Screening and application of novel plant heat-resistant gene

Abstract

The application finds that the heat resistance of a mutant material ski2dcl4 generated by a large amount of 22nt siRNA is obviously enhanced, and the heat resistance is mainly mediated by 22nt siRNA generated at an SMXL4 / 5 site; after thermal domestication, 22nt siRNA generated at the SMXL4 / 5 site can inhibit the expression of SMXL4 / 5 protein, so that the inhibition on HSFA2 is relieved; the specific targeting transcription inhibition factor SMXL4 / 5 can be used as a novel plant heat resistance method to improve the tolerance of plants to high temperature stress.

Description

Technical Field

[0001] The present application relates to the field of plant technology, and in particular, to regulating the production of 22nt siRNA at specific sites in plants and its application in plant heat resistance. Background Art

[0002] As global warming intensifies, agricultural development has suffered a serious blow. High temperature stress directly affects the physiology, biochemistry and overall gene expression of plants, including changes in membrane structure and function, changes in tissue water content, and the composition of primary and secondary metabolites, proteins and lipids, which ultimately seriously damages the normal growth and development of plants. Sustained high temperatures have become a major concern for scientists and agronomists around the world, and research on improving plant heat tolerance is imminent. In order to overcome the damage caused by high temperature stress, plants have formed a complex and sophisticated defense system, including maintaining the integrity of cell membranes, clearing excessive accumulation of ROS through the production of antioxidants, accumulating osmolytes, and upregulating the biosynthesis of heat shock proteins (HSPs) through heat shock transcription factors (HSFs). In recent years, significant progress has been made in the study of the complex regulatory network of HSFs, but most of them are limited to positive regulatory factors, and relatively few studies have been conducted on negative regulatory factors.

[0003] Post-transcriptional gene silencing (PTGS) is a widespread and conserved regulatory mechanism in eukaryotes that can inhibit invasive RNAs, including transgenic and viral RNAs, and can also control endogenous RNAs involved in stress responses and development. In plants, PTGS strictly regulates development, maintains genome stability, and protects plants from invasion by foreign genes. An increasing number of studies have revealed that non-coding siRNAs play a powerful role in regulating plant development and stress adaptation at the post-transcriptional level. However, it is unclear whether the production of endogenous 22nt siRNAs mediated by DCL2, an important component of PTGS, plays an important role in plant adaptation to high temperature stress. Summary of the invention

[0004] In order to analyze the function of endogenous 22nt siRNA in plant heat resistance, screen new plant heat-resistant genes, and provide new ideas and methods for improving plant heat resistance. The present application found that when Arabidopsis RNA degradation pathway factors and DCL4 are missing at the same time, a large amount of 22nt siRNA can be produced at the transcriptional repressor SMXL4 / 5 site, which inhibits the expression and function of SMXL4 / 5 and releases the inhibitory function of HSFA2, thereby activating the high temperature response of the plant and improving the high temperature tolerance of the plant. Based on this, the present application also found that the simultaneous loss of SMXL family members SMXL3 and SMXL4 or SMXL3 and SMXL5 can also significantly improve the high temperature tolerance of the plant, indicating that SMXL3, SMXL4 and SMXL5 are functionally redundant in high temperature tolerance. Although the SMXL3 site does not produce a large amount of 22nt siRNA, it can also be used as a plant heat-resistant gene and applied to improve the high temperature tolerance of plants.

[0005] The first objective of the present application is to provide a method for promoting the production of a large amount of 22nt siRNA at the SMXL4 and SMXL5 sites of plants, wherein the 22nt siRNA is a DCL2-dependent coding region-derived siRNA.

[0006] In one embodiment, the plant is modified to construct RNA degradation pathway factors and DCL4 function deficiency or inhibition to induce the production of a large amount of 22nt siRNA at the SMXL4 and SMXL5 loci;

[0007] Optionally, the modification includes at least one of gene mutation, gene editing and gene silencing;

[0008] Optionally, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla.

[0009] In one embodiment, the loss-of-function mutant or the function-inhibiting mutant plant satisfies any one of the following conditions (1) to (3):

[0010] (1) The functions of 5'-3' RNA degradation pathway factors EIN5 and DCL4 are simultaneously missing or inhibited;

[0011] (2) the functions of 3'-5' RNA degradation pathway factors SKI2 and DCL4 are simultaneously missing or inhibited;

[0012] (3) A large amount of 22nt siRNA is produced at the SMXL4 and SMXL5 gene loci, resulting in the inhibition of SMXL4 and SMXL5 expression or loss of function;

[0013] In one embodiment, the nucleic acid construct that inhibits RNA degradation pathway factors and DCL4 satisfies any one of the following conditions (1) to (2):

[0014] (1) constructing RNAi vectors targeting specific double-stranded RNAs for the coding regions of EIN5 and DCL4 or SKI2 and DCL4 genes;

[0015] (2) Construction of CRISPR knockout or knockdown vectors using specific sgRNA targeting the coding regions of EIN5 and DCL4 or SKI2 and DCL4 genes.

[0016] The second objective of the present application is to provide the application of 22nt siRNA in plant high temperature tolerance, wherein the 22nt siRNA is derived from the coding regions of the SMXL4 and SMXL5 genes.

[0017] In one embodiment, the high temperature tolerance phenotype of the plant includes the survival rate under lethal high temperature conditions and heat acclimation conditions. The lethal high temperature condition is 44°C treatment for 60 minutes or longer, and the heat acclimation condition is 37°C treatment for 1 hour followed by recovery for 3 days, and then lethal high temperature treatment;

[0018] In one embodiment, the 22nt siRNA accumulated in the plant is mainly from the antisense strands of the coding regions of the SMXL4 and SMXL5 genes;

[0019] Optionally, the plant satisfies at least one of the following conditions (1) to (3):

[0020] (1) The functions of 5'-3' RNA degradation pathway factors EIN5 and DCL4 are simultaneously missing or inhibited;

[0021] (2) the functions of 3'-5' RNA degradation pathway factors SKI2 and DCL4 are simultaneously missing or inhibited;

[0022] (3) DCL4 function is missing or inhibited, and DCL2 function is significantly activated;

[0023] Optionally, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla.

[0024] The third purpose of the present application is to provide novel plant high temperature tolerance genes and high temperature tolerance mutant materials.

[0025] In one embodiment, the single mutants of SMXL family members were purchased from NASC (Nottingham Arabidopsis Stock Centre), and the double and multiple mutant materials were obtained by hybridization separation and identification.

[0026] In one embodiment, the high temperature tolerant mutant material satisfies one of the following conditions (1) to (2):

[0027] (1) at least two genes among SMXL3, SMXL4 and SMXL5 are inhibited from being expressed, deleted or replaced, resulting in the inhibition of expression or loss of function of at least two genes among SMXL3, SMXL4 and SMXL5;

[0028] (2) A large amount of 22nt siRNAs accumulated at the SMXL4 and SMXL5 gene loci;

[0029] In one embodiment, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, Water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 The statistical results of the accumulation of 22nt siRNA and the experimental results of high temperature tolerance of the ski2dcl4 mutant in Example 1 of the present application are as follows: Figure 1 Middle A indicates simultaneous inhibition of 3'-5' RNA degradation and accumulation of a large amount of DCL2-dependent 22nt coding region-derived siRNA in the DCL4 mutant ski2dcl4; Figure 1 Middle B shows the proportion of the top 10 genes with large accumulation of 22nt siRNA in the ski2dcl4 mutant; Figure 1 Middle C shows the phenotypes of wild-type Col-0, ski2dcl4 and ski2dcl4dcl2 treated with lethal high temperature of 44°C for 80 minutes and recovered for 7 days, where the upper figure shows the plant phenotype and the lower figure shows the result of Evans blue staining; Figure 1 D in the middle indicates the survival rate statistics after each material treatment;

[0032] Figure 2 This is the expression and phenotype diagram of the NIA1 / 2 single / double mutant material after high temperature stress in Example 2 of this application: Figure 2 A and B in the middle represent the expression levels of nitrite reductase encoding genes NIA1 and NIA2 verified by RNA sequencing data and qPCR after each material was treated with normal temperature and lethal high temperature, respectively; Figure 2Middle C represents the protein levels of NIA1 / 2 of each material after treatment at normal temperature and lethal high temperature; Figure 2 D, E, and F show the phenotypes of the wild type, nia1, nia2, and nia1nia2 under normal growth conditions and lethal high temperature treatment for 60 minutes;

[0033] Figure 3 This is the expression and phenotype diagram of the SMXL4 / SMXL5 single / double mutant material after high temperature stress in Example 2 of the present application: Figure 3 Middle A indicates qPCR verification of the expression levels of SMXL4 and SMXL5 of each material after treatment at normal temperature and lethal high temperature; Figure 3 B and C show the phenotypes of wild type, smxl4, smxl5, and smxl4smxl5 under normal growth conditions and after lethal high temperature treatment for 45 minutes, respectively;

[0034] Figure 4 The phenotypes of the phloem mutants ops and bam3 under normal growth conditions and high temperature stress in Example 2 of the present application;

[0035] Figure 5 This is the phenotype diagram of the single / double / triple mutant materials of the SMXL family members after high temperature stress in Example 3 of the present application: Figure 5 A in the middle indicates the heat intolerance phenotype of a single mutant of an SMXL family member; Figure 5 Middle B shows the phenotype of SMXL family members with double and triple mutations after lethal high temperature treatment;

[0036] Figure 6 This is the thermal acclimation phenotype and statistical diagram of the SMXL4 / SMXL5 single / double mutant material in Example 4 of the present application: Figure 6 A in the middle shows the phenotypes of wild type, smxl4, smxl5, and smxl4smxl5 under normal temperature, lethal high temperature treatment, and heat acclimation conditions; Figure 6 B in the middle is the fresh weight and survival rate of each material after heat acclimation treatment;

[0037] Figure 7 This is a graph showing the HSFA2 mRNA and protein expression levels of each material after heat treatment in Example 5 of the present application: Figure 7 A and B in the middle are the HSFA2 expression levels detected by RNA sequencing data of each material after being treated at normal temperature and lethal high temperature for 60 minutes; Figure 7 Middle C is the relative expression level of HSFA2 in the wild type and smxl4smxl5 before and after heat acclimation detected by qPCR; Figure 7 D in the middle shows the protein expression level of HSFA2 in wild type and smxl4smxl5 under heat acclimation conditions;

[0038] Figure 8This is a graph showing the accumulation of abnormal RNA and siRNA derived from SMXL4 / 5 after heat acclimation and recovery of wild-type materials in Example 6 of this application: Figure 8 A in the middle is 5'RACE verification of the abundance of abnormal RNA derived from SMXL4 and SMXL5 during heat treatment and recovery; Figure 8 Middle B shows the accumulation of 18-26 nt siRNAs derived from SMXL4 and SMXL5 in the wild type during heat acclimation and recovery. DETAILED DESCRIPTION

[0039] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each embodiment is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0040] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0041] As mentioned above, high temperature stress can directly affect the physiology, biochemistry and overall gene expression of plants, severely disrupting the normal growth and development of plants, and is one of the main adversities that cause crop yield reduction. Research on plant heat tolerance will help to discover new heat-resistant genes and their application in crop breeding. At present, the discovery of heat-resistant genes is mainly focused on HSF positive regulatory factors, and no transcription inhibitors have been reported.

[0042] Post-transcriptional gene silencing (PTGS) is a widespread and conservative regulatory mechanism in eukaryotes that strictly regulates development, maintains genome stability, and protects plants from foreign genes. siRNA plays an important role in regulating plant gene expression and growth and development, but the production and function of endogenous 22nt siRNA in plants are still unclear. Although 22nt siRNA has the ability to undergo secondary amplification and activate stress signals, the content of endogenous 22nt siRNA in plants is very low under normal conditions, and whether it plays an important role in plant adaptation to high temperature stress also requires further research. Therefore, constructing a 22nt siRNA with significant accumulation and screening heat-resistant related transcriptional repressors will effectively analyze the function of 22nt siRNA in high temperature response and obtain new plant heat-resistant genes with application value.

[0043] In order to solve the above technical problems, the first aspect of the present application provides a method for increasing the abundance of 22nt siRNA derived from endogenous SMXL4 and SMXL5 sites in plants. The method includes a specific RNAi double-stranded RNA and RNAi vector designed for RNA degradation pathway factors and DCL4, the double-stranded RNA sequence for RNA degradation pathway factors is derived from EIN5 responsible for 5'-3' RNA degradation or SKI2 responsible for 3'-5' RNA degradation, and the double-stranded RNA sequence for DCL4 is derived from DCL4; and / or a specific knockout / knockdown sgRNA and CRISPR knockout / knockdown vector designed for RNA degradation pathway factors and DCL4, the sgRNA sequence for RNA degradation pathway factors is derived from EIN5 or SKI2, and the sgRNA sequence for DCL4 is derived from DCL4; both the double-stranded RNA sequence and the sgRNA sequence are from plants.

[0044] In some specific embodiments, the plant is selected from at least one of Arabidopsis thaliana, Chinese cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, Water lily cyanus, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla.

[0045] The second aspect of the present application provides the function of 22nt siRNA derived from the endogenous coding region of plants on plant heat resistance, suggesting that 22nt siRNA has broad application prospects in plant high-temperature breeding.

[0046] In addition, the present application also found that although there was no accumulation of 22nt siRNA at the SMXL3 site of the SMXL family member, which led to its expression inhibition, its double mutant with SMXL4 or SMXL5 also had significantly improved high temperature heat resistance, indicating that SMXL3 has functional redundancy with SMXL4 and SMXL5 and may also be involved in high temperature stress response. Therefore, based on the phenotype of the double mutant and the conservatism of the SMXL family, the present application believes that SMXL3 can also participate in regulating plant high temperature adaptability as a new transcriptional repressor, and inhibiting the expression and function of SMXL3, SMXL4 and SMXL5 from different plant sources can significantly improve the plant's tolerance to high temperature.

[0047] The embodiments of the present application will be described in detail below in conjunction with examples, but the present application is not limited to these examples. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0048] Example 1 Analysis of the heat-resistant phenotype of the 22nt siRNA accumulation mutant

[0049] like Figure 1As shown, a large amount of 22nt ct-siRNA was accumulated in the mutant ski2dcl4 lacking both SKI2 and DCL4, the 3'-5' RNA degradation pathway factors. Figure 1 A in the figure is mainly derived from nitrate reductase NIA1 / 2 and SMXL family members SMXL4 / 5 ( Figure 1 B), lethal high temperature ski2dcl4 and ski2dcl4dcl2 found that ski2dcl4 has extremely high temperature tolerance, while the lack of dcl2 is not heat-resistant ( Figure 1 C and D), indicating that ski2dcl4 thermoresistance depends on DCL2-mediated 22ntct-siRNA.

[0050] Example 2 Analysis of the heat-resistant phenotype of the 22nt siRNA accumulation site mutant

[0051] like Figure 2 and Figure 3 As shown, the expression of NIA1 / 2 at the sites where more 22nt siRNAs are produced in ski2dcl4 is induced by high temperature, but is significantly lower in the thermostable mutant ski2dcl4 than in the wild type and the thermostable mutant ski2dcl4dcl2, and the NIA1 / 2 protein is also significantly inhibited ( Figure 2 A, B and C in Figure 1). However, the sites SMXL4 and SMXL5 that produced more 22nt siRNA were significantly inhibited after heat treatment, and the lowest level was found in ski2dcl4 ( Figure 3 A in the figure). The results of high temperature heat treatment of the corresponding mutants of NIA1 / 2 and SMXL4 / 5 showed that single mutations of NIA1 or NIA2, or single mutations of SMXL4 or SMXL5 were intolerant to high temperature, while simultaneous mutations of NIA1 / 2 were sensitive to high temperature ( Figure 2 E and F in Figure 1), the simultaneous loss of SMXL4 / 5 significantly improved the plant's high temperature tolerance ( Figure 3 C), indicating that the tolerance of ski2dcl4 to high temperature may be mediated by 22nt ct-siRNA derived from the SMXL4 / 5 locus rather than siRNA derived from NIA1 / 2.

[0052] Since SMXL4 and SMXL5 regulate phloem development redundantly, the simultaneous loss of SMXL4 and SMXL5 can lead to abnormal phloem development, which may be related to the heat resistance of the double mutant. Therefore, the present invention also subjected the phloem development-related mutants ops and bam3 to high temperature treatment. Figure 4 As shown, both ops and bam3 mutants are heat-intolerant, indicating that phloem development defects are not necessary for the high-temperature heat tolerance of smxl4smxl5, but are caused by the downregulation of their expression mediated by 22nt ct-siRNA derived from SMXL4 / 5.

[0053] Example 3 Analysis of heat resistance phenotype of SMXL family members

[0054] like Figure 5 As shown in the figure, the eight SMXL family members in Arabidopsis can be divided into three branches based on sequence homology, of which SMAX1 and SMXL2 belong to one branch, SMXL3, SMXL4 and SMXL5 belong to the second branch, and SMXL6, SMXL7 and SMXL8 belong to the third branch. The phenotypic differences of single or multiple mutations of SMXL family members under high temperature treatment were analyzed. The results showed that single mutations all showed heat-sensitive phenotypes, and only smxl3smxl4, smxl3smxl5 and smxl4smxl5 showed strong heat adaptation, indicating that SMXL3 / 4 / 5 are functionally redundant in response to high temperature stress. The smxl6 / 7 / 8 triple mutation is more sensitive to high temperature, suggesting that its function is significantly different from SMXL3 / 4 / 5. There is no 22nt siRNA accumulation at the SMXL3 site in the ski2dcl4 mutant, indicating that it may regulate the plant's heat response in a non-22nt siRNA-mediated manner.

[0055] Specifically, the nucleotide sequences of SMXL3, SMXL4 and SMXL5 genes related to plant high temperature adaptability are as follows:

[0056] >SMXL3(AT3G52490, SEQ ID NO.1)

[0057] CTTAGCTGCAGTACCCATTACATCTTAATTTTTGTGAAATTTGAGAAAGAAAAGAATATATGGGCAAAGCTGAGTTACCT

[0058] TTGCCTTTTGATACTGCTTTTGTCATCACATGCATTCCACTTTGCACTACAAAATCCACTTTGGACCCTCAAAAAACCCCC

[0059] CAAATTTTTTGCCTCTCTCACAAGAAAAGCATACACATTTCCTCCTTCTCCTTCCTCATATATTTGAAGACCAAAGTCC

[0060] ATTTTCTTTCTCTCTCTTTCTCTCTCGCTCTCCTATATCCTTACTCTTTTCTTTAGGTTTAAGACTTAGCCCCACCT

[0061] TCCATATAGACGCCGTGTTATTAGACCCTTCTTCTTTGGGTGTTTTTGTTGTCCAAGATAAATGGAATGAAGCCAAGATT

[0062] CTTGAAGCTTTTACCATAGAGCTCTCACTTCTGAGTATTAGTACTATCCCCACCTTGTGTTATTTTAGGGTGTTTTGTCA

[0063] CTATGAGAGCTGGAGGCTGCACGGTGGAGCAAGCCCTCACGGCGGATGCTGCAAACGTGGTGAAACAAGCCATGGGGTTG

[0064] GCTAGACGGAGAGGACATGCTCAGGTCACACCTCTCCATGTAGCTAGCACCATGCTCTCTGCTCCCACGGGTTTACTTAG

[0065] AACAGCTTGTCTCCAATCTCACACTCACCCTCTTCAATGCAGAGCCCTCGAGCTCTGCTTCAACGTAGCTTTGAACCGCC

[0066] TCCCGACCTCTACAGGGAGTCCTATGTTAGGGGTTCCAACTTCCCCTTTCCCTTCTATCTCCAACGCTCTCGGTGCAGCT

[0067] TTCAAACGCGCACAAGCTCACCAACGACGTGGTTCTATAGAGAGCCAGCAACAACCGATCTTAGCAGTCAAGATCGAAGT

[0068] GGAGCAGCTCATAATATCTATCCTCGATGATCCTAGCGTGAGTAGAGTGATGAGAGAAGCTGGTTTCTCGAGTCCTCAAG

[0069] TGAAGACTAAAGTCGAGCAAGCTGTTTCTTTAGAGATTTGCTCTAAAACAACCTCTTCGAGTAAACCCAAAGAGGGGAAG

[0070] TTATTAACTCCTGTCAGGAACGAGGATGTTATGAACGTTATCAACAATCTTGTCGACAAAAAGAGAAGAAATTTCGTGAT

[0071] CGTAGGAGAGTGTTTAGCCACTATTGACGGAGTTGTGAAGACGGTGATGGAAAAGTCGACAAAAAAGACGTGCCCGAGG

[0072] TTTTTAAAAGACGTAAAGTTCATAACTTTATCGTTCTCATCGTTCGGGCAACCAAGTAGAGCCGATGTGGAACGTAAGCTA

[0073] GAGGAGCTAGAGACACTCGTGAAGAGCTGTGTAGGGAAAGGAGTGATTCTAAATCTGGGAGATCTAAACTGGTTCGTAGA

[0074] GTCAAGAACCAGAGGTTCTCACTGTATAACAACAACGATAGCTACTGTGTTGTGGAGCATATGATAATGGAGATTGGGA

[0075] AGTTGGCTTGTGGGTTAGTCATGGGAGATCATGGAAGGTTTTGGTTAATGGGTCTTGCGACTTCACAGACTTACGTGAGA

[0076] TGCAAGTCTGGTCAACCCTCGCTTGAATCTCTCTGGTGTCTCACTACTCTTACTATTCCGGCGACTAGTAATAGTCTCCG

[0077] GTTGAGTCTCGTCTCCGAGAGGTAAAAGTCTTCTATCTTTTGAAACAGTCAAGAATGTGCAATCAACAAATCTGTTATT

[0078] ATTTTATTTTTTTTGGTTGGATATGTTCCAACTATTTTGTCTCTTTTTCGAAAAGGACAATTTTACCTATAGTGTTTTTGC

[0079] TTTTTATTTGGTGATCATATCTAAAAGAACGGTGAACCAACGTGCATCTTTCCTAACTTTTTCTCTATTATTTTATAGCT

[0080] TTTATTATAAGCTTTCTTTGGAGAAATACTAAAGAAAAGTTACATATAATAAGTTACTTCATTTAACAGTTTTAACACT

[0081] ACTAACTGATATAATTACCATTTTGTTTCAAATCAGTGAGCTTGAAGTCAAGAAATCAGAGAACGTGTCTCTCCAGCTGC

[0082] AGCAATCATCGGATCAGCTCAGTTTCTGTGAGGAATGTTCCGTCAAGTTTGAATCGGAAGCTCGATTCTTAAAGAGTAGC

[0083] AATAGCAATGTAACCACTGTAGCATTACCGGCATGGCTTCAGCAGTATAAGAAGGAGAATCAAAATAGTCACACTGTGAG

[0084] TTGTATAAACATCAAATCAGTTTACATTATGTCATTTGCCTCTTCTTATAAGTGCGTCTATGTTGTGGTTTTTGGACTTG

[0085] GCAGGATTCAGATTCTATTAAGGAACTTGTGGTGAAGTGGAACTCAATCTGTGATTCAATCCACAAAAGACCATCTCTAA

[0086] AAACACTCACACTCTCTTCTCCTACTTCTTCCTTTTCTGGTTCCACTCAACCTTCAATCAGTACTCTTCATCATCTTCAA

[0087] ACCAACGGTGATTGGCCCGTGATCGAGACAAACACGCATCGTCATCATTCTGTTGTCCATGAGACATCTCACTTAAGACT

[0088] GTTCATTCCAGAACATGACAGCGAGCAAGACTGAGCTAGTCTGTTCGAATCCTAATTCTACAATGAACTCTGAAGCCT

[0089] CTTCAAGCGATGCAATGGAGTTGGAACATGCCTCTTCAAGGTTTAAAGAGATGAATGCAGAAAACCTAGCAACTTTATGT

[0090] GCTGCCTTGGAAAGCAAGGTACCGTGGCAAGGATTTAGTCCCGGAGTTAGCCACAACAGTCTTGAAATGCAGGTCAGG

[0091] ATCGAGTACGAGGAAGATTAACGGAAACGAGGATAAAAAAGAAGATACATGGATGTTCTTCCAAGGTCTTGATGTAGATG

[0092] CTAAAGAGAAGATCGCTAGAGAATTGGCCAAACTCGTGTTTGGATCGCAAGACAGCTTTGTCTCTATCTGTTTGAGTAGT

[0093] TTCTCGTCGACAAGATCGGATTCTGCAGAAGATTTGAGGAACAAGAGGTTGAGAGATGAACAAAGCCTGAGTTACATAGA

[0094] GAGATTCTCGGAAGCTGTTTCGTTGGATCCAAATAGAGTGATCTTAGTTGAAGATATTGAGCAAGCTGATTATTTGTCTC

[0095] AAGTGGTTTCAAGAGAGCTGTTGAGAGAGGAAGAGTTTGTAATTCGAGTGGTGAAGAAGCTTCGCTTAAAGACGCGATT

[0096] GTGATCTTGAGCTGTGAAAGATTTCGTTCAAGATCAAGAGCTTGTTCTCCTCCTAGTAACCAGAAATCGGACGGTTCAGA

[0097] TCAACCTGAGGACAAGAATGTTGCTACTTGTGTTGCACTTGATCTAAACCTATCTATTGATAGTGCGTACGTTTGTGAAG

[0098] AAGAATCATGTGATGAGATTGGCTTACTCGAAGCGGTAGATGCACGGTTTCATTTCAAGTGTTCATCAACATAACACTAA

[0099] CAGCATGCACGTATGCATGTAACATGGCCCAGTTTATGAACATGATCATTCGCATTACATGGTTTATGGTCAACCGTTAT

[0100] TTAATTTGTTTCCCTTACGGACTTATCTTTCATTGGGTTGGGGCAATACTTTGGGTTAAACGTGTAGTTGTAGATTTGCT

[0101] TTTTCAATTTGGCTTAGGAACTTTTTAGAAGGATATGGGGTTAAAACTAGAGATTTTCCTTTTTTATCTTTTTTTTTTT

[0102] GTCTTAATGTAAAAATTATCATATTATGGTCGTAAATGGTAATTTATGTTCATGGATAAGAGACGGAAAAATAATCTTGAC

[0103] ACACATTGGATTGAACCAA

[0104] >SMXL4(AT4G29920,SEQ ID NO.2)

[0105] TAACTTGCTCTGTCCTCATCTCTTCGATACTTCTCTCAGACTAAACATATCTTATAAACACTAAGTTTACTTCCACCAT

[0106] TACTTTTTCTTCCTTTAAGCTTCAAGAACTTCAAAGTCTTACTTAAACCTTTTGTTTGTGGGTAGAGAGGAAATAGCAAA

[0107] AAGAGATCGATAGATTCTTGCGAGGGGTTTAGGGATTTAAGGTGGGTGGTTTTGTGATGCGTACAGGGCTTATACCGTG

[0108] CACCAGACACTAACACCAGAGGCTGCTTCAGTTTTGAAGCAATCTCTAACCTTAGCAAGAAGGAGAGGCCATTCTCAAGT

[0109] CACTCCTCTTCACGTTGCTTCGACGCTTTTAACTTCGTCAAGATCCAATCTTTTCCGAAGGGCATGTCTCAAATCCAATC

[0110] CGTTCACTGCCCTCGGTCGCCAAATGGCTCACCCTTCTCTCCATTGTCGAGCTCTCGAGCTCTGTTTCCAATGTTTCTCTC

[0111] AACAGGCTTCCGACCAACCCGAATCCTCTGTTTCAGACCCAGCCTTCACTCTCCAACGCTCTCGTAGCGGCACTGAAGAG

[0112] AGCACAGGCGCATCAAAGGAGAGGGTGTGTGGAGCAGCAGCAGAGTCAACAGAACCAACCGTTCTTGGCGGTTAAAGTCG

[0113] AGCTCGAGCAGCTTGTTGTGTCGATTCTTGATGATCCTAGTGTGAGTAGAGTGATGAGAGAAGCTGGACTCTCTTAGTGTT

[0114] TCTGTGAAGAGTAACATAGAGGATGACTCCTCTGTTGTTTCCCCTGTTTTCTACGGCTCTTCTTCCTCTGTTGGTGTTTT

[0115] CTCTTCTCCTTGCTCTCCTTCTTCTAGTGAAAACAATCAAGGAGGAGGGACTTTAAGCCCTAACCCTAGTAAGATTTGGC

[0116] ATGCGCATTTGACCAATCATCACTCTTTTGAGCAAAACCCTTTCTTTCATTTCCCTAAAGGAAAGACCTTTACTCCAGAT

[0117] CAAGCTTTTCCCGTGAGAGAAGACGCAAACCCGGTCATCGAAGTGCTTCTAGGGAAGAAGAACAACAAGAAGAGGAACAC

[0118] TGTCATAGTTGGAGATTCTGTTTCTCTAACAGAAGGAGTGGTTGCAAAACTCATGGGTAGAATCGAGAGAGGAGAAGTTC

[0119] CAGATGATTTAAAACAAACACATTTCATCAAGTTTCAGTTTTCACAAGTTGGTTTGAATTTCATGAAGAAGGAGGATATA

[0120] GAGGGACAAGTTAGAGAGTTGAAGAGAAAGATTGATTCTTTCACATCTTGGGGTGGCAAAGGTGTCATTGTTTGTCTTGG

[0121] AGATCTTGATTGGGCAGTTTGGGGAGGCGGTAACAGCGCATCTTCTTCGAACTATAGCGCGGCGGATCATCTAGTGGAAG

[0122] AGATAGGGAGATTGGTTTATGATTATAGCAACACAGGAGCCAAAGTTTGGCTATTGGGGACAGCTTCTTACCAAACATAC

[0123] ATGAGATGTCAAATGAAGCAACCTCCACTTGATGTTCATTGGGCTCTTCAAGCTGTTTCAATTCCTTCAGGAGGACTTTC

[0124] ACTAACCCTTCATGCTTCAAGGTTTTTTTTTTCTCTTCTTATAATTTAATCACTAGCTTAAGTACTCGTGATGGATACTA

[0125] AATTACTTAGTTTCAGTGGTCACAGTTCTGAGATGGCTTCTCAAGTGATGGAGATGAAGCCATTTAGAGTAAAAGAAAA

[0126] GAAGAAGGAGCAAGAGAAGAGGAAGGAAGATAAACTCAATTTCTGTGGAGAATGTGCTTTTAACTATGAGAAAAGC

[0127] AAAAGCTTTTATATCAGCTCAGCACAAAATCTTACCGCCTTGGCTGCAACCTCATGGAGACAAAACAACATTAACCAAA

[0128] AGGTACAAACTTCTTTTTGATAAATGAATGATCTTTGTTTTGTTATTAGCGTTTGTGCAGTTACTTAAACCGTTTTTTT

[0129] GTGGGTTTAACTTTCAGGATGAATTGAGTGGACTGAGAAAAGAAATGGAACCGGTTTTGTCAAGCTCTTCACCACAAAA

[0130] CCTAGTATGACTGCTTGGAGGGCAGAACAGAGCAGCTCTGTTTTACCGGGTTCTTTGATGACTCGAGTCTGAAGCAAAA

[0131] CTCACGTGCATCTAGTTCTGTTGCTAAGTTTAGACGACAGAACTCGTGTACTATCGAGTTTAGTTTCGGAAGTAATCGTC

[0132] AAAAGGTCTAAAGAAGACTGATGAATTGAGTTTGGATGGTTCAAGAGTAACAATGATGAAGGTGTAAAAACTAAGATC

[0133] ACTCTTGCACTTGGGTCATTCTCCATTTCCATCTGATTCAGAGAACTCGGAAAGAAAACGAAAAGCGATTAAAAAT

[0134] GAGTAATTATTGGAAAAGCTTCACGAGAACATTCCATGGCAAAAGGATGTTCTTCCTTCAATCGTTGAAGCCATGGAAG

[0135] AATCTGTCAAGAGGAGTAAGAGGAAAGATGCATGGATGCTGGTTTCGGGGAACGATGTGACTGCCAAAAGAAGATTGGCT

[0136] ATCACATTGACAACTTCTCTTTTCGGGTCACACGAAAATATGTTGAAGATCAATCTAAGAACATCCAAGGCAAGCGAAGC

[0137] ATGCGAGGAGCTCAAGAACGCGTTGAAGAAGAAGGAAGAGGTTGTTATTTTGATAGAGCGAGTTGATTTAGCCGATGCTC

[0138] AGTTCATGAACATCCTCGTAGATCGATTTGAGGCGGGAGATTTGGATGGTTTTCAAGGAAAGAAGAGCCAAATAATCTTC

[0139] CTTTGACGAGAGAAGATGATGAATGTGTAGAGAATGAACATTTTGTCATACCAATGGTGTTGAATTGTAACAAATCAGG

[0140] TTCTGGTTTGGTCATAACAAGAGGAAACCGGAATATGATGCTGCGCCAACGATGATTAAGAAGAAGAAATCCAAGAATCG

[0141] AGGAAGATGACGACGAAAGCAATGTCGCTTGCGACATAAGCAACATAAAGAAAGAGTTCTCAAGACAGTTGAAGTTCGAA

[0142] TCTAATGCTCTTGACCTCAACTTAAGAGTTGATGCCGACGAAGACGAAGAAGAGGAAGCTAAACCGGCCACTGAAATCTC

[0143] AAGCGGGTTTGAAGAACGTTTTCTAGACTCGATCCAAAACCGGTTTGATTTCACAGTTTTGTCGGACGAAGATATAACTA

[0144] AATTCTTCGTGACAAAGATCAAAGATTCGTGCGAGGAGATCCTCGGGCAACGAGAAGAGAGATTCGGGTTCACCGTCGAT

[0145] GCGGAACTGATAGAGAAGTTTTACAAAGGGTGTGGTTTTTTTGCTAACGGTTTGTTTGAAGAGGTGGGTTAAAGAGGTTTT

[0146] TCAAAGGGGTTTAGTAACGGTCAAACGGCGGGAAAGAGGGCATAAGTGTAATTAACCTATGTTTGGGGGGTATAGATA

[0147] TGATTGACCAAGGGGAGGTATACGAGGAAGAAGAAGGATTCATGGGAACTTGTCTACCCAACAGAATCCATGTTTCCTTT

[0148] GTTGATTAGCTTCGGCTTTTATTTCTGTTCTTAATTTCTTCTATTAGAATTATATAAATATATTTTTTGTTAGTATTATTT

[0149] TTCTTATTTCTTTTTGCTTTATAAGAAGAGAAAAGAAGAAAATTAATTATATGACCCAAGAAGTGGAACTTGACCGCATT

[0150] GTTCTTTGTGTAAACATAAGTTGCCTCGCTTCATGATAGAATGTACTTTTTATATTCCTTTTTTAGGAATAGTGTTGTCA

[0151] CCTTTTCAT

[0152] >SMXL5(AT5G57130,SEQ ID NO.3)

[0153] GTATAAAGGAACCAGCTTGGTCTAATTTCCTTATCTGTCTAAAACTCTCTTAAACCTCTGTCTCTTCTCTCTCTTTCTTC

[0154] TCTTACTTATCTTCTTCTTCTCTTCTCTCATTTCTTGAGTTCTCTCTCCAAGACTCTTCTTTTCTTCAGTCTTCAAACATA

[0155] AGAAAGGAAGTTCCTTTTGTTTCTTCTGTTTTAGTTCTCTTGTGGGTTTATCTATTTGGGGTGGTGGTTAAAGGAGGGAG

[0156] CTTTGGGATTAGAAGTTTTTTCAGTGAAATCAGAAAGCTTTCGAGAGAGGTTTTTTTCAATTTCAAAACGTGGGGGTGGGG

[0157] GGTTAGGGTTAGGGTTTACAAGTTATGCGAACAGGTGGTTATACGATTCAACAGACACTCACTACAGAGGCTGCTTCTGT

[0158] TTTGAAGCACTCTCTCACTTTAGCTAGGAGAAGAGGCCATGCTCAGGTTTCTTAACAAAACCTTCAACATTTTGTTAAAG

[0159] TTTTGATCTTTTTGATCTTTCGATGTTTTATTAATGGAAAAGTTTTTGTTTTTTATTGTTTCAGGTCACTCCTCTCCATGT

[0160] TGCAGCTACATTACTGTCATCAAGGACAAGTCTTTTGAGAAGGGCGTGCATTAAATCTCACCCTGGTTTTTCAACTAATT

[0161] ACCAGTTTGCCCCTTCTCGTCTTCAACATCATCATCACCATAACCAAACCATCCTCTTCAATGCAGAGCTCTCGAGCTT

[0162] TGTTTCAATGTCGCACTCAACAGGCTTCCTACTGTTCCTGGTCCTATGTTTCATGGTCAGCCTTCTCTCGCAAACGCTCT

[0163] CGTCGCTGCACTCAAAAGAGCTCAGGCTCACCAAAGACGCGGCTGTATCGAGCAACAACAACAAACGCAAACGCACCCTC

[0164] AAACGCAGCAAACGCAGTTATTGGCAGTCAAAGTAGAGCTTGAACAGTTGGTTATATCCATTCTTGATGACCCGAGTGTG

[0165] AGTCGGGTCATGAGAGAAGCTGGATTTAACAGCACCGCCGTGAAAAGCTGTGTCGAAGATTGTTCCGTTTCTTCCGTCTT

[0166] TTACGGTGGCTCAGCCGTCGGAGTCTTCTCTTCTCCAAACTCTCCCGATCAACAACAACAACATCACAACAGCATCAACC

[0167] GACTTCACCACTACCAAAACCCTAAAGATTTCAACTTTATAAACCCTAACTTCCCTTTATGGCAAACCCATTTCTTAAAC

[0168] CAATCTCCAGACCAAAACCCACTTCTACTTTCCTCCTCCGCCTCTCATCATCACCAACAACAACGCCTGAGAGAAATCGA

[0169] TTTGAAACTCGTCGTTGATGTTCTTATGAGGAAGAAAACGAAGAAGAAGAACCCAGTGATCGTCGGAGACTCAATTTCGT

[0170] TCACTGAAGGTTTCGTTTCAGAGCTAATGGCAAAGCTAGAGAGAGGAGAAATCGATCAAACCGGTGAGTTAAAGCAAACC

[0171] CATTTCGTCAAGTTTCATTTTTCGCCAATGGCGTCCAAGTTCATGAGAAGAGAAGACGTTGAGCTAAACATAAAGGAGTT

[0172] AAGGAAGAAAGTGCTCTCTTTAACAACGAGTGGCAAAAATGCAATTATCTTCACTGGTGACTTAAAGTGGACAGTCAAAG

[0173] AGATTACAAACAACAACAGTGGTGGAATCAATGAGATTTCTTCATCTTACAGTCCTTTGGATCATCTTGTTGAAGAGATT

[0174] GGGAAATTAATCACTGAGTGTAACGACGATGGTGATGATGATGATTGTAAAACCAGAAAGGTTTGGGTAATGGGAACAGC

[0175] TTCGTTTCAGACATACATGAGGTGTCAAATGAGACAACCTTCGTTAGAAACACTGTGGGCACTTCATCCTGTCTCTGTCC

[0176] CTTCGTCAGCTAATCTTGGCTTAAGCCTTCATGCGACAAGGTAAACTCTTTTTCTTACTTTTTACCATTAATTACTCTAA

[0177] AGTAAAATAGTCTATTTTTTCACAAAAGTGAACTCTTTTTTGTGATGTTGGTCAAAAAGGTATTGCGTAGATAGTGACAC

[0178] TAGCTAGTATGTCTATGTTTAAACTTACAAAAAAATCGAATCTTTGTGTCTAGTTTCAAAACAATAATGTTGTGTTTTTG

[0179] CAGAGCTTACTTGAAAATGGTCCTTTTAGAGTCTGTCTTTGTTCTCTGACTTACTCAGATCAGTGTCTCATTGAAGCCAA

[0180] AACCCTCTGTGTCCTCCATGCCTGTCCATTCACACATATACAGTCTCATTTGATAAATTATAAAACTGGACCTACATAGG

[0181] AGTCCACCTATGTGTAGATAAATTATAGAGATGTGACATTTTATATTCCTTAGGAATTTTTGGATATTAGAATTTCATGA

[0182] TATGGAGATAGGTAACGGATTAGATATGATTGGTGTAATATTCAATGGTTATTGCTTGTAGACAAAATTAAAACATCGTA

[0183] GAGAGAATATATCCTGCAACAGGTTGATAATAAAGCTTGAAACTTTTCAATTATGTGTTTTCTTGTTTTGTTTTGTAGCA

[0184] ATGTGTGGACACTTTTACCCCTTTTACCACTTTGGTCAATTAGTCTCAAGTTTTCTCTTTTATGTCTGATAGCTAAGAGA

[0185] CCGTTCTATATTAGGGAAACATCTTGTCTTTTTGTCTACAGGGCTTCTTTTAACAACAATCCAAAATCTCCTTTTACTTT

[0186] TCTGTTTTGTTTTTCAAATGTTATTTGCGATATTGCCACTGACCTCTGGTTTTTGACCGTTCGTTTATTGCAGTGGACAT

[0187] GAGGCAAGGAACATGAGTACTGTGAATGCAACAAAGTCACTTTCTGGTTATGATAAAGCTGAGGAAGAAGAGACAATAAG

[0188] CCATGTTCTGAGTTGTTGTCCTGAATGTGTTACTAGCTTTGACAGAGAAGCCAAATCCCTTAAAGCTAATCAAGACAAGC

[0189] TCTTGCCTTCTTGGCTCCAATCTCATGATGCAGACAGTTCTTCACAGAAGGTACAACATTTGAAATTAAGTACACAGAAA

[0190] AATGATGGATTCAGCGATACATCAAAGGTCTAATTCTTGTGTTTTGATTGTGTTGTAGGATGAGTTAATGGGATTGAAGA

[0191] GAAAATGGAACAGGTTTTGTGAAACTCTACATAATCAGACAGGACAATTGAGTATGATGGGCAACTATCCCTATGGCTTG

[0192] CCTTATGGATCATCACATGAGTCTTCGAAATCAACTTCTTTGATTGATTCATTAGGTTTGAAGCCGAATCAGCGAGCCAC

[0193] AAACTCGATTGCTAAATTCAGACGTCAGAATTCTTGCACCATTGAGTTTGATTTGGGTGGAAACGAACATGAGAAGGGTG

[0194] AGTCGATCAATGAAGCTGAAGATGACAAGGGAAATGAGACGGTCACTCTTGATTTGGGGCGTTCTCTGTTTCGATCAGAT

[0195] TCCGTAACAGATACGAGACTGAAGCTCAGCGCTTTGGTCAAAGCTTTGGAGGAGAGTATTCCAAGGCAAACTGTGACAAT

[0196] GCGTCTTATCGCTGAGAGTTTAATGGATTGCGTGTCAAAGAAGAAAGACAGTTGGATTATAATCGAGGGCAGGGACACAA

[0197] CCGCGAAGAGGAGAGTAGCTCGTACTGTATCTGAATCTGTTTTCGGATCTTTCGAGTCTCTGGTTCATATTGACCTTAAG

[0198] AAGAAAGGAAACGAGTCAAAGGCCAGCCCGGCAACGCTACTTGCTTATGAATTGAAGAACCCTGAGAAGGTTGTGTTCTT

[0199] GATTGAAGACATTGATTTGGCAGATTCCCGCTTCTTGAAACTCCTTGCTGATCGGTTTGAGGACAAACGGAGGATTAAAA

[0200] CCGGTATCGATCATCGCCAAGCCATCTTTATTTTGACAAAGGAGGATTCAAGGAATGTGAGAAACAGAGACTCTGTTTTG

[0201] CAAATTGGTTTGGAGATCACGGCACAGAGTCCAGGAAAAAGAGAAAACCCGAATCGGATTTATCGATCGAGAATGGGGTT

[0202] TTGGATGAAGAAGGAAGTGTGCTCTAGGCAATCGAGTTTCAATAGCTCTTACCTCGACCTGAACATAAAAGCTGAAGACG

[0203] AAGAAGTAGAAGGTGAGATCAGTCCAATTTCAAGCGATTTAACAGGAGAGGGAGAGACAGAGTTCTCCTCTTCCAAGCAAC

[0204] TTTCTAAACCGGATTCAAAACCGGTTTGTCCTAAACAGGTCATGTGAACCAGGTATCGAAAAAGGTATGATAACAGCAGC

[0205] TTTCAGGGAGATTTTTCCTGAGAGGGAAGAAGGAGGCGGAGTTAGGTTTAGCGTGGAGGACAAGTTAGTAGGGAGCTTT

[0206] ACGGGATTCAAAACGGTGCGTTTGAAAGATGGTTAAAGGAGGTTTTTCAAACGGGGTTACTAACGGTTAAAAAGGGAGGG

[0207] AAAAAGGATACGGGTGTAATTAGGATGGTGTTTGGGGGTATAGTTGACAACAAAGGATATGGTGGGGGTGTTGGTGGGTA

[0208] CATGGCTACATTTCTTCCGAACAAAGTCCAAGTTTCCAAGTTCGAGTAGTAGAATCTTTCGGTTAAATTTCTTTTGTTTC

[0209] TTTTTCTTTCGTTCTTTCTTTTTCAATATGTAAAATTTCCATTACTAATGTGGGGGTTTGACTGGTGTAACTCTTTTCTT

[0210] CTTCGAATGTAATATAAATGCGTTTTAAATTTGGGAAAATATTTTTATTAGGATTATGTAAGAAAAATAACATCTTGCAT

[0211] GGATGCTGTTAATGACTATGGTAATGGAA

[0212] Example 4 Analysis of the thermal acclimation phenotype of SMXL4 and SMXL5

[0213] like Figure 6 As shown, the smxl4, smxl5 single mutants and smxl4smxl5 double mutants were heat acclimated and then subjected to lethal high temperature treatment. It was found that the simultaneous functional loss of SMXL4 / 5 after heat acclimation can significantly prolong the duration of heat resistance acquired by the plants. Although there was no significant difference in basal heat resistance when SMXL4 and SMXL5 were individually lost, after prolonging the time to acquire heat resistance, the smxl5 single mutant phenotype showed a higher survival rate than the wild type, but it was still lower than the simultaneous functional loss of SMXL4 / 5.

[0214] Example 5 Analysis of HSFA2 expression after heat treatment of various materials

[0215] As a key regulatory factor for plant heat tolerance, HSFA2 is responsible for activating a series of HSR genes, thereby regulating the plant's response to high temperature stress. Figure 7As shown in the figure, the expression of HSFA2 is induced by heat treatment, and the expression of HSFA2 in the heat-resistant materials ski2dcl4 and smxl4smxl5 mutants is significantly higher than that in the heat-intolerant materials. After heat acclimation, the expression of HSFA2 in smxl4smxl5 is only slightly higher than that in the wild type, but one day after the heat treatment is removed, its expression can still be maintained at a high level, and the protein level is also much higher than that in the wild type, indicating that the high expression of HSFA2 mRNA and protein is likely to be the reason for the high temperature tolerance of smxl4smxl5.

[0216] Example 6 Analysis of the effect of high temperature treatment on the production of abnormal RNA and siRNA of SMXL4 / 5

[0217] High temperature can inhibit the overall translation level of plants and produce RNA fragments without cap structures. Figure 8 As shown, by detecting the uncapped transcripts from SMXL4 / 5 before and after heat treatment by 5'RACE, the present invention found that before heat acclimation, the plant basically accumulated a very small amount of abnormal transcripts from SMXL4 / 5. As heat acclimation proceeded, SMXL4 / 5 began to accumulate abnormal transcripts and reached a maximum value at the early stage of recovery. These abnormal transcripts may serve as substrates for PTGS to produce 22nt siRNA. The results of small RNA sequencing showed that although 21nt, 22nt and 24nt SMXL4 / 5-derived siRNAs were accumulated on the positive strand, only 21nt and 22nt siRNAs from SMXL5 were significantly accumulated on the antisense strand. In addition, 21nt siRNAs were mainly accumulated during heat acclimation, and 22nt siRNAs were mainly accumulated at the early stage of recovery. These 22nt siRNAs from SMXL5 may target SMXL4 as primary small RNAs in the background of ski2dcl4, thereby causing the production of secondary small RNAs at the SMXL4 / 5 site.

[0218] Based on the above embodiments, the present invention proposes two methods for improving the high temperature adaptability of plants:

[0219] (1) Simultaneously inhibit the function of RNA degradation pathway factors and DCL4, and increase the abundance of 22nt siRNA at the SMXL4 and SMXL5 sites.

[0220] (2) By designing RNAi double-stranded RNA or sgRNA, SMXL4 and SMXL5 are specifically targeted to inhibit the function of SMXL4 / 5 and relieve the inhibitory effect on HSFA2, thereby activating the plant's high temperature stress response and improving the plant's high temperature adaptability.

[0221] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0222] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. An isolated nucleic acid, characterized in that The invention comprises a SMXL3 / SMXL4 gene double mutant, a SMXL3 / SMXL5 gene double mutant or a SMXL4 / SMXL5 gene double mutant. The mutations in the SMXL3 / SMXL4 gene double mutant, the SMXL3 / SMXL5 gene double mutant and the SMXL4 / SMXL5 gene double mutant all comprise loss-of-function mutations or function-inhibitory mutations. The SMXL3, SMXL4 and SMXL5 genes involved in the SMXL3 / SMXL4 gene double mutant, the SMXL3 / SMXL5 gene double mutant and the SMXL4 / SMXL5 gene double mutant are derived from plants.

2. The nucleic acid according to claim 1, characterized in that The plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla.

3. The nucleic acid according to claim 1, characterized in that The plant is Arabidopsis thaliana, and the plant with loss-of-function mutation or function-inhibition mutation satisfies any one of the following conditions (1) to (3): (1) The loss-of-function mutant or function-inhibiting mutant plant lacks or inhibits the function of RNA degradation pathway factors (EIN5 or SKI2) and DCL4 protein; (2) the loss-of-function mutant or the function-inhibiting mutant plant has a gene mutation in at least two of the SMXL3, SMXL4 and SMXL5 genes, resulting in the inhibition or loss of the function of the corresponding gene; (3) The loss-of-function mutant or the function-inhibiting mutant plant produces a large amount of 22nt siRNA at the SMXL4 and SMXL5 gene sites.

4. An isolated protein, characterized in that It comprises at least two of the SMXL3 protein mutant, SMXL4 protein mutant and SMXL5 protein mutant with loss of function, wherein the SMXL3 protein mutant, the SMXL4 protein mutant and the SMXL5 protein mutant are encoded by the nucleic acid according to any one of claims 1 and 2.

5. A nucleic acid construct, characterized in that Containing the nucleic acid according to any one of claims 1 to 3.

6. The nucleic acid construct according to claim 5, characterized in that The nucleic acid construct is a cloning vector or an expression vector.

7. A plant cell, tissue or organ, characterized in that Satisfies at least one of the following characteristics (1) to (5): (1) A genome comprising the nucleic acid according to any one of claims 1 to 3; (2) expressing the protein described in claim 4; (3) at least two genes among SMXL3, SMXL4 and SMXL5 are inhibited from being expressed, deleted or replaced, resulting in the inhibition of expression or loss of function of at least two genes among SMXL3, SMXL4 and SMXL5; (4) A large amount of 22nt siRNA is produced at the SMXL4 and SMXL5 gene loci, resulting in the inhibition of SMXL4 and SMXL5 expression or loss of function; (5) The loss or inhibition of RNA degradation pathway factors (EIN5 or SKI2) and DCL4 function leads to the production of a large amount of 22nt siRNA at the SMXL4 and SMXL5 gene loci.

8. A method for inhibiting the expression and function of SMXL4 and SMXL5 genes, characterized in that: The method comprises: (1) Providing a nucleic acid delivery medium material carrying factors related to the inhibition of RNA degradation pathway and DCL4 function; (2) contacting the plant cells, tissues or organs with the nucleic acid delivery medium in step (1), so that the nucleic acid contained in the expression vector is transferred into the plant cells and the nucleic acid delivery medium plays the function of inhibiting the expression of genes related to the RNA degradation pathway and DCL4; (3) using the plant cells or tissues / organs contacted with the nucleic acid delivery medium in step (2) to produce new plant materials, and screening the new plant materials in which RNA degradation pathway-related factors or DCL4 function are inhibited; (4) The newly grown plant materials are further cultured into plants and hybridized to obtain plants in which the RNA degradation pathway-related factors and DCL4 functions are simultaneously inhibited, thereby obtaining transgenic plants in which 22nt siRNA is significantly accumulated at the SMXL4 and SMXL5 sites.

9. Use of the transgenic plant prepared according to the method of claim 8 in regulating plant growth and development and plant stress response.

10. Use of an agent for inhibiting the expression level of plant RNA degradation pathway-related genes and DCL4 gene and / or an agent for inhibiting the activity of plant RNA degradation pathway-related proteins and DCL4 protein in the preparation of a formulation for regulating the 22nt siRNA content at the SMXL4 and SMXL5 loci and / or stress response in plants.

11. The use according to claim 10, characterized in that The preparation for inhibiting the expression and protein activity of proteins related to the plant RNA degradation pathway and DCL4 includes chemical inhibitors that change the activity of proteins related to the RNA degradation pathway and DCL4 protein; and / or the preparation for inducing plant PTGS includes at least one of an RNAi vector or CRISPR vector that inhibits RNA 5'-3' degradation or 3'-5' degradation, and a chemical agonist that inhibits DCL4 expression and activates DCL2 expression.

12. A method for preparing a plant that induces significant accumulation of 22nt siRNA derived from SMXL4 and SMXL5 loci, comprising inhibiting the functions of RNA degradation pathway-related factors and DCL4 to prepare a plant with increased content of 22nt siRNA from SMXL4 and SMXL5 loci.

13. The method according to claim 12, characterized in that Inhibit the expression and protein function of RNA degradation pathway-related factors and DCL4 in plants, including: Use chemical inhibitors that change the activity of RNA degradation pathway-related proteins and DCL4 proteins, such as cycloheximide (CHX); and / or design RNAi double-stranded RNA for RNA degradation pathway-related factors and DCL4, and express them in the wild type; and / or design specific single-stranded guide RNA (sgRNA) for RNA degradation pathway-related factors and DCL4, and express CRISPR vectors containing sgRNA in plants; and / or use chemical agonists that inhibit DCL4 expression and activate DCL2 expression.

14. The use according to claim 10 or 11, or the method according to any one of claims 12 to 13, characterized in that: The controlled endogenous 22nt siRNA is selected from the following groups: seed germination, tissue and organ growth, flowering, fruit ripening, organ senescence, leaf abscission, bud abscission, shoot abscission, pod abscission, fruit abscission, biological stress response to at least one of insects, bacteria, fungi, and viruses, and non-biological stress response to at least one of planting density, heat, low temperature, drought, waterlogging, and saline-alkali stress.

15. The plant cell, tissue or organ according to claim 8, the use according to claim 10 or 11, or the method according to any one of claims 12 to 13, characterized in that: The plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens and Marchantia polyphylla.

Images