X chromosome telomere length detection primer, kit and detection method

Abstract

The invention relates to the technical field of molecular biology and medical monitoring, in particular to an X chromosome telomere length detection primer, a kit and a detection method. The primer group comprises a primer TEL-F / R for amplifying a sample X chromosome telomere and a primer DAX1-F / R for amplifying an internal reference single copy gene. The primer group provided by the invention has the characteristics of strong detection specificity, high amplification efficiency, good stability, good sensitivity, good repeatability and the like. Meanwhile, the two groups of primers are suitable for different age groups, and proper primers and kits can be selected for detection according to the age groups of sampling samples. According to the method, RT-qPCR is used for telomere length measurement, through telomere and internal reference single tube detection, inter-pore interference is reduced, and the result comparability can be effectively improved. Meanwhile, the method has the advantages of low DNA consumption and high measurement speed, is time-saving, efficient, economical and quick, has high pertinence and high sensitivity, and is suitable for measuring the telomere length of large-scale crowds.

Description

Technical Field

[0001] The invention relates to the field of molecular biology and medical monitoring technology, in particular to a primer, a kit and a detection method for X chromosome telomere length. Background Art

[0002] Telomeres are protective structures at the ends of eukaryotic chromosomes composed of repetitive DNA sequences and special proteins. Human diploid cells have 46 chromosomes and 92 telomere DNAs. The proliferation capacity of normal human fibroblasts in vitro culture is not unlimited. Cell division and proliferation will appear senescence after 40 to 60 generations, which is the "Hayflick" limit. Studies have shown that the "Hayflick" limit is due to the inability of DNA polymerase to completely replicate the 3' end of linear chromosomes, resulting in the continuous loss of telomere DNA repeat sequences with each round of DNA replication. When it is shortened to a certain length, the cell enters the aging stage, so telomere length is considered to be one of the biomarkers of aging.

[0003] Telomere length is affected by many factors, such as genetics, gender, age, disease status and lifestyle. Among them, telomere length is related to many diseases, such as neurodegenerative diseases, idiopathic pulmonary fibrosis and inflammatory bowel disease, so being able to accurately and effectively measure telomere length is a very important part of the life science field.

[0004] Existing technologies for measuring telomere length include the following:

[0005] 1. Telomere terminal restriction fragment analysis (TRF), this technology is considered to be the "gold standard" for measuring telomere length, but it requires a large amount of DNA and a long experimental cycle.

[0006] 2. Real-time fluorescence quantitative PCR (quantitative PCR, q PCR): Use specific primers to amplify telomeres, estimate the total length of telomeres (T) by collecting fluorescence, and use primers of single-copy genes to amplify single-copy genes to estimate the number of genome copies (S). According to the T / S ratio, the average length of X chromosome telomeres in each diploid genome is estimated. The advantages of this method are good consistency with the TRF method, low sample volume requirements (10ng is enough), and quick, simple, economical and efficient operation. The limitation is that the results obtained reflect the relative length of the telomeres rather than the absolute length. Short telomeres cannot be measured, and the variability between samples is large, and the error in the pipetting process is large.

[0007] 3. Quantitative fluorescence in situ hybridization (Q-FISH): Use fluorescently labeled telomere probes to directly hybridize telomere DNA on chromosomes in metaphase of mitosis, and use a fluorescence microscope equipped with a digital camera and a professional computer to analyze the fluorescence signal. The measurement result is the true length of each chromosome, excluding the length of subtelomeric sequences. The limitation is that the telomeres of aging cells, non-dividing cells and highly distorted cells cannot be detected. It is time-consuming and labor-intensive and requires highly skilled technicians. This method is generally used in scientific research and is not suitable for measurements of the general population.

[0008] 4. Flow cytometry and flow fluorescence in situ hybridization (Flow FISH): It is to hybridize fixed and perforated cells with fluorescently labeled peptide nucleic acid probes that specifically recognize telomere regions. The telomere fluorescence signal is analyzed by flow cytometry and compared with the standard to obtain the average length of the whole telomere in a single cell. This method is the first telomere length detection method used for clinical diagnosis. It is currently the fastest and most sensitive method for detecting the average telomere length of granulocytes, T cells, B cells and NK cells in human blood. This method is only applicable to diploid cells and samples with complete nuclei and known and stable mitotic interphase cells and samples. It has a large error for tumor cells with highly variable nuclei. In addition, this method can only evaluate the average telomere length in a single cell, and cannot provide information on short telomeres. It has high technical requirements and is time-consuming and difficult to operate.

[0009] The above-mentioned telomere length detection methods all have their own limitations. Therefore, a time-saving, efficient, economical, fast, targeted and highly sensitive telomere detection method is urgently needed. Summary of the invention

[0010] The technical problem to be solved by the present invention is to provide a primer, a kit and a detection method for the length of telomere of chromosome X. To solve the above technical problem, the technical solution provided by the present invention is as follows:

[0011] A primer set for detecting X chromosome telomere length comprises a primer TEL-F / R for amplifying sample X chromosome telomere and a primer DAX1-F / R for amplifying an internal reference single copy gene.

[0012] As an improvement, the primers and primer sequences of the primer set are:

[0013] Tel-F:GGGATTTAGGGACTTGGGCC;

[0014] Tel-R:GGGACTGGGTTAACAGGGAC;

[0015] DAX1-F: CCAGGTCCAAGCCATCAAGT;

[0016] DAX1-R:GAAAACTCGTTACTGCCCGC.

[0017] As an improvement, the primers and primer sequences of the primer set are:

[0018] Tel-F:ATGAGCTGTGACACTCACCG;

[0019] Tel-R:ACAGGTGCTCTTCTAGGGGT;

[0020] DAX1-F: CCAGGTCCAAGCCATCAAGT;

[0021] DAX1-R:GAAAACTCGTTACTGCCCGC.

[0022] The invention also discloses a X chromosome telomere length detection kit, comprising the above primer set, PCR enzyme, buffer, dNTP, template and ultrapure water.

[0023] The present invention also discloses a method for detecting the length of X chromosome telomere, comprising the following steps:

[0024] S1. Material handling

[0025] Peripheral whole blood was obtained from the patients, and the total DNA of peripheral blood leukocytes was extracted using a DNA extraction kit, and the DNA concentration was measured using a spectrophotometer and diluted to the same concentration;

[0026] S2. Perform RT-qPCR assay using the kit;

[0027] S3. Experimental data analysis.

[0028] As an improvement, the DNA concentration in the S1 step is diluted to 10 ug / ml.

[0029] As an improvement, the experimental data in step S3 were analyzed using GraphPad Prism 9.

[0030] The advantages of the present invention are:

[0031] 1. The primer set of the present invention has the characteristics of strong detection specificity, high amplification efficiency, good stability, good sensitivity, good repeatability, etc. At the same time, the two sets of primers of the present invention are suitable for different age groups, and suitable primers and kits can be selected for detection according to the age group of the sample.

[0032] 2. The present invention uses RT-qPCR to measure telomere length, and reduces the interference between wells by detecting telomeres and internal references in a single tube, which can effectively improve the comparability of the results. At the same time, the present invention has the advantages of small DNA usage and fast measurement speed, which is time-saving, efficient, economical, fast, targeted, and highly sensitive, and is suitable for large-scale population telomere length measurement. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a result diagram of the conventional PCR verification of primer specificity in Example 1.

[0034] Figure 2 This is the amplification curve of Tel-4 in Example 1.

[0035] Figure 3 This is the dissolution curve of Tel-4 in Example 1.

[0036] Figure 4 This is the amplification curve of the primer DAX1 of the internal reference single copy gene in Example 1.

[0037] Figure 5 This is the melting curve of the primer DAX1 of the internal reference single copy gene in Example 1.

[0038] Figure 6 It is a scatter plot of all samples in Example 1.

[0039] Figure 7 This is a bar graph showing the correlation between telomere length and age of the samples in Example 1.

[0040] Figure 8 This is a result diagram of the conventional PCR verification of primer specificity in Example 2.

[0041] Fig. 9 This is the amplification curve of Tel-6 in Example 2.

[0042] Fig.10 This is the dissolution curve of Tel-6 in Example 2.

[0043] Fig.11 This is the melting curve of the primer DAX1 of the internal reference single copy gene in Example 2.

[0044] Fig.12 This is the amplification curve of the primer DAX1 of the internal reference single copy gene in Example 2.

[0045] Fig.13 It is a scatter plot of all samples in Example 2.

[0046] Fig.14 This is a bar graph showing the correlation between telomere length and age of the samples in Example 2. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0048] Example 1

[0049] This embodiment discloses a primer set for detecting telomere length of chromosome X, which includes primers TEL-F / R for amplifying telomeres of chromosome X of a sample and primers DAX1-F / R for amplifying an internal reference single copy gene.

[0050] The sequences of the primer sets are:

[0051] Table 1 Primers and primer sequences

[0052]

[0053] The primer set is used to prepare a kit for detecting telomere length, including the primer set and PCR enzyme, buffer, dNTP, template and ultrapure water; the reaction system is as follows:

[0054] Table 2 RT-qPCR reaction system

[0055]

[0056] Table 3 Internal reference single copy gene reaction system

[0057]

[0058] The method for detecting telomeres using the above kit comprises the following steps:

[0059] S1. Material handling

[0060] Peripheral whole blood was obtained from the patient, and the total DNA of peripheral blood leukocytes was extracted using a DNA extraction kit, and the DNA concentration was measured using a spectrophotometer and diluted to 10ug / ml;

[0061] S2. Add samples for RT-qPCR assay;

[0062] S3. Experimental Data Analysis

[0063] Experimental structures were obtained and analyzed using GraphPad Prism 9.

[0064] Taking Tel-4 as an example, the primer set and the detection kit of this embodiment are verified. The specific verification test includes the following steps:

[0065] Step 1. Collect peripheral whole blood from healthy people of different ages;

[0066] Step 2. Extract the total DNA of peripheral blood leukocytes using a DNA extraction kit, measure the DNA concentration using a spectrophotometer, and dilute to the same concentration (10ug / ml);

[0067] Step 3. Design and synthesize primers: including primers TEL-F / R for amplifying sample X chromosome telomeres and primers DAX1-F / R for amplifying internal reference single copy genes; the sequences of the primer sets are shown in Table 1.

[0068] Step 4. Verify primer specificity by conventional PCR;

[0069] Step 5. RT-qPCR method to measure the telomere length of the population, the reaction system is shown in Table 2; single copy gene reaction system, the reaction system is shown in Table 3;

[0070] Step 6. Data analysis: Analyze using GraphPad Prism 9.

[0071] The test results show that the primer set of this embodiment exhibits good specificity in amplifying the primers TEL-F / R for the telomere of chromosome X of the sample and the primers DAX1-F / R for amplifying the single-copy gene of the internal reference. This indicates that the primers of the present invention can accurately identify and bind to the target sequence in the test, thereby ensuring the accuracy of amplification. The primers of the present invention also show a high amplification efficiency, indicating that a large amount of amplification products can be effectively generated in the reaction; during the detection process, the signal intensity can be increased and the detection limit can be reduced, thereby supporting more accurate analysis. According to Figure 6 and Figure 7 The data show that the primer set and kit used in this example show a high correlation with the actual telomere length when testing the telomere length of people aged 20-30 years old, and are suitable for detecting and analyzing the telomere length of people aged 20-30 years old. This provides an accurate and effective tool for biological research and health monitoring of people in this age group. In addition, the qPCR results show that age is negatively correlated with telomere length. This means that as age increases, telomere length gradually shortens, so this detection method can be used to make a relative assessment of a person's degree of aging. Through this assessment, valuable reference information can be provided for personal health status and degree of aging.

[0072] Example 2

[0073] This embodiment discloses a primer set for detecting telomere length of chromosome X, which includes primers TEL-F / R for amplifying telomeres of chromosome X of a sample and primers DAX1-F / R for amplifying an internal reference single copy gene.

[0074] The sequences of the primer sets are:

[0075] Table 4 Primers and primer sequences

[0076]

[0077]

[0078] The primer set is used to prepare a kit for detecting telomere length, including the primer set and PCR enzyme, buffer, dNTP, template and ultrapure water; the reaction system is as follows:

[0079] Table 5 RT-qPCR reaction system

[0080]

[0081] Table 6 Internal reference single copy gene reaction system

[0082]

[0083] The method for detecting telomeres using the above kit comprises the following steps:

[0084] S1. Material handling

[0085] Peripheral whole blood was obtained from the patient, and the total DNA of peripheral blood leukocytes was extracted using a DNA extraction kit, and the DNA concentration was measured using a spectrophotometer and diluted to 10ug / ml;

[0086] S2. Add samples for RT-qPCR assay;

[0087] S3. Experimental Data Analysis

[0088] Experimental structures were obtained and analyzed using GraphPad Prism 9.

[0089] Taking Tel-4 as an example, the primer set and the detection kit of this embodiment are verified. The specific verification test includes the following steps:

[0090] Step 1. Collect peripheral whole blood from healthy people of different ages;

[0091] Step 2. Extract the total DNA of peripheral blood leukocytes using a DNA extraction kit, measure the DNA concentration using a spectrophotometer, and dilute to the same concentration (10ug / ml);

[0092] Step 3. Design and synthesize primers: including primers TEL-F / R for amplifying sample X chromosome telomeres and primers DAX1-F / R for amplifying internal reference single copy genes; the sequences of the primer sets are shown in Table 1.

[0093] Step 4. Verify primer specificity by conventional PCR;

[0094] Step 5. RT-qPCR method to measure the telomere length of the population, the reaction system is shown in Table 2; single copy gene reaction system, the reaction system is shown in Table 3;

[0095] Step 6. Data analysis: Analyze using GraphPad Prism 9.

[0096] The test results are as follows Figure 8-12 As shown, in the primer set of this embodiment, the primers TEL-F / R for amplifying the telomere of chromosome X of the sample and the primers DAX1-F / R for amplifying the single copy gene of the internal reference both show good specificity. This shows that the primers can accurately identify and bind to the target sequence, thereby ensuring the accuracy and reliability of the amplification reaction. In addition, the primers of the present invention also have a high amplification efficiency, and can effectively produce a large amount of amplification products during the reaction process, thereby performing high-efficiency amplification, improving the sensitivity and signal strength of the detection, and ensuring the accuracy and stability of the detection results. According to Fig.13 and Fig.14 According to the data analysis, the primer set and kit used in this example showed a high correlation when testing the telomere length of people aged 30-70 years old. Especially for people over 40 years old, the detection effect is more ideal. This shows that in the evaluation of telomere length over 40 years old, this method provides higher accuracy and reliability. In addition, this detection method provides stronger support for aging detection and evaluation of people over 40 years old. Through the accurate measurement of telomere length of people in this age group, it can provide important reference data for health monitoring and aging research, and support more in-depth biological research and clinical applications.

[0097] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A primer set for detecting telomere length of chromosome X, characterized in that: The method includes primers TEL-F / R for amplifying the telomere of chromosome X of the sample and primers DAX1-F / R for amplifying the single copy gene of the internal reference.

2. A primer set for detecting telomere length of chromosome X according to claim 1, characterized in that: The primers and primer sequences of the primer set are: Tel-F:GGGATTTAGGGACTTGGGCC; Tel-R:GGGACTGGGTTAACAGGGAC; DAX1-F: CCAGGTCCAAGCCATCAAGT; DAX1-R:GAAAACTCGTTACTGCCCGC.

3. A primer set for detecting telomere length of chromosome X according to claim 1, characterized in that: The primers and primer sequences of the primer set are: Tel-F:ATGAGCTGTGACACTCACCG; Tel-R:ACAGGTGCTCTTCTAGGGGT; DAX1-F: CCAGGTCCAAGCCATCAAGT; DAX1-R:GAAAACTCGTTACTGCCCGC.

4. A kit for detecting telomere length of chromosome X, characterized in that: The kit contains the primer set according to claim 2 or 3.

5. A X chromosome telomere length detection kit according to claim 4, characterized in that: The kit includes a primer set, a PCR enzyme, a buffer, dNTPs, a template and ultrapure water.

6. A method for detecting telomere length of chromosome X, characterized in that: The steps include: S1. Material handling Peripheral whole blood was obtained from the patients, and the total DNA of peripheral blood leukocytes was extracted using a DNA extraction kit, and the DNA concentration was measured using a spectrophotometer and diluted to the same concentration; S2. Perform RT-qPCR assay using the kit; S3. Experimental data analysis.

7. A method for detecting telomere length of chromosome X according to claim 6, characterized in that: In the S1 step, the DNA concentration was diluted to 10 ug / ml.

8. A method for detecting telomere length of chromosome X according to claim 6, characterized in that: The experimental data in step S3 were analyzed using GraphPad Prism 9.

Images