Kit and method for dual detection of Verticillium dahliae and Fusarium oxysporum

Abstract

The present invention belongs to the field of biological detection, and specifically relates to a kit and method for dual detection of Verticillium dahliae and Fusarium oxysporum. The present invention has discovered the best primer pair for Verticillium dahliae and Fusarium oxysporum, and established RPA single and double detection methods based on the primer pair, and is suitable for RPA-LFD detection. Compared with the commonly used technology for detecting Verticillium wilt at present, the present invention can detect Verticillium dahliae and Fusarium oxysporum in cotton-related samples more sensitively, quickly and conveniently while ensuring high specificity and low detection limit, and is conducive to getting rid of dependence on professional technicians and laboratory precision instruments, which is of great significance for the rapid and accurate identification, monitoring and early prevention and control of Verticillium wilt and Fusarium wilt in cotton.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and in particular relates to a kit and a method for dual detection of Verticillium dahliae and Fusarium oxysporum. Background Art

[0002] Cotton (Gossypium spp.) is one of the world's major cash crops, and its fiber is an important textile raw material. However, cotton production is affected by a variety of diseases. Cotton Verticillium wilt and cotton Fusarium wilt are important quarantine soil-borne fungal diseases on cotton. The pathogen mainly infects cotton plants through the vascular bundle, and can also spread through infected seeds, diseased plant residues and infected soil. With the reproduction and transportation of cotton seeds, it spreads in various cotton-producing areas. In particular, there is currently no efficient and feasible way to prevent and control cotton Verticillium wilt, so the disease is called the "cancer" of cotton. Early detection and early prevention can weaken the spread and infection of cotton Verticillium wilt and Fusarium wilt in the field, thereby ensuring high and stable yields of cotton, which is of great significance to the development of the cotton industry.

[0003] At present, there are many methods for detecting plant pathogenic fungi. The main detection methods for this pathogenic fungus include isolation and culture, serological technology, polymerase chain reaction (PCR), real-time fluorescence quantitative PCR, nested PCR, microfluidic chip PCR technology, loop mediated isothermalamplification (LAMP), etc. Although the above technologies can detect Verticillium dahliae and Fusarium oxysporum, they have high requirements for precision temperature control equipment and operator skills, are highly dependent on laboratory precision instruments and professional technicians, and are time-consuming. In particular, serological detection methods require the preparation of antibodies against specific recognition sites of fungi, which are prone to cross-reactions when the pathogen content is low and there are other substances that interfere with the sample. Therefore, in actual production, it is urgent to establish a convenient, rapid, sensitive, and professional-free detection method for cotton Verticillium dahliae. Verticillium dahliae Fusarium wilt Fusarium oxysporum Rapid testing.

[0004] As a new isothermal nucleic acid amplification technology, recombinase polymerase amplification (RPA) is characterized by high sensitivity, high specificity and rapid response. RPA amplification can be combined with agarose gel electrophoresis, lateral flow chromatography test strips, CRISPR / Cas system, fluorescent dyes, microfluidic chips, electrochemical sensors, enzyme-linked immunosorbent assay and other methods for the detection of animal and plant pathogens. At present, real-time fluorescence RPA and test strip RPA have shown important application value in the detection of animal and plant pathogens, such as the rapid detection of quarantine diseases such as rice bacterial leaf streak fungus, rice white leaf blight fungus, corn bacterial wilt fungus, and amylovora amylovora. Summary of the invention

[0005] The first object of the present invention is to provide a kit containing a method for detecting Verticillium dahliae ( Verticillium dahliae , VD) and for the detection of Fusarium oxysporum ( Fusarium oxysporum , Fo) in at least one detection system in the second detection system; the first detection system and the second detection system respectively include an upstream primer and a downstream primer; in the first detection system, the upstream primer is XY-VDS-01F and the downstream primer is XY-VDS-01R; the nucleotide sequence of XY-VDS-01F is as follows: 5'- CGCAAAACCGATCCGTGTTCGTGAAGAGACTCG -3' (SEQ ID No .1); the nucleotide sequence of XY-VDS-01R is as follows: 5'- ATAGAGGGGTGGGCAAACAGAACCTCACAGTA -3' (SEQ ID No .2); in the second detection system, the upstream primer is UFI-6F346, and the downstream primer is selected from any one of UFI-6R484 and UFI-6R580; the nucleotide sequence of UFI-6F346 is as follows: 5'- TTGAGCGACGGGAGCGTTTGCCCTCTTACCA -3' (SEQ ID No .3); the nucleotide sequence of UFI-6R484 is as follows: 5'-GAACCCAGGCGTACTTGAAGGAACCCTTACC -3' (SEQ ID No .4); the nucleotide sequence of UFI-6R580 is as follows: 5'-TACCAATGACGGTGACATAGTAGCGAGGAGT -3' (SEQ ID No .5).

[0006] The second object of the present invention is to provide a method for detecting Verticillium dahliae ( Verticillium dahliae ) and / or Fusarium oxysporum ( Fusarium oxysporum) method, which comprises: using the kit to perform RPA reaction on the nucleic acid of the sample to be tested, and analyzing the reaction results.

[0007] The present invention has discovered the best primer pair for Verticillium dahliae and Fusarium oxysporum, and based on the primer pair, established RPA single and double detection methods, which are suitable for RPA-LFD detection. Compared with the commonly used nested polymerase chain reaction, loop-mediated isothermal technology and DAS-ELISA (Double antibody sand-wich-Enzyme-linkeimmuno sorbent assay) technology for detecting Fusarium wilt, the present invention can detect Verticillium dahliae and Fusarium oxysporum in cotton-related samples more sensitively, quickly and conveniently while ensuring high specificity and low detection limit, and is conducive to getting rid of the dependence on professional technicians and laboratory precision instruments, which is of great significance for the rapid and accurate identification, monitoring and early prevention and control of cotton Verticillium wilt and Fusarium wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0009] Figure 1 This is the optimization result of the reaction system for detecting Verticillium dahliae by single-plex RPA-LFD in the embodiment of the present invention. In the figure, a~c are the optimization of temperature, time, probe and primer concentration respectively; C: quality control line; T: detection line. In a, the temperatures of 1~5 are 35°C, 37°C, 39°C, 41°C, and 43°C, respectively. In b, the times of 1~5 are 6min, 8min, 10min, 12min, and 14min, respectively. In c, the concentration combinations of probes and primers of 1~4 are: probe 10μmol / L + primer 10μmol / L, probe 10μmol / L + primer 5μmol / L, probe 5μmol / L + primer 5μmol / L, probe 5μmol / L + primer 1μmol / L, probe 1μmol / L + primer 1μmol / L.

[0010] Figure 2This is the optimization result of the reaction system for detecting Fusarium oxysporum by single-plex RPA-LFD in the embodiment of the present invention. In the figure, a~c: optimization of temperature, time, probe and primer concentrations, respectively; C: quality control line; T: detection line. In a, the temperatures of 1~5 are 35°C, 37°C, 39°C, 41°C, and 43°C, respectively. In b, the times of 1~5 are 6min, 8min, 10min, 12min, and 14min, respectively. In c, the concentration combinations of probes and primers in 1~4 are: probe 10μmol / L + primer 10μmol / L, probe 10μmol / L + primer 5μmol / L, probe 5μmol / L + primer 5μmol / L, probe 5μmol / L + primer 1μmol / L, probe 1μmol / L + primer 1μmol / L.

[0011] Figure 3 It is the result of the single RPA-LFD specific detection experiment in the embodiment of the present invention. In the figure, a: single RPA specificity experiment of Verticillium dahliae; b: single RPA specificity experiment of Fusarium oxysporum. In a~b, 1~9 are respectively Verticillium dahliae 991, Verticillium dahliae 080, Fusarium oxysporum wilt specialized type Fov01, Fusarium oxysporum Fo03, Ascomycetes, Fusarium equisetum, Pink Trichothecene, Fusarium proliferum ET1, Fusarium nematophilum; 10: negative control; C: quality control line; T: detection line.

[0012] Figure 4 The results of the single-plex RPA-LFD sensitivity test in the embodiment of the present invention. In the figure, a: single-plex RPA detection of Verticillium dahliae DNA sensitivity experiment; in a, 1-7: correspond to 85 ng / μL, 8.5 ng / μL, 0.85 ng / μL, 0.085ng / μL, 8.5×10 -3 ng / μL、8.5×10 -4 ng / μL、8.5×10 -5 ng / μL of Verticillium dahliae genomic DNA; 8: negative control. b: Singleplex RPA detection of Fusarium oxysporum DNA sensitivity experiment; in b, 1-9: correspond to 70 ng / μL, 7 ng / μL, 0.7 ng / μL, 0.07 ng / μL, 7×10 -3 ng / μL、7×10 -4 ng / μL、7×10 -5 ng / μL、7×10 -6 ng / μL、7×10 -7 ng / μL of Fusarium oxysporum genomic DNA; CK: negative control; C: quality control line; T: test line.

[0013] Figure 5It is the specific detection result of the dual RPA-LFD in the embodiment of the present invention. In this figure, C line: quality control line; T1 line: detection line for identifying Verticillium dahliae; T2 line: detection line for identifying Fusarium oxysporum; 1-8: corresponding to Verticillium dahliae, Fusarium oxysporum, Verticillium dahliae, Ascomycetes, Fusarium equisetifolia, Trichothecene pink, Fusarium proliferatum ET1, Fusarium nematophila; CK: negative control.

[0014] Figure 6 : The sensitivity test result of the dual RPA-LFD in the embodiment of the present invention. In the figure, line C: quality control line; line T1: detection line for identifying Verticillium dahliae; line T2: detection line for identifying Fusarium oxysporum; lines 1 to 6 are the test results of mixed samples of Verticillium dahliae and Fusarium oxysporum, and correspond to concentrations of 85 ng / μL, 8.5 ng / μL, 0.85 ng / μL, 0.085 ng / μL, 8.5×10 -3 ng / μL、8.5×10 -4 ng / μL of Verticillium dahliae and 70 ng / μL, 7 ng / μL, 0.7ng / μL, 0.07 ng / μL, 7×10 -3 ng / μL、7×10 -4 ng / μL of Fusarium oxysporum; CK: negative control.

[0015] Figure 7 The results of the detection of actual samples by ordinary PCR and RPA-LFD in the embodiments of the present invention. In the figure, a and b correspond to the detection results of ordinary PCR and single-plex RPA on Verticillium dahliae in actual samples; c and d correspond to the detection results of ordinary PCR and single-plex RPA on Fusarium oxysporum in actual samples; e: the actual sample is detected by double RPA test strips. In a~d, 1~12: correspond to different actual samples in turn; +: positive control; -: negative control; C: quality control line; T: test line. In e, C line: quality control line; T1 line: test line for identifying Verticillium dahliae; T2 line: test line for identifying Fusarium oxysporum; 1~12: correspond to different actual samples in turn; CK: negative control. DETAILED DESCRIPTION

[0016] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Those skilled in the art may make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described or illustrated as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0017] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0018] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0019] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0020] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0021] The present invention relates to concentration values, and the meaning includes fluctuations within a certain range. For example, it can fluctuate within a corresponding precision range. For example, 2%, it is allowed to fluctuate within ±0.1%. For values ​​that are large or do not require too fine control, it is also allowed to have a greater fluctuation. For example, 100mM, it is allowed to fluctuate within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, it is allowed to have a fluctuation of ±10%.

[0022] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0023] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0024] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0025] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0026] In the present invention, Verticillium dahliae ( Verticillium dahliae Verticillium dahliae (VD for short) refers to an important plant pathogenic fungus, which belongs to the class Deuteromycota and the genus Verticillium. Verticillium dahliae can infect a variety of plants, including economic crops such as cotton, tomato, potato, tobacco, grape, strawberry, etc. Verticillium dahliae can invade the plant body through stomata or wounds and enter the vascular tissue. The mycelium grows in the trachea and produces a variety of toxins, such as polyketide compounds (PKS) and non-ribosomal polypeptide compounds (NRPS). These toxins can destroy plant cell walls and cell membranes, causing infected plants to have symptoms such as leaf wilting, yellowing, and wilt, and the vascular bundles of the stems and petioles to discolor brown or black. In severe cases, it can cause plant death.

[0027] In the present invention, Fusarium oxysporum ( Fusarium oxysporum, referred to as Fo) refers to an important plant pathogenic fungus, which belongs to the genus Fusarium. Fusarium oxysporum can cause diseases of many crops, including cotton, banana, watermelon, tomato, cucumber, pepper, beet, etc., and is a major threat in agricultural production. Fusarium oxysporum mainly invades the plant root system through root wounds or directly into the vascular tissue. The mycelium grows in the vascular tissue and produces a variety of toxins, such as fusaric acid and deoxynivalenol (DON). These toxins can destroy plant cell walls and cell membranes, causing plants to wilt and die. At the same time, Fusarium oxysporum can secrete auxins (such as indoleacetic acid, IAA), which interferes with the balance of endogenous auxins in plants and causes abnormal plant growth. Plants infected with Fusarium oxysporum will show symptoms such as leaf wilting, yellowing, and wilt, and the vascular bundles of the stems and petioles of infected plants will show brown or black discoloration. In the present invention, the Fusarium oxysporum includes specialized types that are pathogenic to various plants, and is not limited to one or some special subtypes. In some specific embodiments, the Fusarium oxysporum includes but is not limited to specialized types such as Fusarium oxysporum f.sp. Vasinfectum (such as Fusarium oxysporum f. sp. vasinfectum (Fov) Atk. Sny & Hans, usually referred to as Fov01), Fusarium oxysporum f. sp. Tracheiphilum, etc., which are two important specialized types of Fusarium oxysporum, which can cause wilt of cotton and woody plants (especially coconut trees), respectively.

[0028] The present invention first provides a kit, which contains a kit for detecting Verticillium dahliae ( Verticillium dahliae , VD) and for the detection of Fusarium oxysporum ( Fusarium oxysporum, Fo) in at least one detection system of the second detection system; the first detection system and the second detection system respectively include an upstream primer and a downstream primer; in the first detection system, the upstream primer is XY-VDS-01F and the downstream primer is XY-VDS-01R; the nucleotide sequence of XY-VDS-01F is as follows: 5'-CGCAAAACCGATCCGTGTTCGTGAAGAGACTCG -3' (SEQ ID No .1); the nucleotide sequence of XY-VDS-01R is as follows: 5'-ATAGAGGGGTGGGCAAACAGAACCTCACAGTA -3' (SEQ ID No .2); in the second detection system, the upstream primer is UFI-6F346 and the downstream primer is selected from any one of UFI-6R484 and UFI-6R580; the nucleotide sequence of UFI-6F346 is as follows: 5'-TTGAGCGACGGGAGCGTTTGCCCTCTTACCA -3' (SEQ ID No .3); the nucleotide sequence of UFI-6R484 is as follows: 5'-GAACCCAGGCGTACTTGAAGGAACCCTTACC -3' (SEQ ID No .4); the nucleotide sequence of UFI-6R580 is as follows: 5'-TACCAATGACGGTGACATAGTAGCGAGGAGT -3' (SEQ ID No .5).

[0029] The present invention finds that the primer pair can achieve better detection effect in single and multiplex detection of Verticillium dahliae and Fusarium oxysporum, and has higher specificity and lower detection limit.

[0030] In some embodiments, in the second detection system, the upstream primer is UFI-6F346 and the downstream primer is UFI-6R580. Such a primer combination has a better detection sensitivity.

[0031] In some embodiments, the first detection system and the second detection system respectively include probes; in the first detection system, the probe is VD-P, and the nucleotide sequence of VD-P is as follows: 5'-GGTCCAGTGAATGATGTTGCCACGCAATT[THF]CTTGAGTATAGGGCCCTG -3' (SEQ ID No. 6); in the second detection system, the probe is Fo-P, and the nucleotide sequence of Fo-P is as follows: 5'-AGGAAGCCGCTGAGCTCGGTAAGGGTTCC[THF]TCAAGTACGCCTGGGT -3' (SEQ ID No. 7); the 5' end of the probe is modified with a fluorescent labeling group or digoxigenin (Digoxigenin, abbreviated as DIG or Dig), and the 3' end is modified with an alkyl carbon spacer.

[0032] In some embodiments, the 5' end of the downstream primer is modified with a fluorescent labeling group or a biotin affinity group.

[0033] In some embodiments, the fluorescent labeling group is selected from any one of FAM (Fluorescein amidite), FITC (fluorescein isothiocyanate), TAMRA (tetramethylrhodamine), fluorescein, rhodamine, AlexaFluor series dyes (such as Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 594, Alexa Fluor647, Alexa Fluor 750, etc.), GFP (green fluorescent protein), HEX (hexamethylrhodamine), TET (tetraethylrhodamine), Cyanine dye, ROX (red fluorescein), and Texas Red.

[0034] In some specific embodiments, different chemiluminescent groups are modified at the 5' ends of the VD-P and Fo-P, which is helpful to distinguish the detection results of different target bacteria in double detection.

[0035] In some embodiments, the alkyl carbon spacer is selected from one of C2 Spacer, C3 Spacer, and C4 Spacer.

[0036] In specific implementation, those skilled in the art can select a specific biotin affinity group in combination with common sense. In some specific embodiments, the biotin affinity group is selected from one or more of Biotin, Avidin, Streptavidin, and NeutrAvidin.

[0037] In some embodiments, the kit further comprises an RPA amplification reagent and / or a nucleic acid detection test strip, wherein the RPA amplification reagent comprises: reverse transcriptase, recombinase, single-strand binding protein (SSB), strand displacement DNA polymerase, dNTPs, Mn 2+ In some specific embodiments, Mg² is provided in the form of Mg-acetate. + .

[0038] In some embodiments, the nucleic acid detection test strip is a lateral flow device (LFD). In a specific embodiment, two test strips can provide test lines for Verticillium dahliae and Fusarium oxysporum respectively, or one test strip can provide test lines for Verticillium dahliae and Fusarium oxysporum at the same time, and the latter is faster and more efficient in specific use.

[0039] In some specific embodiments, the kit further contains: a stabilizer and a preservative to ensure the stability of the kit during storage and use.

[0040] In some specific embodiments, the kit further comprises: a detergent to help reduce inhibitors in the sample and improve amplification efficiency.

[0041] In some embodiments, the kit further comprises: a positive control and / or a negative control for verifying the accuracy and specificity of the RPA reaction.

[0042] In some embodiments, the kit further comprises: extraction and dilution buffers. If the kit is designed to detect directly from complex samples, it may contain buffers for sample lysis and DNA release.

[0043] In some specific embodiments, the kit further comprises: instructions for providing detailed operating steps, reaction conditions, usage guidelines and precautions.

[0044] Other components in the kit mentioned in the present invention can be obtained through commercial channels, and can be provided in multiple or one reagent in the form of a single reagent or a combination.

[0045] Furthermore, the present invention also provides a method for detecting Verticillium dahliae ( Verticillium dahliae ) and / or Fusarium oxysporum ( Fusarium oxysporum ) method, which comprises: using the kit to perform RPA reaction on the nucleic acid of the sample to be tested, and analyzing the reaction results.

[0046] In the method, only the first detection system in the kit can be used to detect Verticillium dahliae, and only the second detection system in the kit can be used to detect Fusarium oxysporum. At the same time, the first detection system and the second detection system can also be used simultaneously to achieve simultaneous detection of Verticillium dahliae and Fusarium oxysporum.

[0047] In some specific embodiments, those skilled in the art can combine common sense to combine RPA amplification with agarose gel electrophoresis, lateral flow chromatography test strips, CRISPR / Cas systems, fluorescent dyes, microfluidic chips, electrochemical sensors, enzyme-linked immunosorbent assays and other methods to achieve the above-mentioned detection.

[0048] In some embodiments, after the nucleic acid of the sample to be tested is subjected to RPA reaction, the reaction product is detected using a nucleic acid detection test strip (lateral flow immunoassay test strip), and the detection result is analyzed.

[0049] In some embodiments, each 50 μL RPA reaction system contains the following i) and / or ii): i) 3 to 6 pmoL of VD-P, 2 to 20 pmoL of XY-VDS-01F, and 2 to 20 pmoL of XY-VDS-01R; ii) 3 to 6 pmoL of Fo-P, 2 to 20 pmoL of UFI-6F346, and 2 to 20 pmoL of any one selected from UFI-6R484 and UFI-6R580.

[0050] In some specific embodiments, each 50 μL RPA reaction system contains the following i) and / or ii): i) 6 pmoL of VD-P, 10 pmoL of XY-VDS-01F, and 10 pmoL of XY-VDS-01R; ii) 3 pmoL of Fo-P, 2 pmoL of UFI-6F346, and 2 pmoL of any one selected from UFI-6R484 and UFI-6R580.

[0051] In specific implementation, those skilled in the art can configure the primers and probes required in the RPA reaction system in combination with the detection purpose. At the same time, those skilled in the art can set other components involved in the RPA amplification reaction system and their specific amounts in combination with common sense, which can achieve better detection results in the present invention.

[0052] In some embodiments, the temperature of the RPA reaction is 37-43° C., more preferably 39±2° C. As an example, the temperature of the RPA reaction can be 37° C., 38° C., 39° C., 40° C., 41° C., 42° C., or 43° C.

[0053] In some embodiments, the RPA reaction time is 8 to 30 min. As an example, the RPA reaction time can be 8 min, 10 min, 13 min, 14 min, 15 min, 16 min, 17 min, 20 min, 25 min or 30 min.

[0054] In some specific embodiments, the method further comprises the step of extracting nucleic acid from the sample to be tested. The method of extracting nucleic acid from the sample to be tested is well known in the art and is not particularly limited here.

[0055] In some specific embodiments, the sample to be tested is derived from plants such as cotton, tomato, potato, tobacco, grape, strawberry, banana, watermelon, cucumber, pepper, beet, coconut tree, etc. that may be infected with Verticillium dahliae and / or Fusarium oxysporum, or environmental sampling related to the above plants (such as soil samples).

[0056] Those skilled in the art can combine the above-mentioned implementation modes with common sense to obtain more embodiments of the method of the present invention.

[0057] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0058] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0059] 1. Test Materials

[0060] 1.1 Test strains and cotton varieties

[0061] (1) 2 strains of Verticillium dahliae: VD991 and VD080; 2 strains of Fusarium oxysporum: Fusarium oxysporum wilt specialized types Fov01 and Fo03; 5 strains of other and common pathogens on cotton: Ascomycetes, Fusarium equisetum, Trichothecene roseum, Fusarium vegetative ET1, and Fusarium nematophila. The specific strains are shown in Table 1.

[0062] (2) The cotton seeds used were the diseased seeds of “Jimian No. 11”.

[0063] Table 1

[0064]

[0065] Note: CAAS refers to the Cotton Research Institute of the Chinese Academy of Agricultural Sciences; CAIQ refers to the Chinese Academy of Inspection and Quarantine.

[0066] 1.2 Instruments and reagents

[0067] 1.2.1 Instruments

[0068] Gradient PCR instrument was purchased from Invitrogen (Shanghai) Trading Co., Ltd.; DYY-11 agarose gel electrophoresis instrument; fully automatic UV gel imaging system was purchased from Bio-Rad, USA; Nano Drop 2000 ultra-micro volume UV spectrophotometer; Coyote mini heating and cooling metal bath Pad3-H; pipettes were purchased from Eppendorf, Germany.

[0069] 1.2.2 Reagents

[0070] 2×Taq PCR Master Mix was purchased from Beijing Bomade Gene Technology Co., Ltd.; Fungal Genomic DNA Rapid Extraction Kit was purchased from Beijing Coolaibo Technology Co., Ltd.; FastDNA SPIN kit for Soil Soil DNA Extraction Kit was purchased from Abe Medical Equipment Trading (Shanghai) Co., Ltd.; EasyPure® Plant Genomic DNA Kit, Gelred Nucleic Acid Dye (10000×), and Trans DNA Marker I were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; 50×TAE electrophoresis buffer, PDA culture medium (Potato Dextrose Agar), DNA Constant Temperature Rapid Amplification Kit (Colloidal Gold Test Strip Type), HybriDetect Test Strips, etc. were purchased from Nanjing Wobo Biotechnology Co., Ltd.; Zhongce® RAA-nfo Nucleic Acid Amplification Reagent (Test Strip Type) and Tiosbio® Double-labeled Nucleic Acid Detection Test Strip (Rainbow Type) were purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0071] Among them, the specific formula of Czapek liquid culture medium is: add 1.0 g of dipotassium hydrogen phosphate, 0.5 g of potassium chloride, 0.01 g of ferrous sulfate, 3.0 g of sodium nitrate, 0.5 g of magnesium sulfate, and 30.0 g of sucrose per liter of deionized water, and finally adjust the pH to 7.3. The culture conditions when using this liquid culture medium are 26°C and 200 r / min.

[0072] The DNA Constant Temperature Rapid Amplification Kit (Colloidal Gold Test Strip Type) contains buffer A and buffer B involved in the subsequent RPA reaction system.

[0073] Test methods

[0074] 1.3.1 Genomic DNA extraction

[0075] 1.3.1.1 DNA extraction of strains

[0076] Take the hyphae and spores on the PDA medium and Czapek liquid medium, collect the fungi and centrifuge to obtain the precipitate, extract DNA according to the fungal genomic DNA extraction kit, measure the DNA concentration with a micro-nucleic acid protein analyzer, and freeze it at -20℃ for use.

[0077] 1.3.1.2 Soil DNA extraction

[0078] A piece of bacterial cake grown on PDA medium was inoculated into Czapek liquid medium and cultured at 26°C and 200 rpm / min for 7 days. The bacterial solution was filtered through high-temperature sterilized gauze to obtain a spore suspension. The supernatant was centrifuged and the number of pathogenic spores was counted using a hemocytometer. The spores were diluted with sterile water to a concentration of 1×10 7 1 mL of the spore suspension at this concentration was taken and added to a culture dish containing 1.0 g of sterilized soil and mixed thoroughly to make the spore content in the soil sample 5×10 6 conidia / mL, dried at 37℃, transferred to a mortar, and ground into fine powder by adding liquid nitrogen to make artificial diseased soil. At the same time, field soil samples were also collected for sample testing. Soil DNA was extracted using the FastDNA SPIN kit for Soil soil DNA extraction kit.

[0079] 1.3.1.3 DNA extraction from plant samples

[0080] The pathogen inoculated samples and actual field samples were processed, and the total DNA of the plant samples was extracted using the EasyPure® Plant GenomicDNA Kit. The DNA concentration was tested using a micro-nucleic acid protein analyzer and stored at -20°C for future use.

[0081] 1.3.2 Pathogen inoculation

[0082] Before planting cotton, the planting pots and nutrient soil were sterilized under high pressure. Then the susceptible cotton variety "Jimian No. 11" was planted in an environment of 28℃, 16 h light / 8 h dark for about 2 weeks. When the cotton grew the first true leaf, it was inoculated with the Verticillium dahliae isolate VD991 and the wilt-specific type of Fusarium oxysporum Fov01, respectively.

[0083] To obtain pathogens with strong infection activity, first, they were activated by growth on PDA medium, and the mycelium with strong activity was selected from the surrounding growth area and transferred to Czapek liquid medium for expansion culture at 26°C and 200 rpm / min. After 7 days of growth, conidia were harvested from the culture, concentrated by centrifugation, and washed with sterile water. The final concentration was adjusted to 5×10 6 conidia / mL inoculant suspension was used to inoculate cotton seedlings. The roots of the seedlings were slightly damaged and then immersed in the conidia suspension. The seedlings were observed 1 day, 7 days, and 14 days after inoculation. The seedlings that were not inoculated with the pathogen in the suspension were used as controls.

[0084] 1.3.3 Primer and probe design

[0085] Through literature retrieval and primer design using the software Primer premier 5.0, three groups of primers with good amplification effects (X1-X3) were retrieved for Verticillium dahliae. Among them, X1 was derived from "Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi" published by Schoch CL et al. in 2012, X2 was derived from "Research on Rapid Molecular Detection Technology of Cotton Verticillium dahliae" published by Pang Li in 2015, and X3 was derived from "Rapid and visual detection of Verticillium dahliae using recombinase polymerase amplification combined with lateral flow dipstick" published by JU Yuliang et al. in 2020. At the same time, based on the conserved gene Ent-kaurene oxidase (Genbank No. XM_009658236.1), four sets of primer pairs with target fragments between 130 and 280 bp (X4-X7) were designed for subsequent specific primer screening experiments. For Fusarium oxysporum, the sequences were aligned with NCBI and translation elongation factor (GenBank: UDN44712.1) and beta-tubulin (GenBank: QNN89079.1) were selected for primer design for subsequent specific primer screening experiments.

[0086] According to the colloidal gold RPA primer and probe design rules, the position of the combined bases, etc., the corresponding single colloidal gold RPA probes VDJ-01P and FoJ-2-P, and double colloidal gold RPA probes 3VJ-01P and 3FJ-01P were designed. The specific sequences are shown in Table 2. The primers and probes involved in this experiment were synthesized by Bioengineering (Shanghai) Co., Ltd.

[0087] Table 2

[0088]

[0089]

[0090] 1.3.4 Conventional PCR and RPA amplification methods

[0091] The conventional PCR amplification system was: 2x Taq PCR Master Mix 12.5 μL, upstream / downstream primers (5 μM) 1 μL each, template 1 μL, ddH2O 9.5 μL. The reaction procedure was pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 64°C for 30 s, extension at 72°C for 30 s, 35 cycles, final extension at 72°C for 10 min, and storage at 4°C. PCR amplification products were detected by 1.5% agarose gel electrophoresis, and specific target bands were observed by UV gel imaging.

[0092] The single-plex RPA reaction system is: 29.4 µL buffer A, 2 µL DNA template, 0.6 µL probe, 2 µL each of forward and reverse primers, 11.5 µL dd H2O. After complete dissolution, add 2.5 µL buffer B (for multiple reactions, buffer B can be added to the inside of the lid of the reaction tube) and transfer to the amplification area. Invert the reaction tube 8 to 10 times to fully mix the components. After mixing, quickly centrifuge the reaction solution to the bottom of the tube and incubate it in a metal bath. After the reaction is completed, take 10 µL of the reaction product and dilute it 20 times with ddH2O, then take 50 µL of the reaction product and drop it on the paper strip sample well, observe the quality control line and the test line to read the results. When a red line appears on the quality control line of the colloidal gold test strip and no red line appears on the test line, the test result is negative; when a red line appears on the test line of the colloidal gold test strip and a red line appears on the quality control line, the test result is positive. In the optimization of the single-plex RPA reaction system conditions, the specific parameters of each influencing factor were adjusted according to the settings. In other reactions involving single-plex RPA, the optimized best parameters were used.

[0093] The 50 µL system for the dual RPA amplification reaction is: 25 µL buffer A, 0.6 µL probe for Verticillium dahliae (10 µM), 2 µL each of forward and reverse primers for Verticillium dahliae (5 µM), 0.6 µL probe for Fusarium oxysporum (5 µM), 2 µL each of forward and reverse primers for Fusarium oxysporum (1 μM), 1.5 µL each of DNA sample, 10.3 µL ddH2O. After complete dissolution, add 2.5 µL buffer B (for multiple reactions, add buffer B to the inside of the lid of the reaction tube) and transfer to the amplification area. Invert the reaction tube 8 to 10 times to mix all the components thoroughly. After mixing, quickly centrifuge the reaction solution to the bottom of the tube and incubate it in a metal bath at 39°C for 30 minutes. After the reaction is completed, take 10 µL of the reaction product and dilute it 12 times with ddH2O. Take 70 µL of the reaction product and add it to a 200-microliter thin-walled PCR tube. Then insert the test strip conjugation pad end (arrow end) into the PCR reaction tube (the liquid level must not exceed the upper end of the conjugation pad). Wait until the judgment area is completely soaked, and observe the quality control line and the detection line to read the results.

[0094] 2. Results Analysis

[0095] 2.1 Primer pair screening

[0096] From the strains preserved and isolated in the laboratory, two positive strains of Verticillium dahliae, two positive strains of Fusarium oxysporum (Fov01, Fo03) and five non-target detection strains were selected as controls (Table 1), seven primer pairs (X1-X7) for Verticillium dahliae and six primer pairs (Y 1 / 2 , Y 1 / 3 , Y 4 / 6 , Y 4 / 7 , Y 5 / 7 , Y 5 / 8 ) were screened (see Table 2). The conventional PCR amplification of primer pairs was observed by UV gel electrophoresis imaging. When amplifying Verticillium dahliae, it was found that three primer pairs X2 (VDS-F / R), X3 (VD-RPA-F / R) and X4 (XY-VDS-01F / R) had strong specificity and could be used in subsequent experiments. In order to achieve a higher amplification efficiency, by comparing these three primer pairs, it was found that the target fragment amplified by VDS-F / R was longer, and the reaction might encounter problems such as decreased amplification efficiency and low specificity, which would affect the accuracy and reliability of the amplification results and was not suitable for RPA amplification; while the target fragments amplified by VD-RPA-F / R and XY-VDS-01F / R were of moderate size, but the detection sensitivity of the VD-RPA-F / R primer pair was lower than the minimum detection concentration of XY-VDS-01F / R of 8.5pg. When amplifying Fusarium oxysporum, only Y 1 / 2 , Y1 / 3 The primer combination has good specificity, but Y 1 / 3 Y 1 / 2 The results are clearer. Therefore, XY-VDS-01F / R was used for the subsequent test of Verticillium dahliae, and UFI-6F346 / UFI-6R580 was used for the subsequent test of Fusarium oxysporum. The specific amplification results are shown in Table 3.

[0097] Table 3

[0098]

[0099] Note: +: intentional band is shown; -: no intentional band is shown.

[0100] 2.2 Optimization of single-plex RPA reaction system conditions

[0101] The factors that affect the detection sensitivity of the single-plex RPA reaction system mainly include reaction temperature, reaction time and the concentration of primers and probes in the reaction system.

[0102] This experiment optimized the different influencing factors of the Verticillium dahliae amplification system: when the reaction temperature of RPA was 39°C, the detection Verticillium dahliae The red band of the DNA sample test strip was the most obvious, and no red band appeared on the T line in the blank control. When the RPA reaction time was 6 min, a slightly red band began to appear on the test strip. As the reaction time increased, the red band of the T line deepened and reached its peak at 10 min. The amplification effect was better when the probe concentration was greater than the primer concentration. The probe concentrations were 10 μmol / L, 5 μmol / L, and the forward and reverse primers were 10 μmol / L, 5 μmol / L, and 1 μmol / L respectively. It was found that the combination of 10 μmol / L probe and 5 μmol / L primer was the best reaction probe primer concentration combination for the detection system (see Figure 1 ). In summary, the best system used in this experiment is: the reaction system is a combination of 10 μmol / L probe and 5 μmol / L forward and reverse primers, and detection is performed after reacting at 39℃ for 10 min.

[0103] This experiment optimizes the different influencing factors of the Fusarium oxysporum amplification system: when the reaction temperature of RPA is 41℃, the detection Fusarium oxysporumThe red band of the DNA sample test strip was the most obvious, and no red band appeared on the T line in the blank control. When the RPA reaction time was 6 min, a slightly red band began to appear on the test strip. As the reaction time increased, the red band of the T line deepened and reached its peak at 12 min. When the probe concentration was greater than the primer concentration, the amplification effect was better. The probe concentrations of 10 μmol / L, 5 μmol / L and the forward and reverse primers of 10 μmol / L, 5 μmol / L, and 1 μmol / L were tested respectively. It was found that the combination of 5 μmol / L probe and 1 μmol / L primer was the best reaction probe primer concentration combination for the detection system (see Figure 2 ). In summary, the best system used in this experiment is: the reaction system is a combination of 5 μmol / L probe and 1 μmol / L forward and reverse primers, and detection is performed after reacting at 41°C for 12 min.

[0104] 2.3 Single-plex RPA specificity detection

[0105] Through the single-plex RPA specificity test of Verticillium dahliae, Fusarium oxysporum, ascomycetes, Fusarium equisetum, pink trichothecene, Fusarium vegetative ET1, and Fusarium nematophila, it was found that the T line of the test strip only showed red bands when testing Verticillium dahliae, and no red bands appeared on the T line when testing the other 7 pathogens (see Figure 3 ), indicating that the detection method can specifically detect Verticillium dahliae Verticillium dahliae Fusarium oxysporum Fusarium oxysporum .

[0106] 2.4 Singleplex RPA sensitivity detection

[0107] The test strips were used to detect different concentrations of Verticillium dahliae DNA and Fusarium oxysporum DNA. The results are shown in Figure 4 According to the experimental results, when the DNA concentration is 8.5×10 -4 ng / μL, the red band of the test strip T line weakened. When the DNA concentration was 8.5×10 -5 ng / μL, no red band appeared on the T line, indicating that Verticillium dahliae could not be detected; when the DNA concentration was 7×10 -6 ng / μL, the red band of the test strip T line weakened. When the DNA concentration was 7×10 -7 ng / μL, no red band appeared on the T line, which means that Fusarium oxysporum could not be detected. Therefore, the minimum concentration of Verticillium dahliae detected by single-plex RPA was 8.5×10 -4 ng / μL, the minimum concentration for detecting Fusarium oxysporum was 7×10 -6 ng / μL.

[0108] 2.5 Specificity of dual RPA-LFD for the detection of Verticillium dahliae and Fusarium oxysporum

[0109] Specificity assessment is a key technology for the practical application of detection kits. Figure 5 As shown, the positive control containing all the detection target sequences shows three lines, namely, C line, T1 line and T2 line, indicating that Verticillium dahliae and Fusarium oxysporum are double positive, among which T1 line corresponds to the detection line for identifying Verticillium dahliae; T2 line corresponds to the detection line for identifying Fusarium oxysporum. Species without these two target sequences are consistent with the blank control without template, and only C line is displayed. If only one of the detection targets is contained in the sample, a red line will be displayed at each of the T1 / T2 lines (C line and T1 line, C line and T2 line). The results are consistent with the current standards, thus verifying the feasibility of this method.

[0110] 2.6 Sensitivity of dual RPA-LFD for the detection of Verticillium dahliae and Fusarium oxysporum

[0111] For sensitivity testing, the results are as follows Figure 6 As shown in the figure, as the concentration of genomic DNA decreases, the colors of the T1 line and the T2 line show an overall weakening trend. For high DNA concentrations (85 ng / μL~8.5 ng / μL of Verticillium dahliae and 70 ng / μL~0.7 ng / μL of Fusarium oxysporum), the test strip shows three lines, and the T1 line corresponding to Verticillium dahliae and the T2 line corresponding to Fusarium oxysporum are clearly visible. In contrast, the T2 line corresponding to low concentrations (0.085 ng / μL~8×10 -3 ng / μL of Verticillium dahliae and 0.07 ng / μL~7×10 -3 ng / μL) or the blank control (CK) without template showed only one clear band at line C. For Verticillium dahliae and Fusarium oxysporum, the visual inspection limit of this method was 0.7 ng / μL.

[0112] 2.7 Actual sample testing

[0113] The applicability of the detection system was verified by using strip-type RPA to detect the infection of Verticillium dahliae and Fusarium oxysporum in soil samples and cotton plants collected from artificial inoculation and field. The results are shown in Figure 7 The results showed that the test results of the test strip RPA were the same as those of the conventional PCR. It can be seen that the method of the present invention can completely and accurately detect bacterial samples, has good applicability, and has no cross interference.

[0114] In summary, it can be seen that the primer pairs of the present invention can achieve good detection results in both single and multiple detection of Verticillium dahliae and Fusarium oxysporum, and also have high accuracy in the detection of actual samples. The detection time is short and easy to operate, and rapid detection can be achieved in fields, ports and other places. It is expected to be widely used in plant disease management and plant health monitoring.

[0115] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A kit containing a reagent for detecting Verticillium dahliae ( Verticillium dahliae ) and the first detection system for detecting Fusarium oxysporum ( Fusarium oxysporum ) of the second detection system; The first detection system and the second detection system respectively include an upstream primer, a downstream primer and a probe; In the first detection system, the upstream primer is XY-VDS-01F, the downstream primer is XY-VDS-01R, and the probe is VD-P; The nucleotide sequence of XY-VDS-01F is shown below: 5'-CGCAAAACCGATCCGTGTTTCGTGAAGAGACTCG -3'; The nucleotide sequence of XY-VDS-01R is shown below: 5'-ATAGAGGGGTGGGCAAACAGAACCTCACAGTA -3'; The nucleotide sequence of VD-P is shown below: 5' - GGTCCAGTGAATGATGTTGCCACGCAATT[THF]CTTGAGTATAGGGCCCTG -3'; In the second detection system, the upstream primer is UFI-6F346, the downstream primer is UFI-6R580, and the probe is Fo-P; The nucleotide sequence of UFI-6F346 is shown below: 5'-TTGAGCGACGGGAGCGTTTGCCCTCTTACCA -3'; The nucleotide sequence of UFI-6R580 is shown below: 5'- TACCAATGACGGTGACATAGTAGCGAGGAGT -3'; The nucleotide sequence of Fo-P is shown below: 5' -AGGAAGCCGCTGAGCTCGGTAAGGGTTCC[THF]TCAAGTACGCCTGGGT -3'; The 5' end of the probe is modified with a fluorescent labeling group or digoxigenin, and the 3' end is modified with an alkyl carbon spacer.

2. The kit according to claim 1, wherein The 5' end of the downstream primer is modified with a fluorescent labeling group or a biotin affinity group.

3. The kit according to claim 1 or 2, wherein The fluorescent labeling group is selected from any one of FAM, FITC, TAMRA, fluorescein, rhodamine, Alexa Fluor series dyes, GFP, HEX, TET, Cyanine dye, ROX, and Texas Red; And / or, the alkyl carbon spacer is selected from one of C2 Spacer, C3 Spacer and C4 Spacer.

4. The kit according to claim 1, wherein The kit also contains an RPA amplification reagent, which includes: reverse transcriptase, recombinase, single-strand binding protein, strand displacement DNA polymerase, dNTPs, Mn 2+ At least one of .

5. The kit according to claim 4, wherein The kit also contains a nucleic acid detection test strip.

6. A method for detecting Verticillium dahliae ( Verticillium dahliae ) and Fusarium oxysporum ( Fusarium oxysporum ), comprising: Using the kit according to any one of claims 1 to 5, an RPA reaction is performed on the nucleic acid of the sample to be tested, and the reaction result is analyzed.

7. The method according to claim 6, wherein: After the RPA reaction is carried out on the nucleic acid of the sample to be tested, the reaction product is detected using a nucleic acid detection test strip, and the detection result is analyzed.

8. The method according to claim 6, wherein: Each 50 μL RPA reaction system contains the following i) and ii): i) 3~6 pmoL of VD-P, 2~20 pmoL of XY-VDS-01F, and 2~20 pmoL of XY-VDS-01R; ii) 3~6 pmoL of Fo-P, 2~20 pmoL of UFI-6F346, and 2~20 pmoL of UFI-6R580.

9. The method according to claim 6 or 8, wherein: The temperature of the RPA reaction is 37-43°C.

10. The method according to claim 9, wherein: The RPA reaction time is 8 to 30 minutes.

Images