Red fluorescence mutation and repair system for rapidly evaluating editing efficiency of PE editing system and application of red fluorescence mutation and repair system

Abstract

The invention discloses a red fluorescence mutation and repair system for rapidly evaluating the editing efficiency of a PE editing system and application of the red fluorescence mutation and repair system. A red fluorescence mutation and repair system for rapidly evaluating the mutation efficiency of the PE editor comprises the recombinant expression vector P2A-mDSred. The PE editor is selected from PE protein or cells for expressing the PE protein. The DMRS constructed by the method can be used for rapidly detecting the PE editing efficiency, and a foundation is laid for further research of a PE editing technology. A new material is provided for the research of the PE editing technology, in addition, the variety of the small molecule drugs for promoting the PE editing efficiency can be determined, and a research foundation is laid for the development of the gene editing technology.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to a red fluorescent mutation and repair system for rapidly evaluating the editing efficiency of a PE editing system and an application thereof. Background Art

[0002] The development of gene editing technology has promoted human exploration of the field of life sciences. The classic gene editing technology is mainly based on the CRISPR / Cas9 gene editing system published by Jennifer A Doudna in Science in 2012. [1] . This technology can delete or insert bases or base fragments at any gene site, but the biggest drawback of this technology is that the CRISPR / Cas9 system needs to cut the DNA double strands when working, and the cell will introduce a large number of uncertain bases (called indels) when repairing the "wound", which poses a hidden danger to biosafety. In addition, the insertion of exogenous genes requires the mediation of the homologous recombination repair (HRR) mechanism in the cell to achieve the purpose, but the probability of this mechanism occurring is less than 1%. [2] In order to improve the accuracy of gene editing technology, David Liu's team published a research paper on base editing technology in Nature in 2016. It first reported a technology called base editing, which is a method that can directly perform precise editing of target bases in genomic DNA without causing double-strand breaks in DNA. [3] However, as the research continues, the technology still has some limitations, such as the limited editing range (only C·G to T·A or A·T to G·C editing) [4] , and a large number of off-target single nucleotide variants were generated [5] In 2019, David Liu et al. reported on the Prime editors (PEs) system in Nature. The team fused Moloney murine leukemia virus reverse transcriptase (M-MLV RT) to the C-terminus of nCas9 to obtain the first-generation Prime editor (PE1), but the editing efficiency was extremely low. To improve the editing activity of PEs, the team constructed different M-MLVRT enzyme mutants to obtain the PE2 system with high editing efficiency. [6] .

[0003] Since its development, the PEs system has shown great potential and prospects in various organisms. [7] This technique has been successfully applied to mammals [8] (such as humans, mice, rabbits) and important crops [9]The genome editing of rice and wheat shows its wide applicability and high efficiency in the field of gene editing. The research team of Gao Caixia, a researcher, and the research team of Wang Xiaolong, a professor at Northwest Agriculture and Forestry University, respectively demonstrated the potential of the PE system in rice, wheat and mice, showing its strong application value not only in agricultural crop improvement, but also in medical research and disease model construction. These studies further verified the diversity and flexibility of PE technology and proved that it can provide a more precise and efficient tool for gene editing.

[0004] Although the PE editing system has shown its broad application potential, the efficiency of current PE editors still varies greatly among different targets, cell types and species. [6,10] To further improve the editing efficiency of PE, David Liu's group used modified pegRNA (adding evopreQ1 or mpknot to the 3′ end of the pegRNA to protect the 3′ extension from nuclease exonucleases). Compared with typical pegRNA, these engineered pegRNAs (epegRNA) increased the editing efficiency by 1.5-4 times.

[10] In addition, they also found that DNA mismatch repair (MMR) would hinder PE editing and cause the generation of editing byproducts indel

[11] , for this purpose, the PE4 and PE5 gene editing systems were developed to improve the PE editing efficiency by expressing MMR inhibitory proteins. In short, the PE editing system consists of two parts: one is the editor PE fusion protein, which is composed of nickase and reverse transcriptase, and its coding sequence is greater than 6kb. The second is Prime Editing GuideRNA (pegRNA), whose sequence size is about 120bp. The editing of the target site can be achieved after the two are co-transfected into the cell.

[0005] In addition, the implementation of PE editing technology requires co-transfection of multiple vectors into cells, collecting cells after 72 hours of culture, extracting cell genomic DNA, and sequencing after PCR amplification. Finally, statistical analysis of sequencing results is performed to calculate editing efficiency. The long cycle of detecting PE editing efficiency and cumbersome steps limit the research and application of PE. Moreover, during the implementation of PE editing technology, two vectors (i.e., PE protein and pegRNA) need to be transferred at the same time. Co-transfection of multiple vectors into cells has a certain toxic effect on cells, and PE protein vectors are relatively large (PE protein vectors include PE2 about 9.7kbp, PEmax about 9.7kbp, PE4 about 1.2kbp, PE4max about 1.2kbp, etc.), which increases the difficulty of transferring vectors into cells. Summary of the invention

[0006] The purpose of the present invention is to provide a mutated red fluorescent protein encoding gene fragment in view of the above-mentioned deficiencies in the prior art.

[0007] The second object of the present invention is to provide a recombinant expression vector P2A-mDSred containing the mutated red fluorescent protein encoding gene fragment.

[0008] The third object of the present invention is to provide a red fluorescent mutation and repair system for rapidly evaluating the editing efficiency of the PE editing system.

[0009] The fourth object of the present invention is to provide a 293T cell line PE2-293T that conditionally expresses PE2.

[0010] The fifth object of the present invention is to provide the application of the red fluorescent mutation and repair system in evaluating the editing efficiency of PE editor.

[0011] The sixth object of the present invention is to provide a system for screening drugs that promote the editing efficiency of the PE system and its application.

[0012] The purpose of the present invention can be achieved through the following technical solutions:

[0013] A mutant red fluorescent protein encoding gene fragment, the sequence of which is shown in SEQ ID NO.1.

[0014] A recombinant expression vector P2A-mDSred containing the mutated red fluorescent protein encoding gene fragment.

[0015] As a preferred embodiment of the present invention, the recombinant expression vector P2A-mDSred is mainly constructed by the following method: synthesizing the mutated red fluorescent protein encoding gene fragment and the linearized P2A-DSred plasmid shown in SEQ ID NO.2, and then connecting the mutated red fluorescent protein encoding gene fragment and the linearized P2A-DSred plasmid fragment by homologous recombination reaction to obtain a mutated P2A-DSred plasmid, named P2A-mDSred.

[0016] A red fluorescent mutation and repair system for rapidly evaluating the mutation efficiency of a PE editor comprises the recombinant expression vector P2A-mDSred. The PE editor is selected from PE protein or cells expressing PE protein.

[0017] As a preferred embodiment of the present invention, the red fluorescence mutation and repair system further comprises any one of the following:

[0018] (1) comprising a pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment;

[0019] (2) A mut-peg vector, which contains a pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment.

[0020] As a preferred embodiment of the present invention, the pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment shown in SEQ ID NO.3 is constructed into the pU6-pegRNA-GG-acceptor vector to obtain the mut-peg vector.

[0021] A 293T cell line PE2-293T that conditionally expresses PE2 was constructed mainly by the following methods:

[0022] (1) First, the Cas9 cDNA gene on the pCW-Cas9 vector was removed using DNA restriction endonucleases NheI and BamHI to obtain a linearized pCW vector backbone, the pCMV-PE2 vector was amplified by PCR to obtain the PE2 DNA sequence, and the PE2 DNA sequence was connected to the linearized pCW vector backbone to obtain the pCW-PE2 vector;

[0023] (2) Using liposome transfection, 300 ng of pCW-PE2, 600 ng of pMD2.G, and 900 ng of psPAX2 were co-transfected into 293T cells to obtain lentivirus;

[0024] (3) Infecting 293T cells with the lentivirus obtained in step (2) by viral infection to obtain a 293T cell line that conditionally expresses PE2, wherein the cell line can conditionally express PE2 protein in the host cell under the condition of adding doxycycline.

[0025] The application of the red fluorescent mutation and repair system in evaluating the editing efficiency of PE editor. The PE editor is selected from PE protein or cells expressing PE protein.

[0026] The red fluorescent mutation and repair system is combined with the PE2-293T in the screening of drugs that promote the editing efficiency of the PE system.

[0027] A system for screening drugs that promote the editing efficiency of the PE system, comprising the red fluorescent mutation and repair system and a PE editor, wherein the PE editor is a vector or cell expressing PE2, preferably a pCMV-PE2 vector, a pCW-PE2 vector or the 293T cell line PE2-293T that conditionally expresses PE2 as described in claim 7.

[0028] Beneficial effects:

[0029] The DMRS constructed by the present invention can quickly detect the PE editing efficiency, laying a foundation for further research on the PE editing technology. On the other hand, the PE2-293T cell line constructed by the present invention has a 50% PE2 protein expression level and has the ability to participate in optimizing the PE editing efficiency. In general, the present invention provides a new material for the research of PE editing technology, and can also determine the types of small molecule drugs that promote PE editing efficiency, laying a research foundation for the development of gene editing technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Mutation design and vector construction of DSred

[0031] Figure A shows the P2A-desred map, Figure B shows the construction method of P2A-mDSred, and Figure C shows the schematic diagram of DSred mutation sites

[0032] Figure 2 Mutation site vector sequencing results

[0033] Figure 3 DSred expression after mutation of amino acid 72

[0034] Figure 4 DMRS Test Results

[0035] Figure 5 Using DMRS to detect the repair efficiency of different editors for red fluorescence

[0036] Figure 6 Using DMRS to screen small molecule drugs that promote PE editing

[0037] Figure 7 Partial results of pCW-PE2 vector first generation sequencing

[0038] Figure 8 Immunofluorescence detection of Cas9 expression level in PE2-293T. DAPI indicates that DAPI was used for nuclear staining, Cy3-Cas9 indicates that the antibody is the primary antibody for Cas9, and Dox - Indicates that the culture medium does not contain Dox. + Indicates that the culture medium contains Dox.

[0039] Fig. 9 Comparison of PE editing efficiency between PE2-293T and 293T cells

[0040] Fig.10 Testing of DMRS in PE2-293T cells DETAILED DESCRIPTION

[0041] Example 1

[0042] (1) DSred mutation design and vector construction

[0043] According to the DSred sequence analysis, Figure 1 As shown, the present invention selects the mutation of amino acid TAC at position 72 to TAG, and TAG is a stop codon, so as to terminate the transcription and translation of DSred in advance. First, the mutated DSred fragment (CTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTAGTGAAGCA CCCCGCCGACATCCCCGACTACAAGA (SEQ ID NO.1)) is synthesized, and the P2A-DSred plasmid is linearized (SEQ ID NO.2), and the primers are Fw: 5`-ACATCCCCGACTACAAGAAGCT-3`, Rv: 5`-GGA CAGGATGTCCCAGGCGAAG-3`), and then the mutated DSred fragment and the linearized P2A-DSred plasmid are connected by homologous recombination reaction, and the results after sequencing are as follows. Figure 2 As shown, TAC was successfully mutated to TAG, and the mutated P2A-DSred plasmid met expectations after enzyme digestion (enzyme digestion sites BamH1 and H pal, resulting in fragments of 899 bp and 3873 bp), and the mutated P2A-DSred plasmid was named P2A-m DSred.

[0044] (2) DMRS construction

[0045] The constructed P2A-mDSred was transferred into 293T cells and cultured at 37°C and 5% CO2 for 72 h, and then the expression of the mutated DSred was observed. Figure 3 As shown, the red fluorescence disappears after mutation, indicating that this site can be used for subsequent construction of DMRS.

[0046] Subsequently, a pegRNA (mut-peg: CCAGTTCCAGTACGGCTCCAGTTTTAGA GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCACCTACACCTTGGAGCCGTACTGGA (SEQ ID NO.3)) was designed for the mutation site and constructed into the pU6-pegRNA-GG-acce ptor vector (Addgene #132777) to obtain the mut-peg vector. The P2A-mDSred vector, the corresponding mut-peg vector and the pCMV-PE2 vector were co-transfected into 293T cells, and the red fluorescence ratio was counted after 48 hours. The results are shown in Figure 4As shown, the mutation site was successfully repaired by PE2 and mut2-peg, indicating that the present invention successfully constructed DMRS, laying a foundation for the subsequent screening of small molecule drugs that can promote PE editing efficiency.

[0047] (3) Application of DMRS in PE editing

[0048] According to existing reports, the editing efficiency of the PE editing system in pig species is extremely low or almost undetectable. In order to quickly screen for PE editors with higher editing efficiency, the present invention co-transfected DMRS with PE2, PEmax, PE4, and PE4max into PK15 cells. The red fluorescence ratio was detected by flow cytometry, and the editors with higher editing efficiency were screened for subsequent research. The results are shown in Figure 5 As shown, all editors tested have editing efficiency in PK15 cells, among which PE4 and PE4max have the highest efficiency. This indicates that when performing PE editing in pig species, choosing PE4 or PE4max as the editor has the highest efficiency.

[0049] On the other hand, small molecule drugs also affect the efficiency of PE editing. In order to improve the application of PE editing technology in pig species, the present invention uses the DMRS system to test different small molecule drugs in PK15 cells that conditionally express PE2 (the construction of PK15 cells that conditionally express PE2 is detailed in Example 1 of CN118389603A). P2A-mDSred and mut-peg vectors were co-transfected into PK15 cells that conditionally express PE2. The culture medium contained Dox and different concentrations of small molecule drugs 5-Azacytidine (Aza), Trichostatin A (TSA), and Cephalosporin C zinc salt (CPC). The cells were cultured at 37°C and 5% CO2 for 72 hours, and the red fluorescence repair ratio was finally counted. The results are as follows. Figure 6 The results showed that the present invention screened three small molecule drugs, and the highest efficiency of Aza was 28.00%, TSA was 27.27%, and CPC was 18.4. This result shows that Aza, CPC and TSA have significant effects on promoting PE editing efficiency, among which Aza has the best effect. It can be seen that DMRS can quickly screen small molecule drugs that can promote PE editing.

[0050] Example 2

[0051] (1) Construction of pCW-PE2 vector

[0052] After constructing DMRS, in order to further expand the scope of application of DMRS and simplify the PE editing process. The present invention constructs a 293T cell line that conditionally expresses PE2. The advantage is that when implementing PE editing in this cell, there is no need to electroporate the PE editor plasmid, and only the drug Dox that induces the PE editor needs to be added to the culture medium. On the other hand, it is to screen more favorable factors that can promote the efficiency of PE editing in human cells. For example, small molecule drugs, the development of different editors, etc.

[0053] First, the Cas9 cDNA on the pCW-Cas9 vector (Addgene #50661) was excised using DNA restriction endonucleases (NheI and BamHI), and the linearized pCW vector backbone was obtained after gel recovery. Then, primers (Fw 5`-CTATATAAGCAGAGCTCGTGACCCAAGCTGGCTAGCGTT-3`, Rv5`-GTGAAGAATGTGCGAGACACAGTCGAGGCTGATCAGCG-3`) were designed to amplify the PE2 sequence on the pCMV-PE2 vector, and the PE2 DNA sequence was obtained after gel excision and recovery. Finally, the seamless cloning kit connected the PE2 DNA sequence to the pCW vector backbone to obtain the pCW-PE2 vector, and the first-generation sequencing confirmed that the vector was successfully constructed ( Figure 7 ).

[0054] (2) Lentiviral packaging and infection

[0055] Virus packaging: 293T cells were inoculated in a 6-well plate. When the cell confluence was about 70%, 300ng of pCW-PE2, 600ng of pMD2.G, and 900ng of psPAX2 were co-transfected into 293T cells using liposome transfection. The cell culture conditions were: 10% FBS, 90% DMEM medium, 5% CO2, 37°C. After 72h, the supernatant virus was collected and filtered, and stored at -80°C for later use after aliquoting.

[0056] Host cell infection: 293T cells were inoculated into a 6-well plate coated with 0.01% poly-D-lysine. When the confluence reached 50%, the upper culture medium was removed and 2 ml of new culture medium (containing 0.5 ml of virus stock solution, 1.5 ml of fresh culture medium and 16 ug of polybrene) was added for infection for 12-18 hours. The upper culture medium was removed again and 2 ml of fresh culture medium was added for further culture for 24 hours.

[0057] Host cell induction and positive cell screening: 1 μg / ml Dox was then added to the culture medium for induction for 48 h. The supernatant culture medium was removed, and 4 μg / ml puromycin was added to the culture medium for drug screening. Positive cells were obtained after 72 h of screening.

[0058] (3) Immunofluorescence detection of Cas9 levels in 293T cells conditionally expressing PE2

[0059] The cells after drug screening were inoculated into a 24-well plate coated with 0.01% poly-D-lysine. The culture medium contained 1μg / ml Dox. After culturing for 48 hours, the cells were collected for immunofluorescence detection of Cas9 protein levels. After washing the collected cells three times with PBS, 4% paraformaldehyde was added for fixation for 15 minutes. Then, the cells were treated with 0.1% Triton X-100 for 5-10 minutes for cell membrane permeabilization. After that, the blocking solution was added for 1 hour, and then the primary antibody (Cas9, Abcam, 1:1000) was incubated at 4°C overnight. After washing with PBS, the secondary antibody (Cy3, Abclonal, 1:500) was incubated at room temperature for 1 hour, and the nuclear staining was performed for microscopic examination. The results are as follows Figure 8 As shown, more than 50% of the cells expressed Cas9, which indicated that the present invention preliminarily screened 293T cells that conditionally expressed PE2.

[0060] (4) PE2-293T cell function verification

[0061] In order to further confirm whether PE2-293T has editing ability after being transferred into pegRNA, the present invention conducted an editing experiment based on the editing sites reported in the literature. Three different editing methods of the FACF gene locus were selected for testing, namely, three pegRNAs, FANCF_mut / ins / del (FANCF_mut: GGAATCCCTTCTGCAGCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGAAAAGCGATCAAGGTGCTGCAGAAGGGA, FANCF_ins: GGAATCCCTTCTGCAGCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGAAAAGCGATCCAATCGGTGCTGCAGAAGGGAT, FANCF_del: GGAATCCCTTCTGCAGCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGAAAAGCGAAGGTGCTGCAGAAGGGAT). First, three pegRNA sequences, FANCF_mut / ins / del, were synthesized. The construction of the three pegRNA vectors of FANCF was the same as the construction method of the mut-peg vector in Example 1. The pegRNA of FANCF was electroporated into PE2-293T cells at 1150v, 20ms, and 1puls, and cultured in the presence of Dox for 72h. Similarly, the pcmv-PE2 vector and the pegRNA vector of FANCF were co-transfected into 293T cells, respectively. After culturing the above cells for 72h, the cells were collected to extract DNA for PCR amplification, and then library construction and sequencing analysis were performed. CRISPResso was used to analyze the editing efficiency, and the running script was obtained from GitHub. The results are shown in the figure. Fig. 9 As shown, the editing efficiency of PE2-293T cells is significantly improved compared with that of 293T cells.

[0062] In addition, in order to test whether PE2-293T cells can be used in combination with DMRS, and to provide a basis for further optimization of subsequent PE editing technology, the present invention co-transfected the P2A-mDSred vector and the corresponding mut-peg vector into PE2-293T cells, and the red fluorescence repair efficiency was counted after 48 hours. Fig.10As shown in the figure, under Dox-induced conditions, red fluorescence was successfully restored, indicating that the combination of DMRS and PE2-293T cells is feasible.

Claims

1. A mutant red fluorescent protein encoding gene fragment, characterized in that The sequence is shown as SEQ ID NO.

1.

2. A recombinant expression vector P2A-mDSred containing the mutated red fluorescent protein encoding gene fragment according to claim 1.

3. The recombinant expression vector P2A-mDSred according to claim 2, characterized in that The recombinant expression vector P2A-mDSred is mainly constructed by the following method: synthesizing the mutated red fluorescent protein encoding gene fragment described in claim 1 and the linearized P2A-DSred plasmid shown in SEQ ID NO.2, and then connecting the mutated red fluorescent protein encoding gene fragment and the linearized P2A-DSred plasmid fragment by homologous recombination reaction to obtain a mutated P2A-DSred plasmid, named P2A-mDSred.

4. A red fluorescent mutation and repair system for rapid evaluation of PE editor editing efficiency, characterized in that: Comprising the recombinant expression vector P2A-mDSred according to claim 2 or 3.

5. The red fluorescence mutation and repair system according to claim 4, characterized in that: The red fluorescent mutation and repair system further comprises any one of the following: (1) comprising a pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment according to claim 1; (2) A mut-peg vector, which contains a pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment according to claim 1.

6. The red fluorescence mutation and repair system according to claim 5, characterized in that: The pegRNA designed for the mutation site in the mutated red fluorescent protein encoding gene fragment according to claim 1 as shown in SEQ ID NO.3 is constructed into the pU6-pegRNA-GG-acceptor vector to obtain the mut-peg vector.

7. 293T cell line PE2-293T expressing PE2 conditionally, characterized in that It is mainly constructed by the following methods: (1) First, the Cas9 cDNA gene on the pCW-Cas9 vector was removed using DNA restriction endonucleases NheI and BamHI to obtain a linearized pCW vector backbone, the pCMV-PE2 vector was amplified by PCR to obtain the PE2 DNA sequence, and the PE2 DNA sequence was connected to the linearized pCW vector backbone to obtain the pCW-PE2 vector; (2) Using liposome transfection, 300 ng of pCW-PE2, 600 ng of pMD2.G, and 900 ng of psPAX2 were co-transfected into 293T cells to obtain lentivirus; (3) Infecting 293T cells with the lentivirus obtained in step (2) by viral infection to obtain a 293T cell line that conditionally expresses PE2, wherein the cell line can conditionally express PE2 protein in the host cell under the condition of adding doxycycline.

8. Use of the red fluorescent mutation and repair system according to any one of claims 4 to 6 in evaluating the editing efficiency of a PE editor.

9. Use of the red fluorescent mutation and repair system according to any one of claims 4 to 6 in combination with PE2-293T according to claim 7 in screening drugs that promote the editing efficiency of the PE system.

10. A system for screening drugs that promote PE system editing efficiency, characterized in that It comprises the red fluorescent mutation and repair system according to any one of claims 4 to 6, and a PE editor, wherein the PE editor is a vector or cell expressing PE2, preferably a pCMV-PE2 vector, a pCW-PE2 vector, or the 293T cell line PE2-293T that conditionally expresses PE2 according to claim 7.

Images