Six-in-One Detection Kit

[0050] The enterovirus six-in-one detection kit of this embodiment includes six groups of reagents, and the components of each group of reagents are shown in the following Table 1:

[0051] Table 1 Kit components

[0052]

[0053] This kit is suitable for the nucleic acid detection of enterovirus extracted from samples such as throat swabs, anal swabs, intravesicular exudate, feces, cerebrospinal fluid, and virus isolation samples.

[0054] Kit detection method:

[0055] 1. Nucleic acid extraction: Take the sample to be tested and extract nucleic acid according to the instructions of the nucleic acid extraction kit.

[0056] 2. Sample addition: Tube A is a mixture of reverse transcriptase, amplification enzyme and buffer, add 13.5μL to each reaction, tubes B and C are a mixture of specific primer probes for three serotypes of viruses, internal standard gene primer probes and water, add 9.5μL to each reaction, add 2μL to each tube of nucleic acid to be tested, and the final volume is 25μL / tube. Add 2μL of the processed sample nucleic acid to be tested, positive control, and negative control to the prepared PCR reaction tubes (A+B / A+C).

[0057] 3. RT-PCR amplification detection: Place the reaction tube into a fluorescent PCR amplification instrument for amplification detection. Real-time RT-PCR reaction conditions are shown in Table 2:

[0058] Table 2 Real-time RT-PCR reaction conditions

[0059]

[0060] 4. The collection of fluorescence signals is set as FAM fluorescence channel (CVA10, EV71), VIC fluorescence channel (CVA16, CVA4), CY5 fluorescence channel (EV universal, CVA6), ROX fluorescence channel (internal standard gene RNaseP). Controls need to be set for each experiment. Positive control: D tube and E tube provided with the kit; negative control: F tube provided with the kit.

[0061] Through the study of reference values, it was determined that the Ct reference value of the target gene detected by this kit is 35, and the Ct reference value of the internal standard is 34. The positive result determination is shown in Table 3:

[0062] Table 3 Positive result determination

[0063]

[0064] Samples with no Ct value are considered negative, and samples with Ct value > 35.0 are recommended to be re-tested. Samples with internal standard gene Ct value ≥ 34.0 are considered negative, and samples with no Ct value are considered negative, otherwise they are considered positive.

[0065] Example 2 Kit Performance Test

[0066] In order to detect whether this kit product has cross-reactions with other viruses, resulting in false positives, nucleic acids of H1N1, H3N2, FluB, 229E, OC43, NL63, HKU1, HADV, RSV, HPIV1, HPIV2, and HPIV3 viruses were extracted for fluorescent PCR detection. The results are shown in Table 4 below, showing that all were negative.

[0067] Table 4 Results of the kit of the present invention for detecting other different viruses

[0068]

[0069]

[0070] The kit of the present invention has no cross reaction with norovirus, herpes simplex virus type 1 / 2, enteroadenovirus, varicella-zoster virus, rotavirus, hepatitis A virus, astrovirus, Epstein-Barr virus, rubella virus, measles virus, influenza A virus, parainfluenza virus, influenza B virus, cytomegalovirus, respiratory syncytial virus, mumps virus, hepatitis E virus, group B streptococcus, Klebsiella pneumoniae, Escherichia coli, Neisseria meningitidis, Streptococcus pneumoniae, Staphylococcus aureus, Salmonella, Shigella, Vibrio, Haemophilus influenzae, Moraxella catarrhalis, viridans streptococcus, Neisseria, Roseburia mucosa, and Proteus.

[0071] Since enterovirus has a wide distribution area, high epidemic intensity, and a large number of serological types, 2-3 strains of enterovirus of the other 11 serotypes from different regions and eras were tested for positive coincidence rate, and the nucleic acid of each virus in Table 5 was extracted for fluorescent PCR detection. The results are shown in Table 5.

[0072] Table 5 Results of the kit of the present invention detecting different strains of viruses

[0073]

[0074]

[0075] The kit of the present invention was used to conduct 20 independent repeatability experiments to evaluate the stability of the system. The test results showed that the coefficient of variation (CV) within the group was less than 5%, indicating that the detection system has good stability.

[0076] Table 6 Stability evaluation results of the kit of the present invention

[0077] serial number EV71 CVA16 CVA6 EV 1 20.96 19.98 22.02 18.14 2 20.94 19.96 21.89 18.52 3 20.94 19.89 21.78 18.32 4 20.07 19.68 21.98 18.65 5 20.02 19.76 21.68 18.54 6 20.22 19.87 21.78 18.32 7 20.03 19.84 21.89 18.45 8 20.91 19.71 22.13 18.78 9 20.91 19.75 22.16 18.65 10 20.83 19.78 22.15 18.24 11 20.65 19.56 22.18 18.34 12 20.36 19.36 22.21 18.54 13 20.54 19.45 22.22 18.53 14 20.69 19.58 21.98 18.71 15 20.78 19.62 21.89 18.61 16 20.97 19.72 21.69 18.45 17 20.54 19.58 21.72 18.62 18 20.74 19.36 22.14 18.34 19 20.65 19.58 22.01 18.54 20 20.45 19.78 22.03 18.71 CV% 1.6 0.9 0.8 0.9

[0078] Interfering substance experiment:

[0079] The following 10 interfering substances (corresponding concentrations) were mixed with virus-containing specimens in a 1:1 ratio. At the same time, a control was set up in which PBS solution was mixed with virus-containing specimens in a 1:1 ratio. Viral nucleic acid was then extracted and finally fluorescent PCR was performed. The results showed that there was no statistical difference in the fluorescent Ct values.

[0080] Table 7 Interfering substances and concentrations

[0081]

[0082]

[0083] Table 8 Anti-interference substance experimental results of the kit of the present invention

[0084]

[0085] Minimum detection limit:

[0086] EV71, CVA16, CVA6, CVA10, CVA4, and EV-type positive reference substances were used for gradient dilution, with a concentration of 10 0 ~10 8 RT-PCR was performed using RNA reference samples within the range of copies / μL as templates, with 3 replicate wells set for each concentration. The results showed that the minimum detection limit of EV71, CVA16, CVA10, CVA4 and EV was 1 copies / μL. Figure 1-4 These are the 10-fold serial dilution amplification curves and standard curves of EV71, CVA16, CVA6, and EV, respectively.

[0087] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. A kit for the combined detection of six enteroviruses, characterized in that: Including detection primers and probes for EV71, CVA16, CVA6, CVA10, CVA4, EV, the specific nucleotide sequences are as follows: EV71 detection primers: SEQ ID NO.1-2, EV71 detection probe: SEQ ID NO.3; CVA16 detection primers: SEQ ID NO.4-5, CVA16 detection probe: SEQ ID NO.6; CVA6 detection primers: SEQ ID NO.7-8, CVA6 detection probe: SEQ ID NO.9; CVA10 detection primers: SEQ ID NO.10-11, CVA10 detection probe: SEQ ID NO.12; CVA4 detection primers: SEQ ID NO.13-14, CVA4 detection probe: SEQ ID NO.15; EV detection primers: SEQ ID NO.16-17, EV detection probe: SEQ ID NO.18; The 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

2. The kit according to claim 1, characterized in that It also includes detection primers and probes for the internal standard gene RNase P. The nucleotide sequences of the detection primers are shown in SEQ ID NO.19-20, and the nucleotide sequence of the detection probe is shown in SEQ ID NO.

21. The 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. The kit according to claim 1 or 2, characterized in that The detection primers and probes for EV71, CVA16, and CVA6 are placed in the same tube, and the detection primers and probes for CVA10, CVA4, and EV are placed in the same tube; each tube contains detection primers and probes for the internal standard gene RNase P; the 5' end fluorescent reporter groups of the detection probes in the same tube are different.

4. The kit according to claim 3, characterized in that The 5'-end fluorescent reporter group of the detection probe for EV71 and CVA10 is FAM, the 5'-end fluorescent reporter group of the detection probe for CVA16 and CVA4 is VIC, the 5'-end fluorescent reporter group of the detection probe for CVA6 and EV is cy5, and the 5'-end fluorescent reporter group of the detection probe for the internal standard gene is ROX.

5. The kit according to claim 1 or 2, characterized in that Also included are reverse transcriptase, Taq DNA polymerase, and PCR reaction buffer.

6. The kit according to claim 1 or 2, characterized in that It also includes positive control substances and negative control substances. The positive control substances are nucleic acid fragments of six viruses, EV71, CVA16, CVA6, CVA10, CVA4, and EV, and nucleic acid fragments of internal standard genes. The negative control substances are DEPC water.

7. The kit according to claim 6, characterized in that In the positive control, the nucleic acid fragments of EV71, CVA16, CVA6 and the nucleic acid fragment of the internal standard gene are placed in the same tube, and the nucleic acid fragments of CVA10, CVA4, EV and the nucleic acid fragment of the internal standard gene are placed in the same tube.

Images