Litchi genetic transformation culture medium group and genetic transformation method

Abstract

The invention provides a litchi genetic transformation culture medium group and a genetic transformation method, and belongs to the technical field of genetic transformation. The invention provides a litchi genetic transformation culture medium group comprising a callus induction culture medium and a bud differentiation culture medium. The invention further provides a litchi genetic transformation method constructed on the basis of the litchi genetic transformation culture medium group, the callus induction rate reaches 100% by applying the culture medium composition and the genetic transformation method, and the regeneration and genetic transformation efficiency is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic transformation, and particularly relates to a litchi genetic transformation culture medium set and a genetic transformation method. Background Art

[0002] Litchi is an evergreen tree of the genus Litchi in the family Sapindaceae. It mainly grows in tropical and subtropical regions. It likes high temperature and high humidity climate, sunshine, acidic soil rich in humus, and is afraid of frost. Litchi is generally propagated by sowing, layering, and grafting. Its main production areas are concentrated in China, Vietnam, and India, among which China has the largest planting area. Because of its bright appearance and high sugar content, it is widely favored by consumers at home and abroad, and is one of the important economic crops in South my country.

[0003] With the research on litchi genetic regeneration system and genetic transformation system in recent years, the culture of litchi callus is relatively mature, but there are still major problems in inducing the germination of litchi embryonic callus. Guo Shaoyun used tender stem explants of litchi seedlings with axillary buds as experimental materials, and directly induced germination and budding without callus culture, and successfully obtained complete plants with roots, stems and leaves. Qin Yaqi obtained a complete seedling after 50 days of cultivation in somatic embryo maturation culture, with a seedling rate of only 0.6%. The seedlings were weak, the leaves were easy to fall off, and they died 10 days after transplanting. In summary, the current litchi callus induction and regeneration have problems such as low callus induction rate, difficult differentiation of adventitious buds, and low genetic transformation efficiency, which seriously restricts the research on litchi genetic engineering. Summary of the invention

[0004] The present invention provides a litchi genetic transformation culture medium set and a genetic transformation method, which provide reference and reference for the efficient use of plant genome site-specific editing technology in plant improvement and have good application prospects.

[0005] The invention provides a litchi genetic transformation culture medium set, comprising a callus induction culture medium and a bud differentiation culture medium, wherein the callus induction culture medium uses an MS culture medium as a basic culture medium and further comprises components of the following concentrations: 30 g / L sucrose, 2.5 g / L 2,4-D, 1.5 g / L NAA, 1.0 g / L 6-BA and 0.1 g / L Vc, and a pH value of 5.8-6.2;

[0006] The bud differentiation medium uses 1 / 2MS medium as the basic medium and also includes the following components: 30 g / L sucrose, 7 g / L agar, 0.1 g / L inositol, 0.1 mg / L 6-BA, 0.1 g / L Vc, 1 mg / L ZT and 10% coconut milk by volume, and the pH value is 5.8-6.2.

[0007] In one specific embodiment of the present invention, it also includes a staining solution, which is based on MS as a basic culture medium and also includes the following components at the following concentrations: sucrose 30 g / L and AS 100 μmol / L, and a pH value of 5.8 to 6.2.

[0008] The present invention also provides application of the litchi genetic transformation culture medium set in constructing a litchi genetic transformation method.

[0009] The present invention also provides a litchi genetic transformation method, comprising the following steps: (1) using litchi young branches as explants, sterilizing and cutting into stem segments without buds, and transferring them to the callus induction medium in the litchi genetic transformation medium set for dark culture;

[0010] (2) using Agrobacterium containing the target gene plasmid to infect the callus obtained by dark culture in step (1), and after co-culture, transferring the callus to a new callus induction medium and continuing dark culture;

[0011] (3) transferring the callus obtained by continuing dark culture in step (2) to the bud differentiation medium in the above-mentioned litchi genetic transformation medium group, first culturing in the dark and then culturing under light to complete the genetic transformation of the litchi.

[0012] In a specific embodiment of the present invention, the method for preparing the explant in step (1) comprises taking branches that have germinated for 5 to 7 days from a litchi tree, removing the leaves and cutting the tender stems into small segments with an average length of 0.3 to 0.5 cm as the explants.

[0013] In a specific embodiment of the present invention, the explant is sterilized, and the sterilization comprises washing, immersing in sterile water, soaking in a cephalosporin solution, soaking in ethanol and soaking in sodium hypochlorite in sequence.

[0014] In a specific embodiment of the present invention, the temperature of the dark culture in step (1) is 23-25° C. and the time is 14 days.

[0015] In a specific embodiment of the present invention, the culture medium used for the co-cultivation in step (2) includes the callus induction medium.

[0016] In a specific embodiment of the present invention, the temperature of the continued dark culture in step (2) is 23-25° C. and the time is 5-7 days.

[0017] In a specific embodiment of the present invention, the temperature of the dark culture and light culture in step (3) is 23-25° C., the dark culture time is 3-5 days, and the light culture time is 10-14 days.

[0018] Beneficial effects: The present invention provides a litchi genetic transformation medium set comprising a callus induction medium and a bud differentiation medium. The present invention also provides a litchi genetic transformation method constructed based on the above litchi genetic transformation medium set. Using the medium composition and genetic transformation method of the present invention, the callus induction rate reaches 100%, and the regeneration and genetic transformation efficiency is greatly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The pictures are of the induction and regeneration process of callus in litchi. 1-3: callus induction for one week; 4-5: callus induction for two weeks; 6: bud induction;

[0020] Figure 2 This is a field photo of callus tissue infected with Agrobacterium. In the figure, 1: cultured for one week; 2-4: cultured for 18 days; 5-9: cultured for 33 days;

[0021] Figure 3 This is the result of Cas9 exogenous gene identification, where M: 2000bp Marker; 1-8: sample PCR amplification bands; 9: positive control. DETAILED DESCRIPTION

[0022] The invention provides a litchi genetic transformation culture medium set, comprising a callus induction culture medium and a bud differentiation culture medium, wherein the callus induction culture medium uses an MS culture medium as a basic culture medium and further comprises components of the following concentrations: 30 g / L sucrose, 2.5 g / L 2,4-D, 1.5 g / L NAA, 1.0 g / L 6-BA and 0.1 g / L Vc, and a pH value of 5.8-6.2;

[0023] The bud differentiation medium uses 1 / 2MS medium as the basic medium and also includes the following components: 30 g / L sucrose, 7 g / L agar, 0.1 g / L inositol, 0.1 mg / L 6-BA, 0.1 g / L Vc, 1 mg / L ZT and 10% coconut milk by volume, and the pH value is 5.8-6.2.

[0024] In the callus induction culture medium of the present invention, the callus induction rate can reach 100%.

[0025] The bud differentiation culture medium of the present invention can significantly improve the adventitious bud induction rate.

[0026] In a specific embodiment of the present invention, an impregnation solution is further included, wherein the impregnation solution is based on MS as a basic culture medium and further includes the following components at the following concentrations: 30 g / L sucrose and 100 μmol / L AS, and the pH value is 5.8 to 6.2. The impregnation solution has little toxicity to explants and can improve the efficiency of subsequent genetic transformation.

[0027] The present invention also provides application of the litchi genetic transformation culture medium set in constructing a litchi genetic transformation method.

[0028] The present invention also provides a litchi genetic transformation method, comprising the following steps: (1) using litchi young branches as explants, sterilizing and cutting into stem segments without buds, and transferring them to the callus induction medium in the litchi genetic transformation medium set for dark culture;

[0029] (2) using Agrobacterium containing the target gene plasmid to infect the callus obtained by dark culture in step (1), and after co-culture, transferring the callus to a new callus induction medium and continuing dark culture;

[0030] (3) transferring the callus obtained by continuing dark culture in step (2) to the bud differentiation medium in the above-mentioned litchi genetic transformation medium group, first culturing in the dark and then culturing under light to complete the genetic transformation of the litchi.

[0031] The present invention uses young and tender branches of litchi as explants, wherein the method for obtaining the explants comprises cutting tender branches that have sprouted for about 5 to 7 days, cutting off excess leaves on the branches, and cutting tender stems into an average length of 5 cm. The present invention sterilizes the explants, and the sterilization comprises sequentially washing, immersing in sterile water, soaking in a cephalosporin solution, soaking in ethanol, and soaking in sodium hypochlorite. The washing of the present invention comprises firstly washing the explants with running water for 1 minute, and then placing the explants in tap water containing 0.5% detergent, stirring and washing, and after washing with running water for a period of time, transferring the explants to a clean bench for immersion in sterile water. Before the sterile water immersion, the present invention also needs to use sterile water to wash 2 to 3 times, and then immerse the explant with an appropriate amount of sterile water, and then soak it in a cephalosporin (Cef) solution. In the specific operation, Cef can be added to the aforementioned sterile water, such as adding 200 μL of 200 mg / mL Cef, shaking and soaking for 5 minutes, pouring it out, washing with sterile water 2 to 3 times and then soaking it in ethanol, the ethanol can be an ethanol aqueous solution with a volume percentage of 75%, and the soaking time is 30 seconds. After pouring out the solution, wash it with sterile water 2 to 3 times, and then soak it in a sodium hypochlorite solution, that is, pour in 6.5% NaClO and soak it for 5 minutes, and finally wash it with sterile water 6 to 7 times to obtain a sterile explant material.

[0032] The present invention cuts the sterile external branch material, and uses the cut stem segments to induce callus tissue. In the embodiment of the present invention, on a clean bench, the sterilized branch segments are placed on sterilized filter paper and cut into stem segments of about 3 to 5 mm without buds, and then inoculated into callus induction medium for callus induction. During the operation of the embodiment, the culture dish containing the above callus induction medium is sealed with a sealing film, placed in a biochemical incubator at 23 to 25°C and cultured in the dark for about 14 days, and whether the explant grows callus tissue is observed. The callus tissue can be used for the next stage of adventitious bud induction, and an in vitro regeneration system of litchi is established. The explants cultured for 5 to 7 days can be used as materials for transformation.

[0033] The present invention uses induced callus as a material for genetic transformation, and in the embodiment, an Agrobacterium-mediated method is used for genetic transformation, specifically including transforming a vector containing a target gene into Agrobacterium, and then infecting the callus with the recombinant Agrobacterium in an environment of an infiltration solution. The present invention does not specifically limit the construction method of the recombinant Agrobacterium.

[0034] In one embodiment of the present invention, callus tissue cultured for about 5 to 7 days is selected as the Agrobacterium infection material. The Agrobacterium infection material is placed in an infection solution, and then transferred to an ultrasonic cleaner for 40KHz ultrasonic treatment for 1 minute, wherein the infection solution uses MS culture medium as the basic culture medium, and also includes the following concentrations of components: sucrose 30g / L and AS100μmol / L, pH value 5.8-6.2. Then, the recombinant Agrobacterium bacterial solution with the red protein reporter gene RUBY is added to the infection solution, blown and mixed with a pipette gun, and placed in a constant temperature shaker at 28°C and 50rpm for 3h of infection. After the infection is completed, the infection solution is poured off on the operating table, the callus is transferred to a sterilized filter paper to drain the water, and then the callus is placed in a callus induction culture medium, sealed with a sealing film, and placed in a 23-25°C light incubator for dark culture for 5-7d.

[0035] In one embodiment of the present invention, the callus tissue that has been cultured in the dark for 5 to 7 days after co-cultivation is transferred to a bud differentiation medium, first cultured in the dark in a 23-25°C incubator for 5 to 7 days, and then switched to light culture for about 14 days. The present invention also includes identification after bud differentiation culture, such as extracting the genome of an explant whose callus volume has changed significantly before and after culture, and using the extracted genome as a template to verify whether the target gene has been successfully introduced into the callus tissue. In an embodiment of the present invention, the primers used to identify the reporter gene system RUBY include Cas9-GT1 and Cas9-GT2, and the reference sequence is as follows:

[0036] Cas9-GT1 (SEQ ID No. 1): CCAAGTCGGAGCAGGAGATT;

[0037] Cas9-GT2 (SEQ ID No. 2): GCCAGGTAGAGGAAGTTCACA.

[0038] In order to further illustrate the present invention, a litchi genetic transformation culture medium set and a genetic transformation method provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] The method for constructing the culture medium used in the embodiments of the present invention is as follows:

[0040] Callus induction medium: MS 4.74 g / L + agar 7 g / L + sucrose 30 g / L + 2,4-D 2.5 g / L + NAA 1.5 g / L + 6-BA 1.0 g / L + Vc 0.1 g / L, pH 6.2;

[0041] Bud differentiation medium: 1 / 2MS2.29g / L+sucrose 30g / L+agar 7g / L+inositol 0.1g / L+6-BA 0.1mg / L+coconut milk 10%+Vc 0.1g / L+ZT 1mg / L, pH 5.8-6.2;

[0042] LB medium: NaCl 10g / L + tryptone 10g / mL + yeast powder 5g / L + agar 7g / L, pH 5.8-6.2;

[0043] Escherichia coli Kana resistance selection medium: NaCl 10g / L + tryptone 10g / mL + yeast powder 5g / L + agar 7g / L + kana 50mg / L, pH 5.8-6.2;

[0044] Agrobacterium Kana+Rif resistance selective medium: NaCl 10g / L+tryptone 10g / mL+yeast powder 5g / L+agar 7g / L+Kana 50mg / L+Rif200 mg / L, pH 5.8-6.2;

[0045] Dyeing solution: MS 4.47g / L+sucrose 30g / L+AS100μmol / L, pH 5.8~6.2.

[0046] Example 1

[0047] (1) Select litchi branches that have germinated for about 5 days, cut off the tender branches, cut off the excess leaves on the branches, cut the tender stems into an average length of 5 cm, and then rinse with running water for 1 minute. Place the explant in a beaker containing a mixture of detergent and tap water, stir and wash manually, and transfer the explant to an ultra-clean workbench after rinsing with running water for a period of time. Immediately wash with sterile water 2 to 3 times, then immerse the explant in an appropriate amount of sterile water, add 200 μL 200 mg / mL Cef, shake well and soak for 5 minutes, pour out, wash with sterile water 2 to 3 times, soak in 75% ethanol for 30 seconds, pour out, wash with sterile water 2 to 3 times, then pour in 6.5% NaClO and soak for 5 minutes, and finally wash with sterile water 6 to 7 times to obtain sterile branches.

[0048] (2) Cut the sterilized explants on a clean bench. Each explant is about 3 to 5 mm long. Transfer the cut explants to a plate containing callus induction medium. Seal with sealing film and place in a biochemical incubator at 23 to 25°C for about 14 days in the dark to observe whether the explants grow callus.

[0049] The results are as follows Figure 1 As shown, after one week of culture, the explant incision has obviously expanded and callus tissue has grown. After two to three weeks of culture, the callus tissue begins to differentiate and develop into adventitious buds.

[0050] (3) Construction of recombinant vector: Using the 35S-containing plasmid pHDE as a template, R35S-F and R35S-R as upstream and downstream primers, amplify the 35S promoter fragment. Using the DR5-RUBY plasmid as a template, RRUBY-F and RRUBY-R as upstream and downstream primers, amplify the RUBY target fragment. Using the recovered and purified 35S promoter and RUBY as templates, R35S-F and RRUBY-R as upstream and downstream primers, PCR amplify the 35S-RUBY fusion fragment. The pHEE401E-35S-Cas9 plasmid preserved in the laboratory was digested with restriction endonuclease MfeⅠ, and the purified and recovered 35S-RUBY target fragment was homologously recombined with the digestion product to construct the pHEE401E-35S-RUBY plasmid and transfer it into Agrobacterium culture for engineering bacteria used for genetic transformation. The relevant primers are shown in Table 1. The 35S-containing plasmids pHDE plasmid and pHEE401E-35S-Cas9 plasmid are disclosed in the article: Ouyang Lejun, Yuan Yumei, Li Limei, Chen Ziyin, Chen Ziluo, Yin Aiguo. Construction of CRISPR / Cas9 vectors of the grandis MiR156 family[J]. Journal of Forestry and Environment, 2018, 38(4): 488-493.

[0051] Table 1 Primer list

[0052] Primer name Primer base sequence (5'-3') SEQ ID No. R35S-F TAATGCATTTTATGACTTGCAACATGGTGGAGCACGACAC 3 R35S-R GCGAGGGTCGCATGATCCATCGTGTCCTCTCCAAATGAAA 4 RRUBY-F TTTATTTGGAGAGGACACGATGGATCATGCGACCCTCG 5 RRUBY-R GAATTCGTTGTCAATCAATTTCACTATCACTGGAGGCTTG 6

[0053] (4) Take 100 μL of GV3101 Agrobacterium competent cells out of the -80℃ freezer, immediately place on ice to freeze and thaw, then add 1 μL of the recombinant vector with the correct sequencing results, gently blow and mix, and let it stand on ice for 5 minutes. Then transfer the bacterial solution to liquid nitrogen for quick freezing for 5 minutes, then transfer to a constant temperature metal for incubation at 37℃ for 5 minutes, and then transfer to ice for standing for 5 minutes. Add 800 μL of sterile LB culture medium to the bacterial solution and resuscitate at 28℃ and 200rpm for 3 hours.

[0054] (5) The Agrobacterium that had been revived for 3 hours was centrifuged at 5000 rpm for 1 minute in a desktop high-speed refrigerated centrifuge, and a large amount of supernatant was removed. About 100 μL was retained and mixed with a pipette. Then 50 μL of each was evenly spread on LB solid culture medium with Kana and Rif resistance, respectively. The culture medium was left to stand on a clean bench for a period of time to dry the surface moisture of the culture medium, and then the film was sealed and incubated inverted in a 28°C incubator for 48 hours. A single colony was selected and cultured in liquid for 24 hours to prepare the engineered bacterial liquid for the next step of transformation.

[0055] (6) Select callus that has been cultured for about 15 days, has a light yellow color, and a hard texture as the Agrobacterium infection material. Prepare 100 mL of infection solution, add the callus to be transformed into the infection solution on the clean bench, and then transfer it to an ultrasonic cleaner for 40KHz ultrasonic treatment for 1 minute. Add the Agrobacterium engineering bacterial solution carrying the red protein reporter gene RUBY to the infection solution, blow and mix it with a pipette, and place it in a constant temperature shaker at 28℃ and 50rpm for 3 hours of co-cultivation. After the co-cultivation is completed, pour out the infection solution on the operating table, transfer the callus to a sterilized filter paper to drain the water, and then place the callus in the callus induction medium, seal it with a sealing film, and place it in a 23℃ biochemical incubator for dark culture for 5 days.

[0056] The results are as follows Figure 2 As shown, after Agrobacterium-infected callus was cultured for one week, the callus turned light yellow, and after 2 to 3 weeks of culture, the color of the callus gradually turned light red, indicating that the selection marker RUBY gene began to express color.

[0057] (7) The callus tissue after infection and co-cultivation was transferred to a bud differentiation medium containing 200 mg / L Cef to inhibit the production of Agrobacterium after infection. It was first cultured in the dark in a biochemical incubator at 23-25°C for 3 days and then switched to light culture for about 10 days.

[0058] (8) The explants with obvious changes in callus volume before and after culture were taken for genome extraction. The extracted genome was used as a template and Cas9-GT1 and Cas9-GT2 were used as upstream and downstream primers to identify whether the vector was successfully introduced into the callus.

[0059] The results are as follows Figure 3 As shown, it proves that the reporter gene system RUBY was successfully introduced into callus tissue. The exogenous gene Cas9 can be identified in 8 randomly selected callus tissues.

[0060] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A litchi genetic transformation medium set, comprising a callus induction medium and a bud differentiation medium, characterized in that: The callus induction medium uses MS medium as the basic medium and also includes the following components in concentrations: 30 g / L sucrose, 2.5 g / L 2,4-D, 1.5 g / L NAA, 1.0 g / L 6-BA and 0.1 g / L Vc, with a pH value of 5.8 to 6.2; The bud differentiation medium uses 1 / 2MS medium as the basic medium and also includes the following components: 30 g / L sucrose, 7 g / L agar, 0.1 g / L inositol, 0.1 mg / L 6-BA, 0.1 g / L Vc, 1 mg / L ZT and 10% coconut milk by volume, and the pH value is 5.8-6.

2.

2. The litchi genetic transformation culture medium set according to claim 1, characterized in that: It also includes a dyeing solution, which uses MS as the basic culture medium and also includes the following components in concentrations: 30 g / L sucrose and 100 μmol / L AS, and a pH value of 5.8-6.

2.

3. Use of the litchi genetic transformation culture medium set according to claim 1 or 2 in constructing a litchi genetic transformation method.

4. A method for genetic transformation of litchi, characterized in that: The following steps are involved: (1) Using young and tender litchi branches as explants, cutting them into stem segments without buds after sterilization, and transferring them to the callus induction medium in the litchi genetic transformation medium set of claim 1 or 2 for dark culture; (2) using Agrobacterium containing the target gene plasmid to infect the callus obtained by dark culture in step (1), and after co-culture, transferring the callus to a new callus induction medium and continuing dark culture; (3) transferring the callus obtained by continuing dark culture in step (2) to the bud differentiation medium in the litchi genetic transformation medium set of claim 1 or 2, first culturing in the dark and then culturing under light to complete the genetic transformation of the litchi.

5. The method for genetic transformation of litchi according to claim 4, characterized in that: The method for preparing the explant in step (1) comprises taking branches that have germinated for 5 to 7 days from a litchi tree, removing leaves and cutting the tender stems into small segments with an average length of 0.3 to 0.5 cm as the explants.

6. The method for genetic transformation of litchi according to claim 5, characterized in that: The method comprises sterilizing the explant, and the sterilization comprises washing, immersing in sterile water, soaking in cephalosporin solution, soaking in ethanol and soaking in sodium hypochlorite in sequence.

7. The method for genetic transformation of litchi according to claim 4, characterized in that: The temperature of the dark culture in step (1) is 23-25° C. and the time is 14 days.

8. The method for genetic transformation of litchi according to claim 4, characterized in that: The culture medium used for the co-cultivation in step (2) includes the callus induction medium.

9. The method for genetic transformation of litchi according to claim 4, characterized in that: The temperature of the continued dark culture in step (2) is 23-25° C. and the time is 5-7 days.

10. The method for genetic transformation of litchi according to claim 4, characterized in that: The temperature of the dark culture and light culture in step (3) is 23-25° C., the dark culture time is 3-5 days, and the light culture time is 10-14 days.

Images