Molecular marker related to tomato fruit sugar content and application thereof

Abstract

The invention provides a molecular marker related to the sugar content of tomato fruits and application of the molecular marker. The nucleotide sequence of the molecular marker is shown as SEQ ID No.1. The molecular marker provided by the invention can quickly and efficiently identify the sugar content of tomato fruits, and can be well applied to screening of the sugar content of tomato germplasm resources.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to the sugar content of tomato fruits and an application thereof. Background Art

[0002] The three types of sugar transporters in plants include sucrose transporters, monosaccharide transporters, and SWEET transporters. SWEETs are monosaccharide and sucrose transporters present in the plasma membrane or vacuole membrane of plants. They can transport sugar in two directions and promote the diffusion of sugar along the concentration gradient. The tomato genome contains 29 SWEET genes, of which SlSWEET7a and SlSWEET14 encode proteins located on the plasma membrane, which are involved in the transmembrane transport of fructose, glucose, and sucrose and are closely related to the accumulation of sugar in the fruit. Related studies have shown that the SWEET gene family may play a key role in the process of sugar synthesis. The expression levels of LbaSWEET9 and LbaSWEET29 genes in wolfberry were significantly positively correlated with the fructose content. MaSWEET1 was heterologously overexpressed in tomatoes, and it was found that the overexpressed transgenic tomato lines could promote the increase of sucrose and fructose content in the fruit. The sucrose, fructose, glucose, and starch contents in the leaves of tomato plants overexpressing MdSWEET23 were significantly higher than those of the wild type. Although there are many studies on the sugar content of tomato fruits, none of them provide a method for quickly identifying and distinguishing the high and low sugar content of tomato fruits. Therefore, it is urgent to provide a method for distinguishing the sugar content of tomato fruits to facilitate the screening of tomato germplasm resources. Summary of the invention

[0003] In view of this, the present invention provides a molecular marker related to the sugar content of tomato fruit and an application thereof, which can quickly detect the sugar content of tomato fruit.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a molecular marker related to the sugar content of tomato fruit, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1.

[0005] It should be noted that when the molecular marker is present and the sugar content of tomato fruit is low, the genotype is LS type; when the insertion is not present and the sugar content of tomato fruit is high, the genotype is HS type; the nucleotide sequence of the molecular marker is specifically: CATTAATACAGACT.

[0006] Preferably, the molecular marker is located at position 55102868 on chromosome 4 of tomato.

[0007] Preferably, the molecular marker is 16 bp.

[0008] In a second aspect, the present invention provides an application of the molecular marker in detecting the sugar content of tomato fruit.

[0009] Preferably, the nucleotide sequence of the forward primer of the primer set is shown as SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No.3.

[0010] In verifying the accuracy of the above molecular markers, the forward primer of the primer set is specifically GAGGGTTATTAGGTGATAGATTGT, and the reverse primer is specifically CACTTTCAATGCCCAGGAT.

[0011] Preferably, the primer set comprises an inner primer set and an outer primer set, wherein the nucleotide sequence of the forward primer Indel-Inside-F of the inner primer set is shown as SEQ ID No.4; the nucleotide sequence of the reverse primer Indel-Inside-R is shown as SEQ ID No.5; the nucleotide sequence of the forward primer Indel-Outside-F of the outer primer set is shown as SEQ ID No.6, and the nucleotide sequence of the reverse primer Indel-Outside-R is shown as SEQ ID No.7.

[0012] In the application of identifying tomato varieties, the primer set includes an inner primer set and an outer primer set, wherein the inner primer set includes a forward primer Indel-Inside-F: ATCTCATTAAATACAGATCTTAGTATAAA, and a reverse primer Indel-Inside-R: GGTAGATTTTATACTAAGATATAATAGACTC; the outer primer set includes a forward primer Indel-Outside-F: ATTTGTTACGATTTATTGATTCTTA, and a reverse primer Indel-Outside-R: GAGTGGCGAGTGAAACAAG.

[0013] In a third aspect, the present invention provides a method for detecting molecular markers related to sugar content in tomato fruit, comprising the following steps: S1. Using the total DNA of the tomato to be tested as a template, PCR amplification is performed using the primer pair described in claim 7, and then electrophoresis is performed for identification; S2. When the two bands of 579bp and 390bp appear at the same time in the electrophoresis results, the tomato fruit has a low sugar content. When the two bands of 563bp and 209bp appear at the same time, the tomato fruit has a high sugar content.

[0014] It should be noted that the specific nucleotide sequence of 579 bp is.The 390bp nucleotide sequence is specifically ATCTCATTAAATACAGATCTTAGTATAAAATCTACCATATCATATCTTATTAATAAATAATGTTAAATTAAGTATTATTTTCTCTTTACTTAACGACGCGGTTACATCCTGGGCATTGAAAGTGAAAGGACTACTTCAAATAAGTTCAATTGAATAAAAATAATAATAATACTCGCAATGGAAGAATTCACTATTTAGAAGCTAATCGTTTAGTTACACGCTAGTTTGCAGTAATACAAATTTTATCGTATTTTGGTATTTTCAGATATGTTTTAGATATATGTATGGATACATGAAGTTAAAATTAGGAATAGGTCATTTCGAATACAATGTATCTAAGTGGACTCTCATGTAATCTCGCTCGCCAGTCTCTTGTTTCACTCGCCACTC。

[0015] The 563bp nucleotide sequence is specifically ATTTGTTACGATTTATTGATTCTTATATTTTCATTATTTTTTTTAATTGAGTCGAGGATCCATCGAATGTATCTCTAAAGTGTGTATATTCGATTCGTTTGTGAGTCCATGTTGTGGCATTACATTAGATAATGTTGTTGTAATTAGGTACAAAGGAATAGAGGTGGAAGCTTCATTTGAGTCTATTATATCTTAGTATAAAATCTACCATATCATATCTTATTAATAAATAATGTTAAATTAAGTATTATTTTCTCTTTACTTAACGACGCGGTTACATCCTGGGCATTGAAAGTGAAAGGACTACTTCAAATAAGTTCAATTGAATAAAAATAATAATAATACTCGCAATGGAAGAATTCACTATTTAGAAGCTAATCGTTTAGTTACACGCTAGTTTGCAGTAATACAAATTTTATCGTATTTTGGTATTTTCAGATATGTTTTAGATATATGTATGGATACATGAAGTTAAAATTAGGAATAGGTCATTTCGAATACAATGTATCTAAGTGGACTCTCATGTAATCTCGCTCGCCAGTCTCTTGTTTCACTCGCCACTC。

[0016] The 209bp nucleotide sequence is specifically ATTTGTTACGATTTATTGATTCTTATATTTTCATTATTTTTTTTAATTGAGTCGAGGATCCATCGAATGTATCTCTAAAGTGTGTATATTCGATTCGTTTGTGAGTCCATGTTGTGGCATTACATTAGATAATGTTGTTGTAATTAGGTACAAAGGAATAGAGGTGGAAGCTTCATTTGAGTCTATTATATCTTAGTATAAAATCTACC。

[0017] Preferably, the PCR reaction system includes: 13 μL Taq Master buffer, 1 μL DNA template, 1.5 μL Indel-Outside-F, 0.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O is made up to 25 μL; the PCR amplification program includes: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 50-56°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.

[0018] Preferably, the annealing temperature in the PCR amplification program is 54.8°C.

[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) The molecular markers provided by the present invention can quickly and efficiently identify the sugar content of tomato fruits, and can be well applied to the screening of tomato germplasm resources for high and low sugar content in fruits.

[0020] (2) The ARMS-PCR identification process is simple and only requires the use of common Taq enzymes without the need for restriction endonucleases. Therefore, the cost is low and the results can be obtained in 2-3 hours. In addition, by exploring the annealing temperature and primer concentration ratio during amplification, the most suitable annealing temperature was found to be 54.8°C and the best primer concentration ratio was Indel-Outside-F: Indel-Outside-R: Indel-Inside-F: Indel-Inside-R was 3:1:1:3. At this time, the detection bands were clearer and the results were more accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The result diagram of genome-wide association analysis of SV and gene expression provided in Example 1 of the present invention; Figure 2 Allele frequency diagram of SVs selected in SP (P), SLC (C), heirloom (H) and modern (M) populations provided in Examples 1 and 4 of the present invention; Figure 3 This is a correlation analysis diagram between SV genotype and gene expression level provided in Example 1 of the present invention; Figure 4 This is a correlation analysis diagram between SV genotype and metabolite content provided in Examples 1 and 2 of the present invention; Figure 5 This is a comparison chart of sequencing results at this site of three TS materials with extremely high tomato fruit sugar content and three TS materials with extremely low tomato fruit sugar content provided in Example 2 of the present invention; Figure 6 The electrophoresis diagrams of TS-175 and TS-16 provided in Example 3 of the present invention at different annealing temperatures and different primer concentration ratios; Figure 7 This is the electrophoresis diagram of 70 TS materials provided in Example 3 of the present invention when the annealing temperature is 54.8° C. and the primer concentration ratio Indel-Outside-F: Indel-Outside-R: Indel-Inside-F: Indel-Inside-R is 3:1:1:3; Figure 8 The electrophoretic diagrams of commercial varieties and breeding materials provided in Example 4 of the present invention and the verification of TS-16 and TS-175; Fig. 9 This is a graph of sugar content in tomato fruits of 8 commercial varieties and breeding materials provided in Example 4 of the present invention; Fig.10 This is a graph of sugar content in tomato fruits of another 8 commercial varieties and breeding materials provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0023] Sources and physical and chemical parameters of key test materials: BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Lola, Pinfan 5444, Pink Beibei, White Arrow, Tao Mengqian, Pinfan 5755, Pinfan 4945, Provence, Jingfan 309, Millennium, Pink Dan, Crisp Millennium, Hongyan, Kumquat, Zixia Fairy, Golden Beans, Red Agate, Beiweimei, Zibei, Busan 88, Wonderful, Yellow Agate, are all collected by domestic research institutes.

[0024] Example 1 A total of 17 structural genes and regulatory genes related to tomato sugar metabolism and transport were screened by consulting literature, and the results of eGWAS using 71,684 structural variants (SVs) combined with 305 tomato material fruit transcriptome data in Wang Xin's paper (Genome of Solanum pimpinellifolium provides insights into structural variants during tomato breeding) were referred to. Figure 1As shown. It was found that 5 genes among the 17 sugar-related genes were associated with significant sites, of which 4 genes were associated with 4 cis sites. The genotype analysis of the SVs in the associated cis sites was performed, and the correlation analysis between gene expression and metabolite content (Ye Jie, Transcriptome Profiling of Tomato Fruit Development Reveals Transcription Factors Associated with Ascorbic Acid, Carotenoid and Flavonoid Biosynthesis) was performed, as shown in Figure 2 , 3 , 4. It was found that the -10 ) can well distinguish the expression of SWEET 1a (Solyc04g064610) and the sugar content of fruit in natural populations, so the sugar-significantly related variant site SV35822 was used to develop molecular markers. The relevant software used included GEMMA, GraphPad Prism, and Excel2023.

[0025] Example 2 Detection of molecular markers associated with sugar content in tomato fruits S1. Among the 70 natural population materials with both genotype and phenotype determined, 53 materials showed a 16 bp insertion at position 55102868 of chromosome 4 of tomato, and 17 materials did not show a 16 bp insertion at this position, with a P value of 1.164×10 -10 , and the sugar content of tomato fruit with 16bp insertion was significantly lower than that without 16bp insertion ( Figure 4 ). From these natural population materials, materials with high sugar content: TS-16, TS-83, TS-254; and materials with low sugar content: TS-175, TS-100, TS-194. It should be noted that the inserted 16 bp nucleotide sequence is: CATTAATACAGACT.

[0026] S2. PCR amplification and sequencing were performed using InDel detection primers F: GAGGGTTATTAGGTGATAGATTGT, R: CACTTTCAATGCCCAGGAT. The sequencing results were compared. The PCR reaction system: 13 μL Taq Master buffer, 1 μL DNA template, 1 μL each of forward primer and reverse primer, H2O was added to 25 μL; the PCR amplification program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, and finally 72℃ extension for 5 min.

[0027] The results showed that: there was no 16 bp nucleotide sequence insertion in the three selected TS materials with high sugar content in tomato fruit, while there was a 16 bp nucleotide sequence insertion in the three selected TS materials with low sugar content in tomato fruit (such as Figure 5 Therefore, this SV can be selected to develop molecular markers related to the sugar content of tomato fruit.

[0028] Example 3 Identification of tomato sugar content using molecular markers related to tomato fruit sugar content (1) Primer design process According to the ARMS-PCR principle and primer design principle, Primer 5.0 was used to design primers, which included specific inner primers and shared outer primers. The specific inner primers ensured that their specific sites were at the 3' end of the primers and were synthesized by Qingke Biotechnology Co., Ltd. The specific primer sequences are as follows: Indel-Outside-F:ATTTGTTACGATTTATTGATTCTTA; Indel-Outside-R:GAGTGGCGAGTGAAACAAG; Indel-Inside-F:ATCTCATTAAATACAGATCTTAGTATAAA; Indel-Inside-R:GGTAGATTTTATACTAAGATATAATAGACTC.

[0029] (2) Extraction of total DNA from samples Take the sample and add 750μL CTAB solution, grind at 60Hz for 90s; after grinding, place in a water bath at 65℃ for 1-2h; add 750μL chloroform-isoamyl alcohol solution, where the volume ratio of chloroform to isoamyl alcohol is 24:1, turn upside down 100 times and centrifuge at 10000rpm for 10min; take the supernatant solution and add it to a 1.5mL centrifuge tube and add 400μL isopropanol solution and gently turn it upside down 20 times; freeze in a -20℃ refrigerator for 10min; after freezing, centrifuge at 10000rpm for 5min and discard the supernatant solution; wash the precipitate with 75% alcohol and discard the alcohol, and place it in a fume hood to allow the alcohol to evaporate completely; add 50μL ddH2O to dissolve the DNA and store it in a -20℃ refrigerator for later use.

[0030] (3) PCR amplification In order to further explore the effects of annealing temperature and primer concentration on the results during PCR, the following experiments were conducted using TS-175 and TS-16 in Example 2 as sample DNA templates: The PCR reaction system is as follows: When the primer ratio was 1:1:1:1, the PCR reaction system included 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and H2O was added to make up to 25 μL.

[0031] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for 56-50°C temperature gradient amplification, 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 60-50°C annealing for 30 s, 72°C extension for 1 min, 34 cycles, and finally 72°C extension for 5 min.

[0032] When the primer ratio was 1:1:1:1, the PCR reaction system included 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and H2O was added to make up to 25 μL.

[0033] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for amplification, pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 53.7°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.

[0034] When the primer ratio was 3:1:1:3, the PCR reaction system included 13 μL Taq Master buffer, 1 μL DNA template, 0.5 μL Indel-Outside-F, 1.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O was added to 25 μL.

[0035] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for amplification, pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 52.3°C / 54.8°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.

[0036] Agarose gel electrophoresis: Take 5 μL of PCR product and add it to 2% agarose gel for electrophoresis at 150V for 2 min. Observe the results on the gel imaging system ( Figure 6 ).

[0037] Depend on Figure 6 The results showed that when a 579bp and a 390bp band appeared, it indicated that the genotype was LS type and the phenotype was low sugar content type in the fruit; when a 563bp and a 209bp band appeared, it indicated that the genotype was HS type and the phenotype was high sugar content type in the fruit; when bands of 579bp, 390bp, 563bp and 209bp appeared, it indicated that the genotype was heterozygous, but since the size of the 579bp and 563bp bands was very different, the appearance of three bands in the gel imaging system indicated a heterozygous type.

[0038] When the primer ratio was 1:1:1:1 and the annealing temperatures were 56°C, 55°C, 54.8°C, 53.7°C, and 52.3°C, the TS-175 amplified band sizes were 579bp and 390bp, and the TS-16 amplified band sizes were 563bp and 209bp. The brightness of the 579bp band was not as high as that of the 563bp band, but it was still possible to distinguish the genotypes.

[0039] When the primer concentration ratio was 1:1:1:1 and the annealing temperature was 53.7°C, TS-175 amplified 579bp, but TS-16 did not amplify 563bp, indicating that the specificity of the primers at this primer ratio and annealing temperature was unstable.

[0040] When the primer ratio was 3:1:1:3 and the annealing temperature was 52.3℃ and 54.8℃, the amplified band sizes of TS-175 were 579bp and 390bp, and the amplified band sizes of TS-16 were 563bp and 209bp, but primer dimers appeared under the condition of 52.3℃. Therefore, under this primer ratio, at 54.8℃, the primer specificity was strong.

[0041] Verification of annealing temperature and primer ratio on marker detection effect To further verify the detection effect when the annealing temperature was 54.8°C and the primer concentration ratio was 3:1:1:3, 70 TS materials in Example 2 were used for ARMS-PCR amplification. The results are shown in Table 2. Figure 7 .

[0042] Depend on Figure 7 The results show that there are 70 DNA samples, 66 of which have ARMS-PCR amplification band sizes that match the known genotypes from resequencing, and 4 of which have ARMS-PCR amplification band sizes that do not match the genotypes. Among the 4 DNA samples that do not match: TS-138, TS-140, and TS-158 resequencing genotypes are HS, the molecular marker genotyping results are LS, and the sequencing results are LS, with sugar contents of 4.10, 4.10, and 6.20, respectively. TS-90 resequencing results are LS, the molecular marker genotyping results are HS, and the sequencing results are HS, with a sugar content of 4.6. The molecular marker genotypes of the 4 DNA samples are consistent with the sequencing results, indicating that the marker has a high accuracy. Tomato sugar content is a comprehensive result of quantitative traits controlled by multiple genes, and there are also a few cases in natural populations where the phenotype and genotype do not match. The band size amplified by ARMS-PCR using this primer was consistent with the phenotype of the natural population at a rate of 97.05% (the number of DNA samples consistent with the phenotype was 68, and the total number of samples was 70). This molecular marker is feasible for detecting the sugar content of tomato fruit.

[0043] Example 4 Application This example uses commercial varieties and breeding varieties for relevant verification, and the specific steps are as follows: 28 commercial varieties and breeding materials (BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Rolla, Pinfan 5444, Fenbeibei, Baijian, Taomengqian, Pinfan 5755, Pinfan 4945, Provence, Jingfan 309, Qianxi, Fendan, Cui Qianxi, Hongyan, Jinju, Zixiaxianzi, Jindoudou, Hongmanayu, Beiweimei, Zibei, Busan 88, Jingcai, Huangmanayu) were selected and ARMS-PCR detection was performed as described in Example 3 using the molecular markers provided in Example 2. The detection results of 28 commercial varieties and breeding materials are shown in FIG. Figure 8 .

[0044] Depend on Figure 2 , Figure 8 , Fig. 9 , Fig.10 The results show that due to natural selection and artificial domestication, more than 65% of the genotypes of modern large-fruited tomatoes, commercial varieties and breeding varieties are LS types ( Figure 2 ), which has a relatively low sugar content. However, there are germplasm resources with high sugar content in natural populations. Therefore, this molecular marker can be used to screen germplasm with high sugar content in fruits in natural populations, broaden the range of parent selection, and provide a way to breed high-sugar tomato fruit varieties.

[0045] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0046] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker related to sugar content in tomato fruit, characterized in that: The nucleotide sequence of the molecular marker is shown as SEQ ID No.

1.

2. The molecular marker according to claim 1, characterized in that The molecular marker is located at position 55102868 of chromosome 4 of tomato.

3. The molecular marker according to claim 1, characterized in that The molecular marker is 16 bp.

4. Use of the molecular marker according to any one of claims 1 to 3 in detecting the sugar content of tomato fruit.

5. A primer pair for amplifying a molecular marker related to sugar content in tomato fruit according to any one of claims 1 to 3.

6. The primer pair according to claim 5, characterized in that: The nucleotide sequence of the forward primer of the primer set is shown in SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID No.

3.

7. The primer pair according to claim 5, characterized in that: The primer set includes an inner primer set and an outer primer set, wherein the nucleotide sequence of the forward primer Indel-Inside-F of the inner primer set is shown as SEQ ID No.4; the nucleotide sequence of the reverse primer Indel-Inside-R is shown as SEQ ID No.5; the nucleotide sequence of the forward primer Indel-Outside-F of the outer primer set is shown as SEQ ID No.6, and the nucleotide sequence of the reverse primer Indel-Outside-R is shown as SEQ ID No.

7.

8. The method for detecting molecular markers related to sugar content in tomato fruit according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1. Using the total DNA of the tomato to be tested as a template, PCR amplification is performed using the primer pair described in claim 7, and then electrophoresis is performed for identification; S2. When the two bands of 579bp and 390bp appear in the electrophoresis results at the same time, the tomato fruit has a low sugar content. When the two bands of 563bp and 209bp appear at the same time, the tomato fruit has a high sugar content.

9. The detection method according to claim 8, characterized in that: The PCR reaction system included: 13 μL Taq Masterbuffer, 1 μL DNA template, 1.5 μL Indel-Outside-F, 0.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O was added to 25 μL; the PCR amplification program included: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 50-56°C for 30 s, extension at 72°C for 1 min, 34 cycles, and final extension at 72°C for 5 min.

10. The detection method according to claim 9, characterized in that: The annealing temperature in the PCR amplification program is 54.8°C.

Images