Compositions and methods for loading extracellular vesicles

Abstract

The present invention provides extracellular vesicles (EVs) loaded with a conjugate of an active agent with a hydrophilic compound, such as a carbohydrate, methods of making and loading the EVs, compositions comprising the EVs and uses thereof, and conjugates of an active agent with a carbohydrate that can be loaded into an EV. In one embodiment, the exosome is loaded with a conjugate of siRNA and glucose.

Description

Technical Field

[0001] The present invention relates to compositions and methods for loading extracellular vesicles with active molecules coupled to hydrophilic compounds such as carbohydrates or derivatives thereof, the resulting extracellular vesicles and compositions comprising them, wherein the hydrophilic compounds themselves may have biological activity. Background Art

[0002] Exosomes are membrane-bound extracellular vesicles (EVs) produced in the endosomal compartment of most eukaryotic cells. In multicellular organisms, exosomes and other EVs are found in biological fluids including blood, urine, and cerebrospinal fluid. Importantly, exosomes have also been identified within tissue matrices, known as matrix-bound nanovesicles (MBVs). They are also released by cultured cells into their growth medium in vitro. Because their size is limited by the size of the parent MVBs, exosomes are generally considered smaller than most other EVs, with diameters of approximately 30 to 150 nanometers (nm): roughly the same size as many lipoproteins, but much smaller than cells. Because exosomes can naturally and easily enter cells and release their chemical contents into the cell, they can serve as an excellent drug delivery vehicle for drugs that need to penetrate the cell membrane and accumulate inside the cell. Exosomes have been shown to have many beneficial advantages; they can cross the BBB, have an affinity for inflamed tissues, and accumulate in inflamed areas. Exosomes could potentially be an off-the-shelf product that does not require genetic matching. Currently, there are many known methods for loading different compounds into exosomes, such as sonication, electroporation, transfection, incubation, extrusion, saponin-assisted loading, transgenic, freeze-thaw cycles, heat shock, pH gradient method and hypotonic dialysis. In some of these methods, lipophilic compounds such as cholesterol can be used. However, these methods have some disadvantages, such as aggregation, false information and damage to the integrity of the extracellular vesicle membrane. Some of the above methods may affect the ability of target cells to phagocytize exosomes, resulting in insufficient intracellular concentrations of the desired active ingredients.

[0003] WO2021 / 030777 relates to EVs (e.g., exosomes), which contain biologically active molecules covalently linked to extracellular vesicles via anchoring moieties, which can be used as agents for preventing or treating cancer or other diseases.

[0004] EP 3132044 relates to a method for loading exosomes with oligonucleotide cargo, wherein an oligonucleotide comprising one or more hydrophobic modifications is incubated with an exosome population for a period of time sufficient to allow the exosomes to be loaded with oligonucleotides using genetic engineering methods of the cells. Such genetic manipulations may alter the intrinsic biological characteristics of the cells themselves. Therefore, it is preferred to perform minimal manipulations on the cells. In addition, EP3132044 describes exosomes loaded with hydrophobic modified oligonucleotide cargos.

[0005] There remains a pressing need for additional methods to load EVs with oligonucleotides and other different types of desired active ingredients. Summary of the invention

[0006] The present invention discloses compositions and methods for loading extracellular vesicles (EVs) with bioactive molecules. To this end, the active molecule is chemically combined with a non-lipophilic compound that helps enrich the active molecule in the EV, thereby obtaining an EV with a high concentration of active molecules. Unexpectedly, it was found that carbohydrates such as glucose and sucrose can not only enter the EV, but also be incorporated into active agents coupled thereto. It was further found that by adding insulin to the culture medium during the loading process, the loading of EVs and the incorporation of active agents coupled to glucose can be promoted.

[0007] In some cases, the non-lipophilic compound used to load the active agent into the EV is itself an active agent. Therefore, the present invention also provides EVs containing such non-lipophilic active agent compounds. These non-lipophilic compounds may be exogenous compounds and / or present in EVs at concentrations not found in nature.

[0008] According to one aspect, the present invention provides an isolated extracellular vesicle comprising at least one exogenous cargo molecule or an exogenous carbohydrate as an active agent, wherein the exogenous cargo molecule comprises an active agent chemically bound to a carbohydrate or a derivative thereof. According to one embodiment, the present invention provides an isolated extracellular vesicle comprising at least one exogenous carbohydrate as an active agent. According to other embodiments, the present invention provides an isolated extracellular vesicle containing an exogenous cargo molecule comprising an active agent chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the active agent in the cargo molecule is selected from a small molecule, a protein, a peptide, a polypeptide, a lipid and a nucleic acid. According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate. According to some embodiments, the active agent carbohydrate is present at a non-natural concentration. According to some embodiments, the active agent is directly or through a linker to the carbohydrate or a derivative thereof. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the active agent is chemically bound to a carbohydrate or a derivative thereof through a cleavable linkage. According to some embodiments, the active agent is covalently bound to the carbohydrate. According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA and miRNA inhibitors. According to some embodiments, the oligonucleotide is siRNA. According to some embodiments, the present invention provides isolated EVs loaded with exogenous cargo molecules, the exogenous cargo molecules comprising siRNA molecules covalently bound to carbohydrates such as glucose through linkers such as DBCO-C6 acid. According to some embodiments, the present invention provides isolated EVs loaded with exogenous cargo molecules, the exogenous cargo molecules comprising siRNA molecules covalently bound to carbohydrates such as sucrose through linkers such as DBCO-C6 acid. According to some embodiments, the cargo molecules are present in the EV at non-natural concentrations, i.e., at concentrations that do not exist in nature.

[0009] According to another aspect, the present invention provides a method for loading isolated extracellular vesicles (EVs) with exogenous cargo molecules, the method comprising incubating a population of EVs with the cargo molecules, the cargo molecules comprising an active agent chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the active agent is bound to the carbohydrate or a derivative thereof directly or through a linker. According to some embodiments, the linker is 10-hydroxydecanoic acid. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the active agent is selected from small molecules, proteins, peptides, polypeptides, lipids and nucleic acids. According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate and / or is present in the EV at a non-natural concentration.

[0010] According to some embodiments, the method further comprises electroporation or the use of a transfection agent such as a lipofection agent. According to alternative embodiments, the method is performed in the absence of electroporation and in the absence of a transfection agent.

[0011] According to some embodiments, the method is performed in the presence of insulin. According to some embodiments, the amount of exogenous cargo molecules loaded in the obtained EV is at least 20% higher than the amount in the EV loaded in the absence of insulin.

[0012] According to any one of the above aspects and embodiments, the EV is an exosome. According to some embodiments, the EV, such as an exosome, is derived from an adherent cell expressing a mesenchymal marker. According to some embodiments, the adherent cell expressing a mesenchymal marker is a mesenchymal stem cell (MSC). According to some embodiments, the mesenchymal stem cell is a human bone marrow mesenchymal stem cell.

[0013] According to some embodiments, the present invention provides isolated EVs obtained or obtainable by the methods described herein.

[0014] According to yet another aspect, provided herein is a pharmaceutical composition comprising a population of isolated EVs of the present invention and a pharmaceutically acceptable excipient.

[0015] According to yet another aspect, provided herein is a method of delivering an active agent, the method comprising exposing a mammal, an organ, a tissue or a target cell to the isolated EV of the present invention.

[0016] According to another aspect, the present invention provides a method for treating or preventing a disease, medical condition or disorder that can be treated by an active agent loaded into an EV, the method comprising administering a therapeutically effective amount of the EV described herein to a subject in need thereof.

[0017] According to yet another aspect, the present invention provides an exogenous conjugate molecule comprising a nucleic acid chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the nucleic acid is an oligonucleotide. According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA and miRNA inhibitors. According to some embodiments, the nucleic acid is directly or through a linker to a carbohydrate or a derivative thereof. According to some embodiments, the bond or linker is a cleavable bond or linker. According to some embodiments, the present invention provides siRNA coupled to glucose. According to some embodiments, the present invention provides siRNA coupled to sucrose.

[0018] According to any one of the above aspects and embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides, and wherein the carbohydrate derivative is selected from sugars linked to amino acids, polyphenols or lipids. According to some embodiments, the monosaccharide is selected from glucose, ribose, mannose, arabinose, galactose and xylose; the disaccharide is selected from sucrose, lactose and maltose; the trisaccharide is selected from maltotriose and raffinose; the sugar linked to the amino acid is D-ribose-L-cysteine; the sugar linked to the polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercetin, baicalin and puerarin; and the sugar linked to the lipid is a cerebroside such as glucocerebroside. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The integrity of the exosomes is shown.

[0020] Figure 2 The uptake curve of sucrose absorbing exosomes is shown.

[0021] Figure 3 Shown is HPLC analysis of PTEN siRNA 1962 coupled to D-glucose.

[0022] Figure 4A Schematic diagram showing siRNA conjugated to a carbohydrate via a linker.

[0023] Figure 4B Schematic diagram showing siRNA conjugated to glucose via a linker.

[0024] Figure 5 It is shown that conjugation of siRNA to glucose does not affect the activity of siRNA: NUR001 - anti-PTEN siRNA; Competitor Load - conjugate of siRNA to cholesterol; NurExo-Load - conjugate of siRNA to glucose, as described in Example 3.

[0025] Figure 6 Shown are the loading efficiencies of siRNA coupled to glucose (NurExo-Load) or cholesterol (Competitor-Load).

[0026] FIG7 shows cellular uptake of loaded extracellular vesicles (EVs) in human neural progenitor cells. As observed by super-resolution microscopy, the use of glucose ( Figure 7B ) or cholesterol ( Fig. 7A), ReNcell VM cells showed similar uptake of DID-labeled EVs (purple) loaded with siRNA targeting PTEN (green).

[0027] Figure 8 Colocalization analysis of EV and glucose fluorescence signals is shown.

[0028] Fig. 9 Motor rehabilitation assessed by evaluating the BBB score is shown.

[0029] Fig.10 Improvements in sensory recovery assessed using Von Frey filaments are shown.

[0030] Fig.11 A reduction in the tendency to self-cannibalism was shown.

[0031] Fig.12 Recovery of tail pinch and paw pinch reflexes is shown. DETAILED DESCRIPTION

[0032] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. In the event of a conflict, the patent specification, including definitions, will control.

[0033] The present invention provides an extracellular vesicle (EV) loaded with a cargo molecule comprising an active agent chemically bound to at least one carbohydrate or a derivative thereof. In addition, the present invention provides an extracellular vesicle (EV) loaded with an exogenous carbohydrate as an active agent.

[0034] The present invention also provides a novel method for loading EVs with cargo molecules comprising hydrophilic compounds conjugated to active agents. A non-limiting example of the hydrophilic compound is a carbohydrate or a conjugate thereof. The method for loading extracellular vesicles (EVs) with cargo molecules comprises incubating an EV population with the cargo molecule, i.e., an active agent chemically conjugated to at least one carbohydrate or a derivative thereof.

[0035] As shown in the examples, carbohydrates provide the ability to load active agents coupled thereto into EVs similar to cholesterol, which is widely used for this purpose. Active agents are incorporated into EVs using carbohydrates, particularly sucrose and glucose, and glucose content is also enriched in the EVs. This can be used, for example, to provide / replenish cells, particularly cells in damaged (e.g., inflamed) tissues. Sucrose is used to provide even more energy to cells. In addition, in contrast to cholesterol, which may increase membrane rigidity, loading EVs with sugars does not affect the properties of the EV bilayer. In addition, this is correct for carbohydrates that are taken up into EVs through channels. More importantly, using sugars (particularly glucose), the uptake process of active agents coupled to sugars can be controlled, for example, by using insulin.

[0036] According to one aspect, the present invention provides isolated extracellular vesicles (EVs) comprising at least one exogenous carbohydrate as an active agent.

[0037] According to another aspect, the present invention provides an isolated extracellular vesicle (EV) comprising a cargo molecule, wherein the cargo molecule comprises an active agent chemically bound to a carbohydrate or a derivative thereof. In some embodiments, the cargo molecule is referred to as a conjugate.

[0038] According to some embodiments, the cargo molecule is loaded into the EV. Thus, according to some embodiments, the present invention provides an isolated extracellular vesicle comprising at least one cargo molecule, wherein the cargo molecule comprises an active agent chemically bound to a carbohydrate or a derivative thereof. According to any one of the embodiments of the present invention, the cargo molecule is an exogenous molecule. Thus, according to some embodiments, the present invention provides an isolated extracellular vesicle comprising an exogenous cargo molecule, wherein the exogenous cargo molecule comprises an active agent chemically bound to at least one carbohydrate or a derivative thereof.

[0039] According to some embodiments, the active agent is selected from the group consisting of small molecules, proteins, peptides, polypeptides, lipids, carbohydrates, and nucleic acids. According to some embodiments, the active agent is selected from the group consisting of small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the active agent is selected from the group consisting of small molecules, lipids, and nucleic acids.

[0040] According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate.

[0041] The terms, definitions and embodiments provided below refer to, apply and are included in any aspect of the present invention.

[0042] The term "exogenous" refers to a molecule or substance (eg, a compound, nucleic acid, or protein) that is not normally present in a cell or vesicle, originates from outside, and is introduced into a recipient cell or vesicle.

[0043] The terms "extracellular vesicle" and "EV" are used interchangeably herein and refer to cell-derived vesicles that include a membrane surrounding an internal space. Typically, EVs have a diameter in the range of 30nm to 1500nm, more typically 40 to 1200nm, and may be contained in the internal space, displayed on the outer surface of the extracellular vesicle and / or across the membrane. The cargo molecules may include nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. The term EV also includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs with a size between 30 and 150nm in diameter. In some embodiments, the term exosome refers to an EV with a size between 30 and 100nm in diameter. The term "microvesicle" used herein refers to an EV with a size between 100 and 1000nm in diameter. Typically, EVs may contain at least a portion of the molecular contents of the cell from which they are derived, such as lipids, fatty acids, polypeptides, polynucleotides, proteins and / or sugars.

[0044] The EV is derived from a cell. The terms "derived from" and "originated from" are used interchangeably herein and refer to a vesicle within, produced by, or generated from a specific cell, cell type, or any cell population. The terms "mother cell," "producer cell," and "original cell" used herein include any cell from which an extracellular vesicle is derived. For example, a "mother cell" or "producer cell" includes a cell that is a source of an extracellular vesicle. According to some embodiments, the cell is a eukaryotic cell.

[0045] The extracellular vesicle (EV) can be derived from a biological cell in any of a variety of ways, such as by secretion, budding or diffusion from the biological cell. The EV may be isolated from mesenchymal stem cells (MSC), neural crest cells (NCC), mesenchymal stem cell conditioned medium (MSC-CM) or neural crest cell conditioned medium. For example, the EV can be produced, exuded, released or shed from a biological cell. When the biological cell is in cell culture, the EV may be secreted into the cell culture medium.

[0046] Examples of biological cells from which EVs can be derived include adherent cells expressing mesenchymal markers such as mesenchymal stem cells, oral mucosal stem cells or olfactory sheathing cells, astrocytes and neural crest cells. Therefore, according to some embodiments, the EVs are derived from adherent cells expressing mesenchymal markers. According to one embodiment, the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosal stem cells and olfactory sheathing cells. According to one embodiment, the cells are mesenchymal stem cells (MSCs).

[0047] The term "mesenchymal stem cells" refers to multipotent stromal cells that can differentiate into various cell types known in the art, including osteoblasts, chondrocytes, myocytes, adipocytes, osteocytes, fibroblasts, and astrocytes.

[0048] In the pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.

[0049] Mesenchymal stem cells can be isolated from various tissues, including but not limited to bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to some embodiments of the present invention, the mesenchymal stem cells are isolated from bone marrow. According to some embodiments, the mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to some embodiments, the EV is derived from MSC derived from bone marrow. According to other embodiments, the EV is derived from MSC derived from adipose tissue. According to some such embodiments, the EV is selected from exosomes, microvesicles and combinations thereof. According to some embodiments, the cells express CD105, CD166, CD29, CD90 and CD73 markers. According to another embodiment, the cells express CD105, CD166, CD29, CD90 and CD73, and do not express CD34, CD45 and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSCs), exfoliated deciduous tooth stem cells (SHEDs), periodontal ligament stem cells (PDLSCs), apical papilla stem cells (SCAPs), and dental follicle progenitor cells (DFPCs).

[0050] According to some such embodiments, the EV comprises or expresses at least a portion of the markers expressed by the cell from which the EV is derived.

[0051] The EV may comprise one or more proteins, oligonucleotides or polynucleotides secreted by a specific cell type (e.g., mesenchymal stem cells or neural crest cells). The EV may comprise one or more proteins or polynucleotides present in a mesenchymal stem cell conditioned medium (MSC-CM). In a specific embodiment, the EV may comprise miRNA derived from MSC or neural crest cells. For example, the EV may comprise 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more or 70% or more of these proteins and / or polynucleotides. The EV may substantially comprise about 75% of these proteins and / or polynucleotides. The protein may be defined by reference to a protein list or a gene product of a gene list.

[0052] The EV may have at least one property of a mesenchymal stem cell. The EV may have a biological property or biological activity. The EV may have any biological activity of a MSC. The particle may, for example, have the therapeutic or restorative activity of a MSC.

[0053] Methods for isolating, purifying and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, those disclosed by Caplan and Haynesworth in U.S. Pat. No. 5,486,359 and Jones EA et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0054] Mesenchymal stem cell culture can be by diluting BM aspirate (usually 20ml) with an equal volume of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, NY, USA), and layering the diluted cells on a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA) of about 10ml to produce. After centrifugation at 2500x g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1500x g for 15 minutes and resuspended in complete medium (MEM, a medium without deoxyribonucleotides or ribonucleotides; GIBCO), 20% fetal calf serum (FCS) (derived from a batch selected for the rapid growth of MSC (Atlanta Biologicals, Norcross, GA)), 100 units / ml penicillin (GIBCO), 100 μg / ml streptomycin (GIBCO) and 2mM L-glutamine (GIBCO). The resuspended cells were inoculated in a 10 cm culture dish (Corning Glass Works, Corning, NY) containing about 25 ml of culture medium and incubated at 37°C and 5% humidified CO2. After 24 hours of culture, non-adherent cells were discarded and adherent cells were thoroughly washed twice with phosphate buffered saline (PBS). The culture medium was replaced with fresh complete culture medium every 3 or 4 days for about 14 days. The adherent cells were then harvested with 0.25% trypsin and 1 mM EDTA (trypsin / EDTA, GIBCO) at 37°C for 5 min, re-plated in a 6 cm plate, and cultured for another 14 days. The cells were then treated with trypsin and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA). The cultured cells were recovered by centrifugation and 1 to 2X 10 per ml with 5% DMSO and 30% FCS. 6 Aliquots of approximately 1 ml were slowly frozen and stored in liquid nitrogen.

[0055] To expand the mesenchymal stem cell fraction, the frozen cells were thawed at 37°C, diluted with complete medium, and recovered by centrifugation to remove DMSO. The cells were resuspended in complete medium and plated at approximately 5000 cells / cm 2 After 24 hours of culture, non-adherent cells are removed and adherent cells are harvested using trypsin / EDTA, separated through channels with a narrow Pasteur pipette, and preferably at a density of about 1.5 to about 3.0 cells / cm 2Under these conditions, MSC cultures can grow for about 50 population doublings and expand about 2000-fold (Colter DC. et al., Proc Natl Acad Sci USA. 97: 3213-3218, 2000).

[0056] The MSC cultures used in some embodiments of the present invention include three groups of cells defined by their morphological characteristics: small agranular cells (hereinafter referred to as RS-1), small granular cells (hereinafter referred to as RS-2) and large medium granular cells (hereinafter referred to as mature MSCs). The presence and concentration of these cells in culture can be detected by identifying the presence or absence of various cell surface markers, by using, for example, immunofluorescence, in situ hybridization and activity assays.

[0057] The EVs can be generated or isolated in several ways. Such methods may include isolating the EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0058] According to some embodiments, the EVs of the present invention are isolated EVs.

[0059] The EVs of the present invention are mostly spherical, and the terms "size", "particle size", "average particle size" and "particle size" used herein refer interchangeably to the diameter of the EV or the longer diameter of the extracellular vesicle. Any known particle size measurement method can be used to determine the size of the EVs of the present invention. A non-limiting example is nanoparticle tracking analysis (NTA).

[0060] According to some embodiments, the EV is an exosome. According to some embodiments, the EV is a microvesicle. According to another embodiment, the EV is a combination of small and large vesicles.

[0061] According to any of the above embodiments, the EVs are isolated. The EVs can be isolated from cells by standard separation and washing protocols, by differential centrifugation, size exclusion or any other method for isolating particles from culture medium.

[0062] The terms "purify", "purified", "purifying", "isolate", "isolated" and "isolating" are used interchangeably herein and refer to the state of a population of extracellular vesicles (e.g., extracellular vesicles of known or unknown amount and / or concentration) that has undergone one or more purification / isolation processes, such as selection of desired extracellular vesicles, or removal or reduction of residual biological products and / or removal of unwanted extracellular vesicles, such as removal of EVs of a specific size. According to one embodiment, the ratio of the number of EVs to the number of residual maternal cells is at least 2, 3, 4, 5, 6, 8 or 10 times higher than in the starting material, or at least 50, 100, 1000 or 2000 times higher in certain advantageous embodiments. In some advantageous embodiments, the term "isolated" has the meaning of being substantially cell-free or cell-free, and can be replaced by it. According to some embodiments, the extracellular vesicles, such as exosomes, are derived from adherent cells expressing mesenchymal markers. According to some embodiments, the adherent cells expressing mesenchymal markers are mesenchymal stem cells (MSCs).

[0063] The terms "cargo" and "payload" are used interchangeably herein and include, but are not limited to, therapeutic agents, diagnostic probes, peptides, nucleic acids, oligonucleotides, antisense oligonucleotides, plasmids, proteins, small molecules, radioactive substances and conjugates thereof, particularly conjugates with carbohydrates, which are loaded and present in EVs or on their membranes. In some embodiments, the terms "cargo" and "conjugate" are used interchangeably. The term "conjugate" refers to the binding between molecules. The binding may be direct or indirect. For example, the conjugate between nucleic acids and carbohydrates may be direct, such as through a covalent bond, or indirect, such as through a non-covalent bond (e.g., electrostatic interactions (e.g., ionic bonds, hydrogen bonds, halogen bonds), van der Waals interactions (e.g., dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (π effect), hydrophobic interactions, etc.). The term also refers to an active agent chemically bound to at least one carbohydrate or derivative thereof. The term "chemical binding" refers to both covalent bonds and non-covalent bonds. According to some embodiments, the active agent is selected from small molecules, proteins, peptides, lipid polypeptides, carbohydrates and nucleic acids. According to some embodiments, the active agent is a small molecule. According to some embodiments, the active agent is a protein. According to some embodiments, the active agent is a peptide. According to some embodiments, the active agent is a lipid polypeptide. According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the active agent is covalently bound to a carbohydrate. According to other embodiments, the active agent is bound to a carbohydrate via a non-covalent bond.

[0064] According to some embodiments, the active agent may be a pharmacological agent such as a small molecule, a nucleic acid, a peptide, a carbohydrate, and a protein. According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate.

[0065] The terms "active agent," "pharmacological agent," and "active moiety" are used interchangeably herein and refer to an agent that has biological activity, pharmacological effects, and / or therapeutic use.

[0066] According to some embodiments, the pharmacological agent / active agent is an anticancer agent, a cytostatic agent, a DNA or RNA intercalator, a splicing regulator, a tyrosine kinase inhibitor, a statin, an NSAID, an antibiotic, an antifungal agent, an antibacterial agent, an anti-inflammatory agent, an antifibrotic agent, an antihypertensive agent, an analgesic, an antipyretic, an appetite suppressant and weight loss inducer, a sedative, a hypnotic, an anticonvulsant, a hormone, a neurotransmitter, an aromatase inhibitor, an esterase inhibitor, an anticholinergic, an SSRI, a BKT inhibitor, a PPAR agonist, a HER inhibitor, an AKT inhibitor, a BCR-ABL inhibitor, a signal transduction inhibitor, an angiogenesis inhibitor, a synthase inhibitor, an ALK inhibitors, BRAF inhibitors, MEK inhibitors, PI3K inhibitors, enkephalinase inhibitors, β2 agonists, CRTH2 antagonists, FXR agonists, BACE inhibitors, sphingosine-1-phosphate receptor modulators, MAPK inhibitors, Hedgehog signaling inhibitors, MDM2 antagonists, LSD1 inhibitors, beta-lactamase inhibitors, TLR agonists, TLR antagonists, IDO inhibitors, ERK inhibitors, Chk1 inhibitors, nucleic acid-based agents such as oligonucleotides, siRNA, shRNA, antisense oligonucleotides, splice switch oligonucleotides, mRNA, peptides, natural products, polypeptides, carbohydrates, and any combination thereof.

[0067] According to any of the above embodiments and aspects, the carbohydrate is selected from the group consisting of monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides.

[0068] According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from the group consisting of glucose, fructose, ribose, arabinose, galactose, mannose and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose.

[0069] According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose and maltose. According to some embodiments, the disaccharide is sucrose.

[0070] According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose.

[0071] According to some embodiments, the carbohydrate is a tetrasaccharide.

[0072] According to some embodiments, the carbohydrate is an oligosaccharide.

[0073] According to some embodiments, the carbohydrate derivative is selected from conjugates of sugars with amino acids, polyphenols or lipids.

[0074] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate and an amino acid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate connected to an amino acid. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, mannose, ribose, arabinose, galactose, sucrose and maltotriose. The term "amino acid" as used herein refers to an organic compound comprising both an amine and a carboxylic acid functional group, which can be a natural or non-natural amino acid. The twenty-two natural amino acids are aspartic acid (Asp), tyrosine (Tyr), leucine (Leu), tryptophan (Trp), arginine (Arg), valine (Val), glutamic acid (Glu), methionine (Met), phenylalanine (Phe), serine (Ser), alanine (Ala), glutamine (Gln), glycine (Gly), proline (Pro), threonine (Thr), asparagine (Asn), lysine (Lys), histidine (His), isoleucine (Ile), cysteine ​​(Cys), selenocysteine ​​(Sec) and pyrrolysine (Pyl). According to some embodiments, the amino acid is L-cysteine. According to some embodiments, the carbohydrate derivative is D-ribose-L-cysteine.

[0075] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate and a polyphenol. According to some embodiments, the carbohydrate derivative comprises a carbohydrate connected to a polyphenol. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to some embodiments, the polyphenol is selected from flavonoids and isoflavonoids. According to some embodiments, the conjugate of the sugar and the polyphenol is selected from (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, baicalin and puerarin.

[0076] The compound (-)-epigallocatechin gallate 3'-O-α-D-glucoside has the structure of Formula I.

[0077]

[0078] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate and a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate connected to a lipid. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides and amino alcohols, such as serine and hydroxyproline.

[0079] According to some embodiments, the phospholipid is selected from phosphatidylcholine, polyenylphosphatidylcholine, phosphatidylinositol, phosphatidylglycerol, phosphatidylethanolamine, 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), distearoyl sphingomyelin and any combination thereof. According to another embodiment, the liposome-forming lipid is a phospholipid. According to some embodiments, the amino alcohol is sphingosine. According to some embodiments, the glycosphingolipid is a ganglioside. According to some embodiments, the carbohydrate derivative is a glycosphingolipid. According to some embodiments, the glycosphingolipid is a cerebroside. According to some embodiments, the glycosphingolipid is a glucocerebroside. According to some embodiments, the cerebroside, such as glucocerebroside, contains nervonic acid as a lipophilic chain.

[0080] According to some embodiments, the carbohydrate derivative does not comprise cholesterol. According to some embodiments, the cargo molecule does not comprise cholesterol.

[0081] According to some embodiments, the active agent is directly bound to the carbohydrate or derivative thereof.

[0082] According to any of the aspects and embodiments, a carbohydrate is used as a loading agent, enhancer or provider of the active agent.

[0083] According to some embodiments, the active agent is bound to the carbohydrate or its derivative via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic and amphipathic linkers. According to some embodiments, the linker is DBCO-C6 acid with CAS number 1425485-72-8.

[0084] According to some embodiments, the active agent is covalently bound to the carbohydrate or its derivative via a cleavable bond or linker. According to some embodiments, the cleavage may be performed by an enzymatic reaction. According to some embodiments, the cleavage may be performed by a chemical reaction.

[0085] According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the active agent is an oligonucleotide. According to some embodiments, the active agent is a polynucleotide.

[0086] The term "nucleic acid" refers to a single-stranded or double-stranded sequence (polymer) of deoxyribonucleotides or ribonucleotides. In addition, unless otherwise specified, polynucleotides include variants of natural polynucleotides. According to one embodiment, the nucleic acid can be selected from deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), locked nucleic acid (LNA) and analogs thereof, but is not limited thereto. The term covers DNA, RNA, single-stranded or double-stranded thereof and chemical modifications thereof.

[0087] The term "polynucleotide" used herein refers to a long nucleic acid comprising more than 150 nucleotides.

[0088] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein.

[0089] As used herein, the term "oligonucleotide" refers to a short single-stranded or double-stranded sequence of nucleic acid, such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or mimetics thereof, which generally has less than or equal to 150 nucleotides.

[0090] According to some embodiments, the oligonucleotide comprises 2 to 150, 10 to 100 or 15 to 50 nucleotides.

[0091] According to some embodiments, the nucleic acid is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA and miRNA inhibitors. According to some embodiments, the nucleic acid is siRNA. According to some embodiments, the nucleic acid is shRNA.

[0092] According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises a nucleic acid molecule chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecule is an exogenous molecule. According to some embodiments, the nucleic acid molecule is an siRNA. According to some embodiments, the nucleic acid molecule is an shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate through a linker. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicle comprises a cargo molecule as shown in Figure 4. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising an siRNA chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequence SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound to the 3' of the sense strand through, for example, a linker. According to some embodiments, the bond is a cleavable bond. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises an siRNA molecule covalently bound to glucose, optionally through a DBCO-C6 acid linker. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises an siRNA molecule covalently bound to sucrose, optionally through a DBCO-C6 acid linker. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises a siRNA molecule covalently bound to arabinose, optionally via a DBCO-C6 acid linker.

[0093] According to some embodiments, about 20 to about 100% of the EVs comprise a cargo molecule of the invention. According to some embodiments, the cargo molecule is exogenous. According to some embodiments, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs comprise a cargo molecule of the invention.

[0094] According to another aspect, the present invention provides a method of loading isolated extracellular vesicles (EVs) with cargo molecules, the method comprising incubating a population of EVs with a cargo molecule comprising an active agent chemically bound to a carbohydrate or a derivative thereof.

[0095] According to some embodiments, the active agent is selected from the group consisting of small molecules, proteins, peptides, polypeptides, lipids, carbohydrates, and nucleic acids. According to some embodiments, the active agent is selected from the group consisting of small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the active agent is selected from the group consisting of small molecules, lipids, carbohydrates, and nucleic acids.

[0096] According to some embodiments, the EV is an exosome. According to some embodiments, the EV is a microvesicle. According to another embodiment, the EV is a combination of small and large vesicles.

[0097] According to any of the above embodiments, the EVs are isolated. The EVs can be isolated from cells by standard separation and washing protocols, by differential centrifugation, size exclusion or any other method for isolating particles from culture medium.

[0098] According to any of the above embodiments and aspects, the carbohydrate is selected from the group consisting of monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides.

[0099] According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from the group consisting of glucose, fructose, ribose, arabinose, galactose, mannose and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose.

[0100] According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose and maltose. According to some embodiments, the disaccharide is sucrose.

[0101] According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose.

[0102] According to some embodiments, the carbohydrate is a tetrasaccharide.

[0103] According to some embodiments, the carbohydrate is an oligosaccharide.

[0104] According to some embodiments, the carbohydrate derivative is selected from a conjugate of a sugar with an amino acid, a polyphenol or a lipid. The carbohydrate derivative is as described in any one of the above embodiments.

[0105] According to some embodiments, the active agent is directly bound to the carbohydrate or derivative thereof.

[0106] According to some embodiments, the active agent is bound to the carbohydrate or its derivative via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic and amphipathic linkers. According to some embodiments, the linker is 10-hydroxydecanoic acid.

[0107] According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the nucleic acid is an oligonucleotide. According to some embodiments, the nucleic acid is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA and miRNA inhibitors. According to some embodiments, the nucleic acid is siRNA. According to some embodiments, the nucleic acid is shRNA.

[0108] According to some embodiments, the method for preparing the EV of the present invention comprises incubating the EB population with a cargo molecule, the cargo molecule comprising a nucleic acid selected from siRNA, shRNA, saRNA, miRNA, RNAi or mRNA, which is bound to a carbohydrate or a derivative thereof selected from glucose, ribose, arabinose, galactose, mannose, sucrose, maltotriose, (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, isoquercetin, baicalin, puerarin, cerebroside and glucocerebroside. According to some embodiments, the method for preparing the EV of the present invention comprises incubating the EV population with a cargo molecule, wherein the cargo molecule comprises a nucleic acid molecule chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecule is an exogenous molecule. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate via a linker. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicle comprises a cargo molecule as shown in Figure 4.

[0109] According to some embodiments, the present invention provides a method for preparing an isolated extracellular vesicle loaded with siRNA, the method comprising incubating an siRNA chemically bound to a carbohydrate or a derivative thereof with an isolated EV. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequence SEQID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound to the 3' of the sense strand, for example, through a linker. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the bond is a cleavable bond. According to some of the above embodiments, the EV is derived from an adherent cell expressing a mesenchymal marker. According to some of the above embodiments, the adherent cell expressing a mesenchymal marker is a mesenchymal stem cell (MSC). According to some of the above embodiments, the mesenchymal stem cell is a human bone marrow mesenchymal stem cell. According to some of the above embodiments, the EV is an exosome.

[0110] According to some embodiments, about 20 to about 100% of the obtained EVs contain cargo molecules of the present invention. According to some embodiments, the cargo molecules are exogenous. According to some embodiments, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs contain cargo molecules of the present invention. According to some embodiments, about 20 to about 100%, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs are loaded with cargo molecules of the present invention.

[0111] According to some embodiments, the methods of the present invention further comprise electroporation or administration of a transfection agent such as a lipofection agent.

[0112] According to an alternative embodiment, the method of the invention is performed in the absence of electroporation and transfection reagents.

[0113] According to some embodiments, loading the EV with the cargo molecule is performed in the presence of insulin or a derivative thereof. According to some embodiments, the insulin is selected from aspart insulin, glulisine insulin, lispro insulin, regular insulin, NPH insulin, detemir insulin, glargine insulin, degludec insulin and mixtures thereof. According to some embodiments, the insulin is a rapid-acting, intermediate-acting or long-acting insulin. According to some embodiments, the insulin is present in a concentration of 1 to 1000 nM. According to some embodiments, the insulin is present in a concentration of 1 to 1000 U / ml. According to some embodiments, the insulin is present in a concentration of 10 to 1000 U / ml. According to some embodiments, insulin is present at a concentration of 20 to 800U / ml, 30 to 700U / ml, 40 to 600U / ml, 50 to 500U / ml, 60 to 400U / ml, 70 to 300U / ml, 80 to 200U / ml, 90 to 150U / ml, 80 to 150U / ml, 70 to 120U / ml or 80 to 120U / ml. According to some embodiments, insulin is present at a concentration of 0.1 to 1000U / ml. According to some embodiments, insulin is present at a concentration of 0.1 to 100U / ml or 0.5 to 50U / ml. The insulin can be present over the entire loading time (incubation of the EV with cargo molecules) or any portion of the time.

[0114] According to some embodiments, insulin significantly increases the uptake of cargo molecules of the present invention by EVs compared to EVs loaded without insulin. This is particularly significant for cargo molecules comprising active molecules bound to glucose. According to some embodiments, insulin increases the uptake of the cargo molecules in EVs by at least 10% compared to corresponding conditions that do not include (lack of or absence of) insulin. According to some embodiments, insulin increases the uptake of the cargo molecules in EVs by at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% or at least 80% or at least 100% compared to corresponding conditions that do not include insulin. According to some embodiments, insulin increases the uptake of cargo molecules of the present invention in EVs by 10% to 60% compared to corresponding conditions that do not include insulin in the buffer during loading. According to some embodiments, insulin increases the uptake of the cargo molecule in the EV by 15 to 55%, 20 to 50%, 25 to 45%, 30 to 50%, 30 to 55%, 35 to 50%, or 35 to 45% compared to corresponding conditions not including insulin. According to some embodiments, the cargo molecule comprises an active agent covalently bound to glucose. According to some embodiments, the amount of the cargo molecule in the resulting EV is 10 to 60%, 15 to 55%, 20 to 50%, 25 to 45%, 30 to 50%, 30 to 55%, 35 to 50%, or 35 to 45% more than the amount in the EV loaded in the absence of insulin. According to some embodiments, the amount of the cargo molecule in the obtained EV is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% or at least 80% or at least 100% higher than the amount in the EV loaded without insulin. The terms "substantially free", "essentially free", "free of", "not including" and "not containing" can be used interchangeably and refer to a composition that does not include, contains or contains a specific component, for example, the composition contains less than 0.1wt%, less than 0.01wt% or less than 0.001wt% of the component. According to some of the above embodiments, the EV is derived from an adherent cell expressing a mesenchymal marker. According to some of the above embodiments, the adherent cell expressing a mesenchymal marker is a mesenchymal stem cell (MSC). According to some of the above embodiments, the mesenchymal stem cell is a human bone marrow mesenchymal stem cell. According to some of the above embodiments, the EV is an exosome.

[0115] According to another aspect, the present invention provides EVs that can be obtained by or by the method of the present invention as described in any one of the above embodiments. According to some embodiments, the EV comprises cargo molecules loaded by the method of the present invention. According to some of the above embodiments, the EV is derived from adherent cells expressing mesenchymal markers. According to some of the above embodiments, the adherent cells expressing mesenchymal markers are mesenchymal stem cells (MSCs). According to some of the above embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells. According to some of the above embodiments, the EVs are exosomes.

[0116] According to yet another aspect, the present invention provides a composition comprising an EV of the present invention, for example loaded with a cargo molecule, and a carrier. According to some embodiments, the EV is or can be obtained by a method of the present invention.

[0117] As used herein, the term "carrier" refers to any compound or composition that can be used to facilitate the storage, stability, application, cell targeting and / or delivery of the topical composition, including but not limited to suitable carriers, skin conditioners, skin protectants, diluents, emollients, solvents, excipients, pH adjusters, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, antifoaming agents, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, mono-, di- and tri-glycerides and their derivatives, waxes, oils and water.

[0118] According to some embodiments, the composition is a pharmaceutical composition, and the carrier is a pharmaceutically acceptable carrier.

[0119] Therefore, according to some embodiments, the present invention provides a pharmaceutical composition comprising an EV population according to any one of the above embodiments and aspects and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV population obtained or obtainable by the method of the present invention and a pharmaceutically acceptable carrier.

[0120] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" as used herein refers to any and all solvents, dispersion media, preservatives, antioxidants, coatings, isotonic and absorption delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, glidants, pH regulators, buffers, enhancers, wetting agents, solubilizers, surfactants, antioxidants, etc. that are compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds to provide supplementary, additional or enhanced therapeutic functions. A solid carrier or excipient may be, for example, lactose, starch or talc, or a liquid carrier such as water, fatty oil or liquid paraffin.

[0121] Other carriers or excipients that can be used include, but are not limited to, materials derived from animal or plant proteins, such as gelatin, dextrin, and soy, wheat, and psyllium seed proteins; gums, such as gum arabic, guar gum, agar, and xanthan gum; polysaccharides; alginates; carboxymethylcellulose; carrageenan; dextran; pectin; synthetic polymers, such as polyvinylpyrrolidone; polypeptide / protein or polysaccharide complexes, such as gelatin-arabic complexes; sugars, such as mannitol, glucose, galactose, and trehalose; cyclic sugars, such as cyclodextrins; inorganic salts, such as sodium phosphate, sodium chloride, and aluminum silicate; and amino acids and derivatives thereof having 2 to 12 carbon atoms, such as, but not limited to, glycine, alanine, aspartic acid, glutamic acid, hydroxyproline, isoleucine, leucine, and phenylalanine. Each possibility represents an independent embodiment of the present invention.

[0122] Solutions or suspensions for parenteral, intradermal or subcutaneous application typically include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerol, propylene glycol (or other synthetic solvents), antibacterial agents (such as benzyl alcohol, methyl parabens), antioxidants (such as ascorbic acid, sodium bisulfite), chelating agents (such as ethylenediaminetetraacetic acid), buffers (such as acetates, citrates, phosphates) and agents for regulating osmotic pressure (such as sodium chloride, glucose). pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes or multiple dose glass or plastic bottles.

[0123] Pharmaceutical compositions suitable for parenteral administration include, but are not limited to, aqueous and non-aqueous sterile injection solutions or suspensions, which may contain antioxidants, buffers, antibacterial agents, and solutes that make the composition substantially isotonic with the blood of the target receptor. For example, such compositions may also include, for example, water, alcohol, polyols, glycerol, and vegetable oils. Extemporary injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. Such compositions preferably include a therapeutically effective amount of the compound of the present invention and / or another one or more therapeutic agents, and an appropriate amount of carrier, so as to provide a form of appropriate administration to the subject.

[0124] According to some embodiments, the pharmaceutical composition of the present invention comprises a population of EVs containing cargo molecules, wherein the cargo molecules comprise nucleic acid molecules chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecule is an exogenous molecule. According to some embodiments, the nucleic acid molecule is an siRNA. According to some embodiments, the nucleic acid molecule is an shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate via a linker. According to some embodiments, the linker is DBCO-C6 acid. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is an siRNA, and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicle comprises a cargo molecule as depicted in FIG. 4. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising an siRNA chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequence SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound to the 3' of the sense strand, for example, through a linker. According to some embodiments, the bond is a cleavable bond. According to some of the above embodiments, the EV is derived from an adherent cell expressing a mesenchymal marker. According to some of the above embodiments, the adherent cell expressing a mesenchymal marker is a mesenchymal stem cell (MSCs). According to some of the above embodiments, the mesenchymal stem cell is a human bone marrow mesenchymal stem cell. According to some of the above embodiments, the EV is an exosome. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises an siRNA molecule covalently bound to glucose, optionally through a DBCO-C6 acid linker. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises a siRNA molecule covalently bound to sucrose, optionally via a DBCO-C6 acid linker.According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, wherein the cargo molecule comprises a siRNA molecule covalently bound to arabinose, optionally via a DBCO-C6 acid linker.

[0125] According to some embodiments, the pharmaceutical composition is used to treat and / or prevent a disease, disorder or condition that can be treated with the active agent loaded in the EV. Obviously, the use depends on the molecule loaded in the EV and will be adjusted accordingly. Therefore, a pharmaceutical composition comprising an EV loaded with siRNA that inhibits the expression of phosphatase and tensin homolog (PTEN) protein is used to treat any disease or condition that requires reduction of PTEN protein expression, such as neurodegenerative diseases, neuronal disorders, neuronal damage, CNS damage, and the neuronal damage or damage is spinal cord injury (SCI).

[0126] The term "treating" a condition or patient refers to taking steps to obtain beneficial or desired results, including clinical results. Beneficial or desired clinical results include, but are not limited to, ameliorating, eliminating, substantially inhibiting, slowing or reversing the progression of a disease, condition or disorder, substantially improving or alleviating clinical or aesthetic symptoms of a condition, substantially preventing the appearance of clinical or aesthetic symptoms of a disease, condition or disorder, and preventing harmful or annoying symptoms. Treating further refers to achieving one or more of the following: (a) lessening the severity of the disorder; (b) limiting the development of symptoms characteristic of the disorder being treated; (c) limiting the worsening of symptoms characteristic of the disorder being treated; (d) limiting the recurrence of the disorder in patients who have previously suffered from the disorder; and / or (e) limiting the recurrence of symptoms in patients who were previously asymptomatic for the disorder.

[0127] As used herein, the term "preventing" when used in relation to a condition refers to the administration of a composition to reduce the frequency or delay the onset of symptoms of a medical condition in a subject compared to a subject not receiving the composition.

[0128] The pharmaceutical composition of the present invention can be administered using any known method. The term "administration" of a substance, compound or medicament to a subject can be performed using one of various methods known to those skilled in the art. For example, the compound or medicament can be administered intranasally (e.g., by inhalation), intrathecal (in the spinal canal or subarachnoid space), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, ocularly, sublingually, orally (by ingestion), intracerebrally and transdermally (by absorption, e.g., by skin catheter). The compound or medicament can also be appropriately introduced by a replaceable or biodegradable polymer device or other device (e.g., patch and pump) or a formulation providing an extension, slow or controlled release of the compound or medicament. Administration can also be performed, for example, once, multiple times and / or in one or more extended time periods. According to some embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a day. According to other embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a month. In some embodiments, administration includes direct administration (including self-administration) and indirect administration (including prescribing behavior). For example, as used herein, a physician who instructs a patient to self-administer a drug or have another person administer a drug and / or provides a prescription for a drug to a patient is administering the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered near a lesion or injury. According to one embodiment, the pharmaceutical composition is administered orally. According to one embodiment, the pharmaceutical composition is administered intranasally. According to some embodiments, the pharmaceutical composition is administered topically. According to some embodiments, the pharmaceutical composition is administered systemically.

[0129] According to another aspect, the present invention provides a method for delivering an active agent, the method comprising exposing a mammal, an organ, a tissue or a target cell to an EV of the present invention containing a cargo molecule of the present invention comprising the active agent, such as an EV obtained or obtainable by a method of the present invention.

[0130] According to another aspect, the present invention provides a method for treating a disease, medical condition or disorder treatable by an active agent, the method comprising administering to a subject in need thereof a therapeutically effective amount of an EV of the present invention, which contains a cargo molecule comprising an active agent bound to a carbohydrate as described in any of the above embodiments.

[0131] According to another aspect, the present invention provides a conjugate molecule comprising an exogenous nucleic acid chemically bound to a carbohydrate or a derivative thereof. All terms and embodiments defined above also apply hereto and are included therein. According to some embodiments, the conjugate molecule does not contain cholesterol.

[0132] According to some embodiments, wherein the carbohydrate is selected from the group consisting of monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides, and wherein the carbohydrate derivative is selected from the group consisting of sugars linked to amino acids, polyphenols or lipids.

[0133] According to one embodiment, the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose, fructose and xylose; the disaccharide is selected from sucrose, lactose and maltose. According to one embodiment, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the sugar linked to the amino acid is ribose-cysteine. According to some embodiments, the sugar linked to the polyphenol is selected from (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, baicalin and puerarin. According to some embodiments, the sugar linked to the lipid is a cerebroside. According to some embodiments, the cerebroside is glucocerebroside.

[0134] According to some embodiments, the nucleic acid is bound to a carbohydrate or a derivative thereof directly or via a linker. Any linker may be used, such as those defined above. According to some embodiments, the nucleic acid is an oligonucleotide.

[0135] According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, miRNA, miRNA inhibitors and short activated NA (saRNA). Therefore, according to some embodiments, the present invention provides a conjugate comprising an oligonucleotide selected from RNA, RNAi, siRNA, shRNA, miRNA and miRNA inhibitors chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate. According to some embodiments, the nucleic acid is covalently bound to a carbohydrate through a linker. According to some embodiments, the linker is a DBCO-C6 acid linker. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid, and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is a siRNA, and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is siRNA, and the carbohydrate is bound to its antisense strand. According to some embodiments, the cargo molecule has the structure depicted in Figure 4. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising an siRNA chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequence SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound to the 3' of the sense strand, for example, through a linker. According to some embodiments, the bond is a cleavable bond. According to some embodiments, the active agent is covalently bound to a carbohydrate or a derivative thereof through a cleavable bond or a linker. According to some embodiments, the cleavage can be performed by an enzymatic reaction. According to some embodiments, the cleavage can be performed by a chemical reaction. According to some embodiments, the present invention provides an exogenous siRNA molecule, which is optionally covalently bound to glucose through a DBCO-C6 acid linker. According to some embodiments, the present invention provides an exogenous siRNA molecule, which is covalently bound to sucrose, optionally via a DBCO-C6 acid linker.According to some embodiments, the present invention provides an exogenous siRNA molecule, which is covalently bound to arabinose, optionally via a DBCO-C6 acid linker.

[0136] References without a specific number herein mean one or more.

[0137] The term "and / or" is used to mean that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0138] The term "or" as used herein indicates that alternatives can be combined where appropriate; that is, the term "or" includes each individually listed alternative as well as combinations thereof, provided that these combinations are not mutually exclusive.

[0139] The terms "comprising", "including", "having" and "containing" are used interchangeably herein and have the meaning of "consisting at least in part of...". When interpreting each statement in this specification that includes the term "comprising", features other than the one or more features preceding the term may also be present. Related terms such as "including" and "comprising" should be interpreted in the same manner. The terms "having" and "including" may also encompass the meanings of "consisting of..." and "consisting essentially of..." and may be replaced by these terms. The term "consisting of..." does not include any components, steps or procedures that are not specifically described or listed. The term "consisting essentially of..." means that the composition or component may include additional ingredients, but only if the additional ingredients do not substantially change the basic and novel characteristics of the claimed composition or method.

[0140] Having now generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the invention.

[0141] Example

[0142] Example 1.

[0143] The loading scheme was to mix 3 different concentrations of each sugar, sugar derivative, sugar derivative-siRNA conjugate, and sugar-siRNA conjugate with 10 6 -10 8Exosomes / μl were co-incubated for 2 and 4 hours at 25°C and 37°C in the presence and absence of insulin, with and without insulin. The sugars and sugar derivatives tested were glucose, ribose, arabinose, galactose, sucrose, mannose, maltotriose, (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, isoquercetin, baicalin, puerarin, cerebrosides and glucocerebrosides. All possibilities were tested in triplicate. After incubation, the exosomes were separated from the culture medium and washed twice. The loaded exosomes were used to quantify the concentration of sugars, sugar derivatives, sugar-siRNA conjugates and siRNA within the exosomes and were also used for related in vitro experiments at a later time.

[0144] The concentrations of sugar / sugar derivatives, sugar / sugar derivative-siRNA conjugates and siRNA within the exosomes are tested using at least two different analytical methods (e.g., using fluorescent labeling, ELISA, WB, PCR, LC-MS / MS).

[0145] Exosomes loaded with the most successful cargo molecules comprising sugar / sugar derivatives and sugar / sugar derivatives conjugated to siRNA, which achieved the highest intra-exosome concentration, were then incubated with cells to demonstrate the suppression and inhibition of relevant genes and proteins.

[0146] To determine the efficiency of the sugar / sugar derivative, sugar / sugar derivative-siRNA conjugate loading the exosomes, the following procedure was performed.

[0147] After mixing 3 different concentrations of each sugar, sugar derivative, sugar derivative-siRNA conjugate, and sugar-siRNA conjugate with 10 6 -10 8 After 2 and 4 hours of co-incubation at 25°C and 37°C for 2 hours and 4 hours of loading protocols, cy-3 labeled siRNA is added to each sample to determine the loading efficiency. The exosomes are labeled with a fluorescent dye for exosome membrane staining (such as carboxyfluorescein succinimidyl ester-CFSE green dye), so the cell membrane will be stained with CFSE green dye and the siRNA cargo will be stained with Cy3 / FAM red marker. Using Cytoflex / Nanosight or other nanoparticle tracking analysis technology (NTA), we will be able to see the loaded exosomes and determine the loading efficiency of each condition.

[0148] In addition, for each condition, the labeled loaded exosomes were added to the cells. The cells were observed under a confocal microscope to confirm that the exosomes were properly engulfed into the cells.

[0149] Then, to evaluate the efficient suppression and inhibition of siRNA-targeted genes by the siRNA loaded in exosomes, cells were incubated with loaded exosomes from all the above conditions for 24 to 72 hours, harvested, and tested at the RNA and protein levels. To evaluate gene expression in cells, RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's protocol. cDNA was prepared using a high-capacity cDNA reverse transcription kit (Thermo Fisher). Real-time quantitative PCR was performed on a QuantStudio 12K Flex Real-Time PCR System using target gene-specific primers. Relative expression levels were determined using the ΔΔCt method, in which the gene of interest was normalized to GAPDH expression.

[0150] To assess protein expression, cells were incubated with loaded exosomes from all the above conditions for 24 to 72 hours, harvested and lysed. Lysates were tested for protein expression using western blot analysis or / and ELISA using antibodies specific for the target protein.

[0151] Example 2

[0152] Four different sugars (three monosaccharides and one disaccharide (glucose, mannose, galactose and sucrose) were incubated with EVs derived from BM MSCs and separated after incubation on UHPLC using a dedicated sugar column (Phenomenex (LunaOmega) Agilent 1290 Infinity II) coupled to a 1260 Infinity ELSD.

[0153] Materials and methods

[0154] Glucose working solution - concentration is 1000PPM (~1mg / ml)

[0155] Sucrose working solution - concentration is 1000PPM (~1mg / ml)

[0156] Arabinose working solution - concentration is 1000PPM (~1mg / ml)

[0157] Galactose working solution - concentration is 1000PPM (~1mg / ml)

[0158] To each of the four different sugar solutions, 10 μl of EV was added at a concentration of ~10 7 Particles / μl (measured on Nanosight NS300)

[0159] • Make up the volume to 100 μl with DDW.

[0160] - The solution was incubated at RT for 30 min with shaking.

[0161] HPLC parameters for separation of different sugars

[0162] In UHPLC, a dedicated sugar column (Phenomenex (Luna Omega) Agilent 1290 Infinity II) was used in combination with a 1260 Infinity ELSD for separation.

[0163] Phase preparation:

[0164] ·Water(A)

[0165] Solvent mixture (B): acetonitrile (90%), isopropanol (5%), water (5%)

[0166] The initial concentrations of the phases were 5% (A) and 95% (B).

[0167] During the run, the concentration was gradually changed to 10% (A) and 90% (B).

[0168] The chromatograms of each sugar, EV, and sugar and EV were analyzed and compared, and the absorbance level of the sugar in EV was calculated. The fraction of unbound sugars is summarized in Table 1.

[0169] Table 1. Percentage of unbound sugars

[0170] Standard Deviation % of Residual Sugar sugar 0 19 sucrose 2 28 Galactose 1 20 glucose 1 20 Arabinose

[0171] In this experiment, we investigated the effects of a fixed concentration (1000 ppm) of 4 different sugars and a fixed concentration (10 7 The results showed that under these conditions, up to 80% of each sugar was taken up in / onto MSC-derived EVs.

[0172] In a similar arrangement, other sugars were tested: ribose, mannose, lactose, maltose, maltotriose, and raffinose.

[0173] Example 3. Quantitative measurement of glucose uptake efficiency of BM MSC-derived EVs

[0174] Experimental objectives:

[0175] The objectives of this experiment were to quantitatively measure the glucose uptake potency of BM MSCs-derived EVs and to develop an analytical method for QC and QA to quantify glucose-conjugated molecules as loading agents for EVs.

[0176] Experimental plan:

[0177] This experiment was based on previous results obtained in Example 2, which showed the high uptake efficacy of four different sugars (glucose, sucrose, mannose and galactose) into BM MSC-derived EVs. Here, the focus was on glucose as a loading agent for EVs and determining its uptake profile.

[0178] Work Program

[0179] Glucose working solution - concentration is 1000PPM

[0180] · Add 10 μl of EV to solutions with different glucose concentrations (see Table 2) at a concentration of ~10 7 Particles / μl (measured on Nanosight NS300)

[0181] • Make up the volume to 100 μl with DDW.

[0182] - The solution was incubated at RT for 30 min with shaking.

[0183] Table 2. Solution preparation

[0184]

[0185] All conditions were performed in triplicate

[0186] HPLC parameters for glucose separation

[0187] In UHPLC, a dedicated sugar column (Phenomenex (Luna Omega) Agilent 1290 Infinity II) was used in combination with a 1260 Infinity ELSD for separation.

[0188] Phase preparation:

[0189] ·Water(A)

[0190] Solvent mixture (B): acetonitrile (90%), isopropanol (5%), water (5%)

[0191] The initial concentrations of the phases were 5% (A) and 95% (B).

[0192] During the run, the concentration was gradually changed to 10% (A) and 90% (B).

[0193] The integrals of the chromatograms with different glucose concentration (PPM) conditions and different controls were calculated to determine the amount of glucose absorbed.

[0194] Calibration curve

[0195] As a first step, we verified that the glucose concentration range from 250 PPM to 1000 PPM was within the linear range of the assay. A calibration curve was established and the results showed that R 2 =0.9932. In addition, the uptake of glucose by exosomes was measured. The results are presented in Table 3.

[0196] Absorption curve

[0197] Table 3.

[0198] Glucose concentration Average glucose absorbed (%) STD 250 42 1.7 500 37 0.3 750 28 4.6 1000 9 5.3

[0199] For a glucose concentration of 250 PPM, the glucose absorption capacity of EV (UHPLC, Agilent) was -40%.

[0200] Example 4: Quantitative measurement of sucrose uptake efficiency of BM MSC-derived EVs

[0201] Experimental objectives:

[0202] The objectives of this experiment were to measure the uptake efficiency of sucrose by BM MSC EVs in a quantitative measurement, to develop an analytical method for quantifying the loading of sucrose-conjugated molecules into exosomes, and to demonstrate that conjugation of molecules to glucose is an efficient method for loading EVs with desired molecules. Different sucrose concentrations were used to measure the uptake efficiency of disaccharides (compared to monosaccharides).

[0203] Experimental plan:

[0204] This experiment was based on previous results showing high uptake efficiency of four different sugars (glucose, sucrose, arabinose and galactose) into MSC EVs. In this experiment, we focused on sucrose as a loading agent for EVs and determined its uptake profile.

[0205] Work Program

[0206] Prepare sucrose solution at a concentration of 1000 PPM

[0207] Add 10 μl of exosomes to solutions with different sucrose concentrations (see table below) at a concentration of ~10 7 Particles / μl (protein 3.01μg / μl)

[0208] The solution was incubated at room temperature with shaking for 0.5 h.

[0209] The working concentrations are summarized in Table 4.

[0210] Table 4. Summary of concentrations

[0211]

[0212] All conditions were performed in triplicate

[0213] HPLC parameters for sucrose separation

[0214] In UHPLC, a dedicated sugar column (Phenomenex (Luna Omega) Agilent 1290 Infinity II) was used in combination with a 1260 Infinity ELSD for separation.

[0215] Phase preparation:

[0216] ·Water(A)

[0217] Solvent mixture (B): acetonitrile (90%), isopropanol (5%), water (5%)

[0218] The initial concentrations of the phases were 5% (A) and 95% (B).

[0219] During the run, the concentration was gradually changed to 10% (A) and 90% (B).

[0220] result

[0221] First, as in the case of glucose, we established a calibration curve to verify that sucrose concentrations from 250 to 1500 PPM were within the linear range of the assay. The results are summarized in Table 5.

[0222] Table 5. Sucrose linear curve

[0223] ppm Area 1 Area 2 Area 3 average value SD 250 21.0 19.4 19.0 19.8 0.9 500 47.0 44.0 30.0 40.3 7.4 1000 92.5 85.7 93.3 90.5 3.4 1500 143.9 152.0 133.5 143.1 7.6

[0224] The different concentrations of sucrose showed a linear curve. This control is important to verify the calibration of the system.

[0225] EV Verification

[0226] Individual EVs were tested in UHPLC to validate them prior to absorption testing. The chromatograms shown below confirm their validity ( Figure 1 ).

[0227] Analysis of sucrose absorption curve

[0228] The results of sucrose absorption on EVs are presented in Tables 5 and Figure 2 middle.

[0229] Table 5.

[0230]

[0231] Summary and Conclusion:

[0232] In general, the results showed an absorption curve with an absorption peak around 500 ppm sucrose.

[0233] Example 5

[0234] The siRNA used in this experiment is anti-PTEN-siRNA 1962 conjugated to sugar, more specifically glucose. The siRNA sequence is described below.

[0235]

[0236] HPLC analysis of the siRNA showed Figure 3 A schematic diagram of such a conjugate is shown in Figure 4A In the present invention, more specific conjugates with glucose are presented in Figure 4B middle.

[0237] In other embodiments of the invention, the siRNA is conjugated with other sugars: sucrose, arabinose, mannose, galactose, ribose, lactose maltose, maltotriose and raffinose.

[0238] Example 6

[0239] As a next step, it was tested whether conjugation of siRNA to glucose affects the potency of siRNA. This was performed using conventional transfection of cells (by using Lipofectamine) using the conjugate described in Example 5.

[0240] Transfection:

[0241] HEK293 were grown to 90% confluence. One day before transfection, 20K cells / well were seeded in a 96-well plate with 100 μl growth medium in each well. The transfection experiment was repeated three times. siRNA was mixed with transfection medium (T medium - serum-free growth medium) according to the manufacturer's protocol. Lipofectamine TM Gently mix RNAiMAX before use and then dilute as above. Gently mix. Mix the diluted RNAi duplex with the diluted Lipofectamine TM Combine RNAiMAX. Mix gently and incubate at room temperature for 5-20 minutes.

[0242] Replace the medium in all wells to be transfected with 100 uL of Growth Medium.

[0243] Add RNAi duplex-Lipofectamine to each well containing cells TMRNAiMAX complex. Mix gently by rocking the plate back and forth. Incubate the cells at 37°C for 24 hours. After 24 hours, change the medium for all samples (100uL medium / well) and image the cells under a fluorescent microscope to record transfection efficiency (pic / calculation). After 72 hours, the cells are ready to be harvested for RNA purification.

[0244] Gene Expression:

[0245] RNA was isolated using the RNeasy Mini Kit according to the manufacturer's instructions. cDNA was prepared from 500 ng RNA using a cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions.

[0246] RNA levels were assessed using designed Taqman probes. The relative expression of the target gene (PTEN) compared to GAPDH as a gene was calculated using the ΔCt method. The expression levels were normalized to untransfected cells.

[0247] The results are presented in Figure 5 In the figure, it is shown that the conjugation of siRNA to glucose does not affect the activity of siRNA. In the figure: NUR001 is an anti-PTEN siRNA; Competitor Load - a conjugate of siRNA to cholesterol; NurExo-Load - a conjugate of siRNA to glucose as described in Example 4. As can be clearly seen in the figure, glucose conjugated to siRNA does not affect the efficiency of siRNA in inhibiting PTEN expression after transfection of HEK293 cells.

[0248] Example 7.

[0249] The purpose of this experiment is to determine the efficiency of siRNA molecules loaded into EVs, that is, the percentage of EVs loaded with siRNA coupled to sugars. Compare siRNA coupled to glucose (as in Example 5) and cholesterol. EVs derived from bone marrow MSCs were stained with lipophilic dyes (EV staining method) and loaded with fluorescently labeled siRNA conjugates. EV purification was performed using a 35nm qEV single column (Izon). The sample was eluted with filtered PBS (0.02 μm). The collected fractions were then transferred to an amicon ultracentrifugal filter tube with a molecular weight cutoff of 30 kDa, and the volume was then made up to 500 μl with PBS (0.02 μm). The tube was centrifuged at 14000 x g for 10 min at RT to concentrate EVs. In order to obtain maximum recovery of the concentrate, the amicon ultracentrifugal filter tube was then inverted in a new collection tube and centrifuged at 1000 x g for 5 minutes at RT. The fractions were then observed and analyzed under a high-resolution microscope (data not shown). Figure 6The loading efficiency of siRNA conjugated to glucose compared to the same siRNA conjugated to cholesterol is shown. As can be seen from the figure, the loading efficiency is about 60%, similar to the loading of the cholesterol conjugate.

[0250] In similar experiments, siRNAs conjugated to other sugars were tested: sucrose, arabinose, galactose, ribose, mannose, lactose, maltose, maltotriose, and raffinose.

[0251] Example 8.

[0252] In this example, the ability of EVs loaded with glucose- or cholesterol-conjugated siRNA to enter cells was tested. To this end, loaded EVs were incubated with human progenitor cells.

[0253] Methods: ReN cells were grown to 80-90% confluence. One day before EV treatment, 10K cells / well were seeded in Matrigel-coated 96-well plates containing 100 μl of growth medium. The medium was replaced on the day of the experiment.

[0254] The following EVs were thawed and processed:

[0255] 1. EVs loaded with Ellap5-cholesterol-Cy3 stained with a membrane marker (DiD)

[0256] 2. EVs loaded with Ellap5-glucose-Cy3 stained with a membrane marker (DiD)

[0257] Add 7uL of each sample to each well in triplicate:

[0258] The cells were incubated at 37°C for 24 hours.

[0259] The next day, cells were washed once with PBS and stained with Hoechst. Images were acquired using a super-resolution microscope (LightSheet, Zeiss Z7).

[0260] As can be seen in Fig. 7A and 7B As seen in Figure 3, EVs loaded with either glucose- or cholesterol-coupled siRNA were similarly taken up by cells.

[0261] In similar experiments, siRNAs conjugated to other sugars were tested: sucrose, arabinose, galactose, ribose, mannose, lactose, maltose, maltotriose, and raffinose.

[0262] Example 9. Loading of EVs in the presence of insulin

[0263] Experiment I

[0264] Exosomes (200 μl PBS; 10 8 Particles / μl) were incubated at 37°C for 4 hours with 5nmol of siRNA coupled to glucose and 0.1U of insulin added to the above 200ul. Next, the exosomes were washed by amicon filtration or ultracentrifugation (100000xG, 2h) and resuspended with 200ul of saline for further characterization. These results were compared with control conditions (ie, no insulin was added). After adding loaded exosomes to the cells, RT-qPCR and western blotting of the target gene were compared based on the expression of the silenced gene (ie, PTEN) in the cells.

[0265] Experiment II

[0266] Exosomes (20 μl, 10 8 Particles / μl) were incubated with 5 nmol and glucose or another sugar (above reagents) and cy3 / FAM-conjugated siRNA as a fluorescent marker and 10 μg insulin at RT (or 37°C) for 2-4 hours. Next, the exosomes were washed by amicon filtration or ultracentrifugation (100000G, 2h) and resuspended in 200 μl saline for characterization. These results were compared to control conditions: exosomes incubated with glucose-conjugated siRNA in the absence of insulin. The output is a fluorescence analysis of the exosomes using Nanosight / Cytoflex or high-resolution microscopy.

[0267] Experiment III

[0268] Extracellular vesicles (EVs) (1x10 10 Particles / ml) were pre-incubated with 1:6000 diluted insulin (100 U / ml) for 20 min at 37°C and then mixed with glucose as 2-NBDG (0.1 mM) (Invitrogen catalog number N13195) (CTRL) for 1 h at 37°C. EVs were then labeled with 1,1-dioctadecyl-3,3,3,3-tetramethylindolyl dicarbocyanine (DiD). To eliminate small particles including dye aggregates, EVs were eluted through an Izon column. EV suspensions were visualized using super-resolution microscopy and fluorescence signals were measured using IMARIS software. Values ​​are presented as mean ± standard error of the mean (SEM).

[0269] The results are presented in Figure 8 It can be seen that the presence of insulin significantly increased the uptake of glucose in EVs by about 40%.

[0270] Similar experiments were performed using sugars such as sucrose, arabinose, galactose, ribose, mannose, lactose, maltose, maltotriose, and raffinose.

[0271] Example 10. Treatment of Total Spinal Cord Injury Using EVs Loaded with siPTEN-Glucose

[0272] In this experiment, rats with total spinal cord injury were treated intranasally with EVs loaded with siPTEN-glucose.

[0273] Surgery and treatment administration were performed as described by Guo et al., 2019 ACS Nano 2019 13(9), 10015-10028 DOI: 10.1021 / acsnano.9b01892.

[0274] To evaluate the neuroprotective potential of ExoPTEN treatment, rats with complete SCI were divided into 4 groups (4 rats per group at the beginning of the experiment): (1) no treatment, (2) PTEN-siRNA treatment, (3) exosomes alone, and (4) ExoPTEN. Treatment was administered intranasally and started 2-3 h after injury.

[0275] The results showed that intranasal ExoPTEN treatment improved motor, sensory and reflex recovery, as well as health status in injured rats. Figure 9-12 The results of in vivo studies of spinal cord injury (full transection) in rats after intranasal treatment with proprietary ExoPTEN are presented in Figure 1. In the figure, ExoPTEN is EV derived from bone marrow MSCs loaded with siRNA_1962 coupled to glucose, siPTEN refers to siRNA_1962; POC exosomes are loaded with commercially available anti-PTEN siRNA coupled to cholesterol, with the sequences: antisense UUCUGUUUGUGGAAGAACUC (SEQ ID NO: 3) and sense GAGUUCUUCCACAAACAGAA (SEQ ID NO: 4); control - saline.

[0276] The research stated that:

[0277] In the ExoPTEN-treated group, which included four rats that received intranasal administration of ExoPTEN, 75% of the rats responded to the treatment, regaining hind limb reflexes, recovering some motor function, showing no signs of self-mutilation (an indicator of stress), and regaining sensory control.

[0278] In four rats each in the exosome-only and therapeutic PTEN siRNA-only treatment groups, 25% of subjects experienced recovery of hindlimb reflexes, motor function, and sensory control, while also showing no signs of stress-related self-harm.

[0279] In a control group of six rats treated with a non-therapeutic saline solution, none showed any recovery of sensation, reflexes, or motor recovery. All rats in this group displayed self-mutilating behaviors, indicating high levels of stress.

[0280] Furthermore, MRI analysis of the rat spinal cord clearly showed tissue regeneration caudal to the epicenter of T10 injury in treated rats compared to control (saline) rats.

[0281] Although the present invention has been described above by way of preferred embodiments thereof, modifications may be made thereto without departing from the spirit and essence of the invention as defined in the appended claims.

Claims

1. An isolated extracellular vesicle comprising an exogenous cargo molecule, wherein the exogenous cargo molecule comprises an active agent chemically bound to at least one carbohydrate or a derivative thereof.

2. The isolated EV according to claim 1, wherein the active agent is selected from small molecules, proteins, peptides, polypeptides, lipids and nucleic acids.

3. The isolated EV according to any one of claims 1 to 2, wherein the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides, or wherein the carbohydrate derivative is selected from sugars linked to amino acids, polyphenols or lipids.

4. The isolated EV according to claim 3, wherein the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose and xylose; the disaccharide is selected from sucrose, lactose and maltose; the trisaccharide is selected from maltotriose and raffinose; the sugar linked to the amino acid is D-ribose-L-cysteine; the sugar linked to the polyphenol is selected from (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, baicalin and puerarin; and the sugar linked to the lipid is a cerebroside, such as glucocerebroside.

5. The isolated EV according to any one of claims 1 to 4, wherein the carbohydrate is glucose.

6. The isolated EV according to any one of claims 1 to 5, wherein the active agent is bound to the carbohydrate via a linker.

7. The isolated EV according to any one of claims 1 to 6, wherein the active agent is a nucleic acid.

8. The isolated EV of claim 7, wherein the nucleic acid is an oligonucleotide.

9. The isolated EV according to claim 8, wherein the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, miRNA and / or short activating RNA (saRNA).

10. The isolated EV according to claim 9, wherein the oligonucleotide is siRNA.

11. The isolated EV cargo according to any one of claims 1 to 10, wherein the active agent is covalently bound to the carbohydrate or its derivative via a cleavable linkage.

12. A method for loading isolated extracellular vesicles (EVs) with cargo molecules, the method comprising incubating a population of EVs with a carbohydrate molecule as an active agent or a cargo molecule comprising an active agent chemically bound to at least one carbohydrate or a derivative thereof.

13. The method of claim 12, wherein the carbohydrate is selected from the group consisting of monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides, and wherein the carbohydrate derivative is selected from the group consisting of amino acids, polyphenols and lipids linked to a carbohydrate.

14. The method of claim 13, wherein the monosaccharide is selected from the group consisting of glucose, ribose, arabinose, galactose, mannose and xylose.

15. The method of claim 13, wherein the disaccharide is selected from the group consisting of sucrose, lactose and maltose.

16. The method of claim 13, wherein the trisaccharide is maltotriose.

17. The method of claim 13, wherein the derivative comprising a sugar linked to an amino acid is from D-ribose-L-cysteine.

18. The method of claim 13, wherein the derivative comprising a sugar linked to a polyphenol is selected from the group consisting of (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercetin, baicalin, puerarin, flavonoids and isoflavonoids.

19. The method of claim 13, wherein the derivative comprising a sugar linked to a lipid is a cerebroside.

20. The method of claim 19, wherein the cerebroside is glucocerebroside.

21. The method of any one of claims 12 to 20, wherein the active agent is bound to the carbohydrate via a linker.

22. The method of claim 21, wherein the linker is DBCO-C6 acid.

23. The method of any one of claims 12 to 22, wherein the active agent is selected from the group consisting of small molecules, proteins, peptides, lipids, polypeptides, and nucleic acids.

24. The method of claim 23, wherein the active agent molecule is a nucleic acid.

25. The method of claim 24, wherein the nucleic acid is an oligonucleotide.

26. The method of claim 25, wherein the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, saRNA, and miRNA inhibitors.

27. The method of claim 26, wherein the oligonucleotide is siRNA.

28. The method of claim 25 or 27, wherein the active agent molecule is a nucleic acid conjugated to a carbohydrate selected from the group consisting of glucose and sucrose.

29. The method according to any one of claims 12 to 28, further comprising electroporation or use of a transfection agent such as a lipofection agent.

30. The method according to any one of claims 12 to 28, wherein the method is performed in the absence of electroporation and in the absence of a transfection agent.

31. The method according to any one of claims 12 to 30, wherein the method is performed in the presence of insulin.

32. The method of claim 31, wherein the amount of exogenous cargo molecules loaded in the resulting EVs is at least 20% higher than the amount loaded in the EVs in the absence of insulin.

33. The isolated EV according to any one of claims 1 to 11 or the method according to any one of claims 12 to 32, wherein the EV is an exosome.

34. The isolated EV according to any one of claims 1 to 11 or the method according to any one of claims 12 to 33, wherein the extracellular vesicles are derived from adherent cells expressing mesenchymal markers.

35. The isolated EV or method of claim 34, wherein the adherent cells expressing mesenchymal markers are mesenchymal stem cells (MSCs).

36. The isolated EV or method of claim 35, wherein the mesenchymal stem cells are human bone marrow mesenchymal stem cells.

37. An isolated EV obtainable by or through the method according to any one of claims 12 to 36.

38. A pharmaceutical composition comprising a population of isolated EVs according to any one of claims 1 to 11 or claims 32 to 36 and a pharmaceutically acceptable carrier and / or excipient, wherein the isolated EVs contain exogenous cargo molecules containing an active agent.

39. A pharmaceutical composition according to claim 38, which is used to treat or prevent a disease, disorder or medical condition that can be treated with an active agent loaded into the EV or with unloaded EVs.

40. A method of delivering an active agent, the method comprising exposing a mammal, an organ, a tissue or a target cell to an isolated EV comprising a cargo molecule according to any one of claims 1 to 11 or claims 32 to 38.

41. A method of treating a disease, disorder or medical condition treatable by an active agent, the method comprising administering to a subject in need thereof a therapeutically effective amount of an EV according to any one of claims 1 to 11 or claims 32 to 38, wherein the EV comprises a cargo molecule comprising the active agent.

42. An exoconjugate molecule comprising a nucleic acid covalently bound to at least one carbohydrate or derivative thereof.

43. The conjugate molecule of claim 42, wherein the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides, and wherein the carbohydrate derivative is selected from sugars linked to amino acids, polyphenols or lipids.

44. The conjugate molecule of claim 43, wherein the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose and xylose; the disaccharide is selected from sucrose, lactose and maltose; the trisaccharide is selected from maltotriose and lactose; the sugar linked to the amino acid is D-ribose-L-cysteine; the sugar linked to the polyphenol is selected from (-)-epigallocatechin gallate 3′-O-α-D-glucoside, isoquercetin, baicalin and puerarin; and the sugar linked to the lipid is a cerebroside, such as glucocerebroside.

45. A conjugate molecule according to any one of claims 42 to 44, wherein the nucleic acid is bound to the carbohydrate via a linker.

46. ​​A conjugate molecule according to any one of claims 42 to 45, wherein the nucleic acid is an oligonucleotide.

47. The conjugate molecule of claim 46, wherein the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, miRNA and saRNA.

48. The conjugate molecule of claim 47, wherein the oligonucleotide is a siRNA.

49. The conjugate molecule of claim 47 or 48, wherein the conjugate comprises siRNA bound to a carbohydrate selected from the group consisting of glucose and sucrose.

50. The conjugate molecule according to any one of claims 42 to 49, wherein the nucleic acid is covalently bound to the carbohydrate or a derivative thereof via a cleavable linkage.

Images