Bacillus amyloliquefaciens and application thereof in fermentation production of guanosine

Abstract

The invention discloses a bacillus amyloliquefaciens strain and an application thereof in fermentation production of guanosine, the bacillus amyloliquefaciens strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), the classification name of the bacillus amyloliquefaciens strain is bacillus amyloliquefaciens, the preservation number is CGMCC No.30808, and the preservation date is May 29, 2024. The bacillus amyloliquefaciens strain ACGua304 is a strain which is stable in performance and high in guanosine yield and is screened through multiple mutagenesis, and the guanosine yield is increased by 34.92% when the strain is placed on a 30L fermentation tank through optimization of a shake-flask culture medium and adjustment of a small-scale test fermentation process.

Description

Technical Field

[0001] The invention relates to a strain of Bacillus amyloliquefaciens and application thereof in fermentation production of guanosine, belonging to the technical field of fermentation engineering. Background Art

[0002] Guanosine, also known as guanine nucleoside, has the effects of enhancing cardiovascular function, anti-inflammatory and antioxidant effects, improving immune function, and anti-tumor effects. It can be used to synthesize food flavor enhancers (disodium 5'-guanylate, disodium 5'-ribonucleotide), and is also the main raw material for many drugs (nucleoside antiviral drugs such as ribavirin and acyclovir).

[0003] There are two methods for producing guanosine: chemical synthesis and fermentation. Chemical synthesis requires a large amount of organic solvents, which will cause environmental pollution problems and is rarely used. Fermentation is currently a commonly used method for producing guanosine in China. It is easy to control, has a short cycle, and has little environmental pollution, but the strains screened have relatively weak glycoside production capabilities.

[0004] The invention application with publication number CN104232674A discloses a method for increasing the production of guanosine by Bacillus amyloliquefaciens. The method uses a thermosensitive plasmid pKS2 as a vector and removes a partial fragment of the promoter of the purine operon (purEKBCSQLFMNHD) by homologous recombination. The preferred sequence fragment is the -193 to -29 bp fragment before the purE gene is deleted. The strain after the deletion of the fragment relieves the repressive effect of purR (the repressor protein of the purine operon) and the transcriptional attenuation effect caused by the palindromic structure of the fragment. The purF gene encoding phosphoribosylpyrophosphate (PRRR) transamidase is desensitized by point mutation, preferably 217 leucine is mutated to isoleucine (L217I), and the feedback inhibition of the product adenylate and guanylate is relieved. The guanosine production capacity of the modified Bacillus amyloliquefaciens XH-Δpo in the shake flask was 10% higher than that of the initial strain. The nucleotide position 217 of the purF gene was mutated on the basis of the engineered strain, and the feedback inhibition of the products adenylate and guanylate was roughly released, and the guanosine production capacity of the shake flask was increased by 18%, indicating that the ability of Bacillus amyloliquefaciens XH to accumulate guanosine can be improved by the modification of the promoter fragment region of the purine operon and the desensitization of the purF gene by site-directed mutation, which provides ideas for the selection of higher-yield strains for industrial production. However, the guanosine production is only 19.6g / L.

[0005] In order to improve the efficiency of guanosine production and reduce the cost of guanosine production, it is of great significance to screen high-yield strains. Summary of the invention

[0006] The purpose of the present invention is to provide a strain of Bacillus amyloliquefaciens and application thereof in fermentation production of guanosine.

[0007] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a strain of Bacillus amyloliquefaciens, wherein the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens ACGua304, which has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration (CGMCC), with a deposit number of CGMCC No.30808 and a deposit date of May 29, 2024.

[0008] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: application of a strain of Bacillus amyloliquefaciens ACGua304 in fermentation production of guanosine.

[0009] The preferred technical solution is: comprising the following steps:

[0010] Step 1: Activation of Bacillus amyloliquefaciens ACGua304

[0011] Stir Bacillus amyloliquefaciens ACGua304 from the glycerol tube into the eggplant bottle for activation;

[0012] Eggplant bottle culture conditions: temperature 30-37°C, pH 6.8-7.3, culture time 15-24h;

[0013] Step 2: Seed Tank / Shake Flask Culture

[0014] Wash the cultured bacteria in the eggplant bottle and inoculate it into the sterilized seed culture medium, and culture it to the logarithmic phase;

[0015] Seed culture conditions: temperature 30-37°C, pH 6.0-7.5, culture time 6-15h;

[0016] Step 3: Fermentation

[0017] The seed solution cultured to the logarithmic phase is inoculated into the sterilized fermentation medium and cultured for 50 to 80 hours to obtain the guanosine fermentation solution;

[0018] Fermentation culture conditions: temperature 30-37°C, pH 6.0-7.5;

[0019] Dissolved oxygen control: The dissolved oxygen level is controlled at 10% to 60% by adjusting the ventilation volume and stirring speed;

[0020] The glucose concentration was controlled at 0.5-2.0% in the early stage and below 0.5% after 40 hours.

[0021] The glutamate concentration is controlled at 0.1-2.0%.

[0022] The preferred technical solution is: in step 1, the eggplant bottle culture medium is 1-10 g / L glucose, 5-20 g / L peptone, 5-20 g / L yeast powder, 1-10 g / L monosodium glutamate, 0.1-5 g / L sodium chloride, and 20-30 g / L agar powder.

[0023] The preferred technical solution is: in step 2, the seed culture medium is 10-50 g / L of glucose, 0.1-3 g / L of dipotassium hydrogen phosphate, 0.1-3 g / L of magnesium sulfate, 10-50 g / L of corn steep liquor, 0.1-5 g / L of urea, 10-20 g / L of yeast powder, 2-10 g / L of polypeptide powder, 1-10 g / L of monosodium glutamate, 0.1-5 g / L of sodium chloride, and 10-200 ug / L of adenine.

[0024] The preferred technical solution is: in step 3, the fermentation medium is 5-50 g / L glucose, 0.1-5 g / L potassium dihydrogen phosphate, 10-30 g / L ammonium sulfate, 0.1-10 g / L magnesium sulfate, 10-50 g / L corn steep liquor, 10-20 g / L yeast powder, 5-20 g / L polypeptide powder, 100-300 ug / L adenine, 1-30 g / L monosodium glutamate, and one portion of trace elements.

[0025] The preferred technical scheme is: it also includes extraction of fermentation liquid: filtering the guanosine fermentation liquid through a membrane to obtain a clear liquid; evaporating, concentrating and crystallizing the filtered clear liquid, and removing the mother liquid after centrifugation; decolorizing and cooling the obtained wet crystals, recrystallizing, and centrifuging; and finally drying the obtained wet crystals with a double cone vacuum to obtain guanosine crystals.

[0026] The preferred technical solution is: the equipment used for membrane filtration is a ceramic membrane, the temperature is 65-70°C, and the filtration flux is above 100LMH; the equipment used for evaporation, concentration and crystallization is a multi-effect evaporation crystallizer; activated carbon is used for decolorization, the cooling control speed is 5°C / h, and the minimum temperature is 10°C.

[0027] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0028] The invention subjects Bacillus amyloliquefaciens ACGua to multiple ARTP mutagenesis and screening of resistant mutants, thereby breeding a Bacillus amyloliquefaciens strain ACGua304 with stable performance and high yield; through optimization of a shake flask culture medium and adjustment of a pilot fermentation process, the strain can produce 51.11 g / L of guanosine and achieve a conversion rate of 15.23% in a 30L fermenter within 80 hours, which are respectively increased by 34.92% and 17.6% compared with the starting strain. DETAILED DESCRIPTION

[0029] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in the embodiments.

[0030] Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0031] Example 1: Mutagenesis method of Bacillus amyloliquefaciens

[0032] Using Bacillus amyloliquefaciens ACGua as the starting strain, after multiple mutagenesis screening, a strain with high guanosine production was obtained. The steps are as follows:

[0033] Plasma mutagenesis (ARTP) screening: Bacillus amyloliquefaciens was streaked from the glycerol tube onto the guanosine slope for activation and cultured at 36°C for 20h; a loop of bacteria was picked from the guanosine slope and placed in a liquid seed culture medium, cultured at 105rpm, 36°C reciprocating shaker for 3-4h, 1ml of seed solution was placed in a 1.5ml EP tube, centrifuged at 4000rpm for 5min, the supernatant was removed, 1ml of saline was added, mixed, repeated three times, and the bacterial suspension was diluted with 5% glycerol to an appropriate concentration, OD600 0.6-1.0; 10ul of the diluted bacterial suspension was evenly applied to a sterile stainless steel slide, ARTP mutagenesis conditions: RF power 120W, treatment distance 2mm, carrier gas flow 10SLM, treatment temperature was room temperature (20-40°C), treatment time 10s. The treated slide was placed in an EP tube containing 1ml of sterile saline, shaken and mixed, then diluted and evenly applied to the plate, and cultured at 36°C for 24h.

[0034] Screening of resistant mutants: Prepare guanosine solid culture medium, sterilize and add appropriate amount of 8-azaguanine, methionine sulfoxide and dequamectin to the plate, with the concentration range of 1-50 mg / L. Spread the induced bacterial solution evenly on the plate and culture at 36℃ for 3-7 days. Inoculate the grown strains into the shake flask medium, culture at 105rpm, 36℃ reciprocating shaker for 24h, and select some strains with higher glycoside production for preservation.

[0035] Example 2: Bacillus amyloliquefaciens ACGua304

[0036] 16SrRNA gene sequence determination results:

[0037]

[0038] Determination results of gyrB gene sequence:

[0039] TATAAGTATCCGGCGGTCTTCACGGTGTTGGGGCGTCTGTCGTAAACGCCTTATCGACCACTCTTGACGTTACGGTTCATCGTGACGGGAAAATCCATTATCAGGCGTATGAACGCGGTGTACCGGTGGCCGATCTTGAAGTGATCGGTGACACTGATAAGACCGGAACGATTACGCACTTCGTTCCCGATCCGGAAATTTTCAAAGAAACAACCGTATACGACTATGATCTGCTTTCAAACCGTGTCCGAGAATTGGCCTTCCTGACAAAGGGCGTCAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTACGTTGAGTACTTAAACCGTTCCAAAGAAGTCATTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAACATTTATTCTTTCACGAATAACATCAACACATACGAAGGCGGCACGCACGAAGCCGGATTTAAAACCGGTTTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATCTGAGCGGTGATGATGTGAGAGAAGGGCTGACTGCCATCATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACGAAGCTCGGCAACTCTGAAGCGAGAACGATTACTGATACGCTGTTTTCTTCCGCACTGGAAACATTCCTTCTTGAAAATCCG。

[0040] Example 3: Comparison between Bacillus amyloliquefaciens ACGua304 and the original strain

[0041] The invention discloses an application of Bacillus amyloliquefaciens ACGua304, which has been deposited in the General Microbiological Center (CGMCC) of China Microorganism Culture Collection Administration, and its classification name is Bacillus amyloliquefaciens, the deposit number is CGMCC No.30808, the deposit date is May 29, 2024, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0042] The application of the Bacillus amyloliquefaciens ACGua304 is to ferment and produce guanosine; the steps are as follows:

[0043] Step 1: Activation of Bacillus amyloliquefaciens ACGua304

[0044] Bacillus amyloliquefaciens ACGua304 was streaked from a glycerol tube into an eggplant bottle for activation; the culture conditions of the eggplant bottle were as follows: temperature 36°C, pH 7.2, culture for 20 hours, and the slant culture medium was 5 g / L glucose, 10 g / L peptone, 10 g / L yeast powder, 2 g / L monosodium glutamate, 2.5 g / L sodium chloride, and 25 g / L agar powder.

[0045] Step 2: Seed tank / shake flask culture

[0046] Wash the cultured bacteria in the eggplant bottle and inoculate it into the sterilized seed culture medium and culture it to the logarithmic phase; the seed culture conditions are 37℃, pH 7.0, and the culture time is 8h. The seed culture medium is 20g / L glucose, 2.4g / L dipotassium hydrogen phosphate, 0.5g / L magnesium sulfate, 20g / L corn steep liquor, 2g / L urea, 16g / L yeast powder, 8g / L polypeptide powder, 5g / L monosodium glutamate, 2.5g / L sodium chloride, and 200ug / L adenine.

[0047] Step 3: Fermentation

[0048] The seed liquid cultured to the logarithmic phase is inoculated into the sterilized fermentation medium and cultured for 50 to 80 hours to obtain the guanosine fermentation liquid; the culture conditions are 37°C and pH 6.4; the dissolved oxygen level is controlled at 20% to 30% by adjusting the ventilation volume and stirring speed, the glucose concentration is controlled at 0.5 to 2.0% from 0 to 40 hours, and is controlled below 0.5% after 40 hours; the glutamic acid concentration is controlled at 0.1 to 2.0%. The fermentation medium is 20g / L glucose, 4g / L potassium dihydrogen phosphate, 20g / L ammonium sulfate, 5g / L magnesium sulfate, 20g / L corn steep liquor, 18g / L yeast powder, 10g / L polypeptide powder, 200ug / L adenine, 10g / L monosodium glutamate, and 1g / L trace elements. The trace elements are composed of magnesium, zinc, and copper mixed in a mass ratio of 1:2:1.

[0049] Step 4: Extraction of fermentation broth

[0050] The cultured guanosine fermentation liquid is filtered through a membrane to obtain a clear liquid; the filtered clear liquid is evaporated, concentrated, and crystallized, and the mother liquor is removed after centrifugation; the obtained wet crystals are decolorized, cooled, recrystallized, and centrifuged; the wet crystals are finally dried with a double cone vacuum to obtain guanosine crystals. The equipment used for membrane filtration is a ceramic membrane, the temperature is 65-70°C, and the filtration flux is above 100LMH; the equipment used for evaporation, concentration, and crystallization is a multi-effect evaporation crystallizer; activated carbon is used for decolorization, the cooling control speed is 5°C / h, and the minimum temperature is 10°C.

[0051] By the above method, Bacillus amyloliquefaciens ACGua304 was cultured for 10 batches, and the average values ​​of the culture results of the 10 batches are shown in Table 1.

[0052] Table 1: Comparison of fermentation results of starting strains ACGua and ACGua304

[0053] ACGua ACGua304 Fermentation tank volume L 30 30 Fermentation cycle h 50～80 50～80 Guanosine g / L 37.88 51.11 Conversion Rate % 12.95 15.23

[0054] As can be seen from Table 1, compared with the starting strain ACGua, under the same conditions, the guanosine production of Bacillus amyloliquefaciens ACGua304 in the present invention is increased by 34.92%, and the conversion rate is increased by 17.6%.

[0055] Example 4: A strain of Bacillus amyloliquefaciens and its application in fermentation production of guanosine

[0056] A strain of Bacillus amyloliquefaciens, wherein the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens ACGua304, which has been deposited in the General Microbiological Center of China Microorganism Culture Collection Administration (CGMCC), with a deposit number of CGMCC No.30808 and a deposit date of May 29, 2024.

[0057] The application of Bacillus amyloliquefaciens in the fermentation production of guanosine comprises the following steps:

[0058] Step 1: Activation of Bacillus amyloliquefaciens ACGua304

[0059] Stir Bacillus amyloliquefaciens ACGua304 from the glycerol tube into the eggplant bottle for activation;

[0060] Eggplant bottle culture conditions: temperature 30°C, pH 6.8, culture time 15h;

[0061] Step 2: Seed Tank / Shake Flask Culture

[0062] Wash the cultured bacteria in the eggplant bottle and inoculate it into the sterilized seed culture medium, and culture it to the logarithmic phase;

[0063] Seed culture conditions: temperature 30°C, pH 6.0, culture time 6h;

[0064] Step 3: Fermentation

[0065] The seed solution cultured to the logarithmic phase was inoculated into the sterilized fermentation medium and cultured for 50 hours to obtain the guanosine fermentation solution;

[0066] Fermentation culture conditions: temperature 30°C, pH 6.0;

[0067] Dissolved oxygen control: The dissolved oxygen level is controlled at 10% by adjusting the ventilation volume and stirring speed;

[0068] The glucose concentration was controlled at 0.5% in the early stage and below 0.5% after 40 hours;

[0069] The glutamate concentration was controlled at 0.1%.

[0070] A preferred embodiment is as follows: in step 1, the eggplant bottle culture medium is 1 g / L glucose, 5 g / L peptone, 5 g / L yeast powder, 1 g / L monosodium glutamate, 0.1 g / L sodium chloride, and 20 g / L agar powder.

[0071] A preferred embodiment is: in step 2, the seed culture medium is 10-50 g / L of glucose, 0.1-3 g / L of dipotassium hydrogen phosphate, 0.1 g / L of magnesium sulfate, 10 g / L of corn steep liquor, 0.1 g / L of urea, 10 g / L of yeast powder, 2 g / L of polypeptide powder, 1 g / L of monosodium glutamate, 0.1 g / L of sodium chloride, and 10 ug / L of adenine.

[0072] A preferred embodiment is as follows: in step 3, the fermentation medium is 5 g / L glucose, 0.1 g / L potassium dihydrogen phosphate, 10 g / L ammonium sulfate, 0.1 g / L magnesium sulfate, 10 g / L corn steep liquor, 10 g / L yeast powder, 5 g / L polypeptide powder, 100 ug / L adenine, 1 g / L monosodium glutamate, and 1 part of trace elements. The trace elements are composed of magnesium, zinc, copper, manganese, sodium, and potassium mixed in equal proportions; each liter of the fermentation medium contains 0.5 g of the trace elements.

[0073] The preferred embodiment includes the following steps: extracting the fermentation liquid: filtering the guanosine fermentation liquid through a membrane to obtain a clear liquid; evaporating and concentrating the filtered clear liquid to crystallize it, and removing the mother liquid after centrifugation; decolorizing and cooling the obtained wet crystals, recrystallizing them, and centrifuging them; and finally drying the obtained wet crystals by double cone vacuum drying to obtain guanosine crystals.

[0074] The preferred implementation is: the equipment used for membrane filtration is a ceramic membrane, the temperature is 65°C, and the filtration flux is above 100LMH; the equipment used for evaporation, concentration and crystallization is a multiple-effect evaporation crystallizer; activated carbon is used for decolorization, the cooling control speed is 5°C / h, and the minimum temperature is 10°C.

[0075] The above description is only used to explain the preferred embodiments of the present invention, and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A Bacillus amyloliquefaciens strain, characterized in that: The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens ACGua304, which has been deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.30808 and a deposit date of May 29, 2024.

2. Use of the Bacillus amyloliquefaciens according to claim 1 in the fermentation production of guanosine.

3. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 2, characterized in that: The following steps are involved: Step 1: Activation of Bacillus amyloliquefaciens ACGua304 Stir Bacillus amyloliquefaciens ACGua304 from the glycerol tube into the eggplant bottle for activation; Eggplant bottle culture conditions: temperature 30-37°C, pH 6.8-7.3, culture time 15-24h; Step 2: Seed Tank / Shake Flask Culture Wash the cultured bacteria in the eggplant bottle and inoculate it into the sterilized seed culture medium, and culture it to the logarithmic phase; Seed culture conditions: temperature 30-37°C, pH 6.0-7.5, culture time 6-15h; Step 3: Fermentation The seed solution cultured to the logarithmic phase is inoculated into the sterilized fermentation medium and cultured for 50 to 80 hours to obtain the guanosine fermentation solution; Fermentation culture conditions: temperature 30-37°C, pH 6.0-7.5; Dissolved oxygen control: The dissolved oxygen level is controlled at 10% to 60% by adjusting the ventilation volume and stirring speed; The glucose concentration was controlled at 0.5-2.0% in the early stage and below 0.5% after 40 hours. The concentration of glutamate is controlled at 0.1-2.0%.

4. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 3, characterized in that: In step 1, the eggplant bottle culture medium is 1-10 g / L glucose, 5-20 g / L peptone, 5-20 g / L yeast powder, 1-10 g / L monosodium glutamate, 0.1-5 g / L sodium chloride, and 20-30 g / L agar powder.

5. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 3, characterized in that: In step 2, the seed culture medium is 10-50 g / L of glucose, 0.1-3 g / L of dipotassium hydrogen phosphate, 0.1-3 g / L of magnesium sulfate, 10-50 g / L of corn steep liquor, 0.1-5 g / L of urea, 10-20 g / L of yeast powder, 2-10 g / L of polypeptide powder, 1-10 g / L of monosodium glutamate, 0.1-5 g / L of sodium chloride, and 10-200 ug / L of adenine.

6. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 3, characterized in that: In step 3, the fermentation medium is 5-50 g / L glucose, 0.1-5 g / L potassium dihydrogen phosphate, 10-30 g / L ammonium sulfate, 0.1-10 g / L magnesium sulfate, 10-50 g / L corn steep liquor, 10-20 g / L yeast powder, 5-20 g / L polypeptide powder, 100-300 ug / L adenine, 1-30 g / L monosodium glutamate, and one portion of trace elements.

7. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 3, characterized in that: The method also includes extracting the fermentation liquid: filtering the guanosine fermentation liquid through a membrane to obtain a clear liquid; evaporating and concentrating the filtered clear liquid to crystallize it, and removing the mother liquid after centrifugation; decolorizing and cooling the obtained wet crystals, re-crystallizing them, and centrifuging them; and finally drying the obtained wet crystals with a double cone vacuum to obtain guanosine crystals.

8. The use of Bacillus amyloliquefaciens in fermentation production of guanosine according to claim 7, characterized in that: The equipment used for membrane filtration is a ceramic membrane, the temperature is 65-70°C, and the filtration flux is above 100LMH; the equipment used for evaporation, concentration and crystallization is a multi-effect evaporation crystallizer; activated carbon is used for decolorization, the cooling control speed is 5°C / h, and the minimum temperature is 10°C.