Biocontrol strain mitomycin streptomyces and application thereof

Abstract

The invention belongs to the field of biological control, and particularly discloses a biocontrol strain streptomyces mitomycin and application thereof.The strain is streptomyces mitomycin LZ-734 and is preserved in the China General Microbiological Culture Collection Center on October 9th, 2024, the preservation number is CCTCC NO: 32156, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. According to the present invention, the fermentation crude extract of Streptomyces mumenini LZ-734 has good inhibition effects on Magnaporthe oryzae and rhizoctonia solani, the inhibition rate on the Magnaporthe oryzae reaches 99.06%, and the inhibition rate on the rhizoctonia solani is 66.61%, such that the Streptomyces mumenini LZ-734 can be used for prevention and control of rice blast and rice sheath blight disease, and has good development and application prospects.

Description

Technical Field

[0001] The invention relates to the field of biological control, in particular to a biological control strain Streptomyces mitomycinicola and application thereof. Background Art

[0002] Rice blast (Pyricularia oryzae) and rice sheath blight (Rhizoctonia solani) are the two most harmful diseases in my country's rice-growing areas. Rice blast is widely distributed and occurs in more than 80 countries and regions around the world. In general epidemic years, it can cause a 10%-20% reduction in production, and in severe cases, the loss can reach 40%-50%. Since the 1990s, the annual occurrence area of ​​rice blast in my country has been more than 3.8 million hectares, and the annual loss of rice grains has reached hundreds of millions of kilograms. Rice blast can occur in all growth stages and parts of rice. According to the different periods and parts of the disease, rice blast can be divided into: seedling leaf blast, leaf blast, leaf pillow blast, node blast, ear neck blast, branch stalk blast, grain blast, etc. Among them, leaf blast and ear neck blast are the most common and cause greater harm. When leaf blast is serious, the whole field looks like it is burned, the plants are stunted, new leaves are difficult to grow, and heading is difficult. When the ear neck blast occurs seriously during the heading period, a large number of white ears or shriveled grains will result. Rice sheath blight is widely distributed in rice-producing areas around the world. It occurs in major rice-producing areas in the Americas, Europe, and Africa, but the rice-producing areas in Southeast Asia are the worst affected. In my country, with the heavy investment in short-stalked and multi-tillering varieties and water and fertilizer, the occurrence of sheath blight is becoming increasingly serious.

[0003] Therefore, in addition to rice yield and quality, the resistance of rice varieties to rice blast and sheath blight is also considered as an important breeding index in the process of rice breeding and selection. However, no rice variety with high resistance to both rice blast and sheath blight has been found so far. At present, in actual production, people mainly use Jinggangmycin to prevent and control sheath blight, and no other ideal alternative antibiotics have been found so far; as for the prevention and control of rice blast, tricyclazole drugs are mainly used. Since tricyclazole drugs are chemical synthetic drugs, although they have good effects in the short term, if similar chemical agents are used continuously for a long time and over a large area, they will seriously pollute the environment and cause a significant increase in the resistance and drug resistance of pathogens. In the long run, it will pose a serious threat to the stability of the entire agriculture and human health. Therefore, it is particularly urgent and important to explore and discover antibacterial substances that have good control effects on the above pathogens, can be degraded in the natural environment, and are harmless to the human body. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a biocontrol strain Streptomyces mitomycinii and application thereof.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] One of the technical solutions of the present invention is a biocontrol strain Streptomyces mutomycini, which is Streptomyces mutomycini LZ-734, which was deposited in the General Microbiology Center of China Culture Collection Administration on October 9, 2024, with a deposit number of CCTCC NO: 32156, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical solution of the present invention is the application of a biocontrol strain Streptomyces mitomyces in preventing and controlling rice blast fungus and rice sheath blight fungus.

[0008] Compared with the prior art, the Streptomyces mutomycini LZ-734 of the present invention has a good inhibitory effect on rice blast and rice sheath blight, with an inhibition rate of 99.06% on rice blast and 66.61% on rice sheath blight. Therefore, it can be used for the prevention and treatment of rice blast and rice sheath blight, and has a good development and application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is the antibacterial effect of strain LZ-734 on rice blast fungus.

[0010] Figure 2 This is the antibacterial effect of strain LZ-734 on rice sheath blight.

[0011] Figure 3 The colony morphology characteristics of strain LZ-734.

[0012] Figure 4 This is the evolutionary tree of strain LZ-734 based on 16S, recA and atpD sequences. DETAILED DESCRIPTION

[0013] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0014] Example 1. Isolation, screening and identification of strain LZ-734

[0015] The rice slag was collected from the rice fields in Liaozhong District of Shenyang City, and the sclerotia of rice sheath blight were separated. 1g of sclerotia was ground in 5ml of sterile water with a sterile mortar and pestle to prepare 5ml of sclerotia stock solution. 10% of the sclerotia stock solution was taken. -3 , 10 -4 , 10 -5100 μL of the diluent was spread on ISP4 medium plates, where the inorganic salt starch agar medium (ISP4) consisted of 1000 mL of distilled water, 10 g of soluble starch, 1 g of dipotassium hydrogen phosphate, 10 g of sodium chloride, 1 g of ammonium sulfate, 2 g of calcium carbonate, 1 mL of trace salt, and 18 g of agar, with a pH of 7.0-7.2; sterile water was used as a control, and each treatment was repeated 3 times and cultured at 28°C for 4-8 weeks. Single colonies with different culture characteristics such as colony morphology, color, and size were selected for purification and preservation.

[0016] A total of 47 strains were isolated, including 1 fungus, 24 bacteria and 22 actinomycetes.

[0017] The 47 isolated strains were fermented with ISP2 liquid medium containing 4% XAD-16 macroporous adsorption resin, 300 mL for each strain. The resin of each strain was collected, washed and dried, and then the macroporous adsorption resin was completely soaked in methanol for 4 times, each time for 4 hours, one of which was soaked overnight. The methanol soaking liquid was collected, and the methanol soaking liquid was extracted with methanol: water: dichloromethane = 1:1:2, and the dichloromethane phase was collected. The dichloromethane phase was concentrated using a rotary evaporator to obtain a dichloromethane extract, which was the crude extract of the strain fermentation.

[0018] The mycelium growth rate method was used to screen the biocontrol strains of rice blast and rice sheath blight. The crude extracts of each strain were dissolved in 0.5% (v / v) DMSO, fixed to volume with sterile water containing 0.25% (v / v) Tween-80, and mixed according to V agent: V culture medium = 1:9 to make a final concentration of 100μg / mL, and the corresponding solvent was used as a control. Use a puncher to punch out 5mm activated rice blast and rice sheath blight fungus cakes and place them in the center of the plate at 28℃. After 2-7 days, the colony diameter was measured and the inhibition rate was calculated. Each treatment was repeated 3 times.

[0019]

[0020] Finally, a strain was selected whose fermentation crude extract had good inhibitory effect on both pathogens. The inhibition rate on rice blast reached 99.06% (see Figure 1 ), the inhibition rate of rice sheath blight was 66.61% (see Figure 2 ). The strain was identified by morphology: Figure 3 As shown, its single colony is gray-white aerial hyphae; further, the strain was identified by molecular biology: the 16S rDNA sequencing results of the strain are as follows:

[0021]

[0022] The recA sequence is as follows:

[0023] CGGACGCGGGTGAGCGCCTCGGTGAGCGGCCGACGAGCCGATCGAGGTGATCCCCACCGGGTCCACCGCGCTCGACGTCGCGCTCGGCGTCGGCGGGCTGCCGCGCGGCCGCGTGGTGGAGGTGTACGGCCCGGAGTCCTCCGGCAAGACGACGCTGACGCTGCACGCTGTGGCGAACGCGCAGAAGCTCGGCGGCTCGGTGGCGTTCATCGACGCGGAGCACGCTCTGGACCCGGAGTACGCGAAGAAGCTCGGCGTCGACATCGACAGCCTCATCCTCTCGCAGCCGGACAACGGTGAGCAGGCGCTGGAGATCGTGGACATGCTGGTCCGCTCCGGTGCGCTGGACCTGATCGTCATCGACTCCGTCGCGGCCCTGGTGCCCCGTGCGGAGATCGAGGGCGAGATGGGCGACTCGCACGTGGGTCTGCAGGCCCGTCTGATGAGCCAGGCGCTCCGTAAGATCACGAGCGCGCTCAACCAGTCCAAGACCACCGCCATCTTCATCAACCAGCTCCGCGAGAAGATCGGGGTGATGTTCGGCTCCCCGGAGACCACGACCGGTGGCCGGGCGCTGAAGTTCTACGCCTCGGTGCGTCTGGACATCCGTCGGATCGAGACGTTGAAGGACGGCACCGACGCCGTGGGCAACCGCACCCGCGTCAAGGTCGTCAAGAACAAGGTGGCGCCGCCCTTCAAGCAGGCGGAATTCGACATCCTCTACGGTCAGGGCATCAGCCGTGAGGGCGGTCTGATCGACATGGGAGTGGAGCACGGCTTCGTCCGCAAGGCCGGT

[0024] GCCTGGTACACCTACGAGGGTGACCAGCTCGCCAGACATGAGACTTTCCGG。

[0025] The atpD sequence is as follows:

[0026] TCATCGCTTCAGATGCCATGTCCGCGCCGGAGGCCGAGGCGCAGATCACCGAGCGCTGGCCGATCCACCGCAAGGCCCCGGCCTTCGACCAGCTCGAGTCCAAGACCGAGATGTTCGAGACCGGACTGAAGGTCGTCGACCTGCTGACCCCGTACGTCAAGGGCGGCAAGATCGGTCTCTTCGGTGGTGCGGGCGTCGGCAAGACGGTCCTCATCCAGGAAATGATCATGCGTGTGGCGAAGCTGCACGACGGTGTGTCGGTGTTCGCCGGTGTCGGCGAGCGCACCCGTGAGGGCAACGACCTCATCGACGAGATGACCGACTCGGGCGTCCTGGAGAAGACCGCGCTGGTCTTCGGCCAGATGGACGAGCCGCCGGGCACCCGTCTGCGGGTCGCGCTGTCCGCCCTGACCATGGCGGAGTACTTCCGCGATGTGCAGAAGCAGGACGTGCTGCTCTTCATCGACAACATCTTCCGCTTCACGCAGGCCGGTTCCGAGGTCTCCACGCTGCTCGGCCGCATGCCGTCCGCAGTGGGTTACCAGCCGACCCTGGCCGACGAGATGGGTGTGCTCCAGGAGCGCATCACCTCGACGCGTGGTCACTCGATCACCTCGATGCAGGCGATCTACGTCCCCGCGGACGACCTGACCGACCCGGCCCCGGCCACCACGTTCGCCCACCTCGACGCGACGACGGTTCTCTCCCGTCCGATCTCCGAGAAGGGCATCTACCCGGCCGTGGACCCGCTGGACTCCACGTCCCGCATCCTGGACCCGCGCTACATCGCGCAGGACCACTACGACACGGCCAGCCGTGTCAAGGGGATCCTGCAGAAGTACAAGGACCTCCAGGACATCATCGCGATCCTCGGTATCGACGAGCTGGGCGAGGAGGACAAGCTCGTTGTCCACCGTGCCGCGTCGCGTCAGAGGCGGCGA。

[0027] The 16S rDNA, recA and atpD sequences of the strain were compared by BLAST on NCBI, and the 16S similar strains were used as the tree building group to download the 16S, recA and atpD gene sequences (see Table 1).

[0028] Table 1 16S, recA and atpD gene sequence numbers of strains used in strain construction

[0029]

[0030] After linear splicing of the 16S-recA-atpD sequences, the phylogenetic tree was constructed using MEGA7 software (see Figure 4 ), combined with morphological characteristics analysis, the strain was finally identified as Streptomyces mutomycini LZ-734, which was deposited in the General Microbiology Center of China Culture Collection Administration on October 9, 2024, with the deposit number CCTCC NO: 32156, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0031] Example 2 Evaluation of the inhibitory effect of Streptomyces mutomycini LZ-734 on rice blast and rice sheath blight

[0032] The Streptomyces mutomycini LZ-734 was fermented with 300 mL of ISP2 liquid medium containing 4% XAD-16 macroporous adsorption resin, and the resins of each strain were collected, washed, dried, and then completely soaked in methanol for 4 times, each time for 4 hours, one of which was soaked overnight. The methanol soaking liquid was collected, and the methanol soaking liquid was extracted with methanol: water: dichloromethane = 1:1:2, and the dichloromethane phase was collected. The dichloromethane phase was concentrated using a rotary evaporator to obtain a dichloromethane extract, which was the fermentation crude extract of strain LZ-734.

[0033] The crude extract of strain LZ-734 fermentation was dissolved in 0.5% (v / v) DMSO, fixed to volume with sterile water containing 0.25% (v / v) Tween-80, and mixed according to V agent: V culture medium = 1:9 to make a final concentration of 100 μg / mL, and the corresponding solvent was used as a control. A 5mm activated rice blast fungus and rice sheath blight fungus cake was punched out with a hole puncher and placed in the center of the plate. At 28°C, the colony diameter was measured after 2-7 days and the inhibition rate was calculated. Each treatment was repeated 3 times and the average value was taken. The results are shown in Table 2.

[0034]

[0035] Table 2 Inhibitory effect of strain LZ-734 on rice blast pathogen and rice sheath blight pathogen

[0036]

[0037] It can be seen from Table 2 that the Streptomyces mutomycini LZ-734 of the present invention has a good inhibitory effect on both rice blast pathogen and rice sheath blight pathogen.

[0038] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A biocontrol strain Streptomyces mitomycinicola, characterized in that: The strain is Streptomyces mutomycini LZ-734, which was deposited in the General Microbiology Center of China Culture Collection Administration on October 9, 2024, with the deposit number CCTCC NO: 32156, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the biocontrol strain Streptomyces mitomyces as claimed in claim 1 in controlling rice blast and rice sheath blight.

Images