Primer group and method for detecting miRNA through one-pot real-time fluorescent quantitative PCR (polymerase chain reaction)

Abstract

The invention provides a primer group and a method for detecting miRNA (micro Ribonucleic Acid) through one-pot real-time fluorescent quantitative PCR (Polymerase Chain Reaction), the primer group comprises a specific stem-loop primer LP, a specific Linker primer, a universal upstream primer F, a universal downstream primer R and a specific probe P, and the amplification specificity can be ensured; all reagents required by reaction are added into a reaction system at one time, and the experimental process is simple and easy to operate; the reverse transcription process and the qPCR process are carried out in one reaction tube, so that the repeated uncovering process is avoided, the pollution risk is reduced, and the personal error is reduced; the whole reaction time is greatly shortened compared with that of two-step fluorescent quantitative PCR, and the experiment time is saved; due to the design of the universal upstream primer and the universal downstream primer, multiple amplification of miRNA becomes possible.

Description

Technical Field

[0001] The invention belongs to the technical field of miRNA detection, and relates to a primer set and a method for detecting miRNA by one-pot real-time fluorescence quantitative PCR. Background Art

[0002] microRNA (micro RNA) is a type of endogenous non-coding small molecule single-stranded RNA with a length of about 20-23 nucleotides (nt). It is highly conserved in the evolutionary process and can cause the degradation of target gene mRNA or inhibit its translation through specific base complementary pairing with target gene mRNA, thus negatively regulating the expression of target genes extensively. Since its discovery in 1993, tens of thousands of miRNAs have been found in humans, animals, plants and viruses. MiRNAs are not only found in tissue cells, but also widely exist in body fluids, including serum, plasma, urine, etc., in the form of free miRNAs or miRNAs encapsulated in intracellular vesicles. Abnormal expression of miRNA will lead to physiological abnormalities and the occurrence of diseases. Therefore, in-depth research on the quantitative detection method of miRNA in tissue or cell samples will help people further understand the relationship between miRNA and the occurrence and development of diseases, and provide new ideas for the early diagnosis of diseases.

[0003] Mature miRNA fragments are small, usually only 20-23 nt, without poly (A) tails, and family members usually differ by only one or two bases, and the expression level in cells is generally low. These characteristics have brought difficulties and challenges to the establishment of miRNA quantitative detection methods. Despite this, scientists have developed a variety of miRNA detection methods, such as Northern blotting, microarray, sequencing, real-time fluorescence quantitative PCR, etc.

[0004] At present, the most mature and widely used technology for miRNA quantification is real-time fluorescence quantitative PCR technology. The so-called real-time fluorescence quantitative PCR is to achieve quantitative and qualitative analysis of the starting template through real-time detection of the fluorescence signal of each cycle product in the PCR amplification reaction. In the real-time fluorescence quantitative PCR reaction, a fluorescent chemical substance is introduced. As the PCR reaction proceeds, the PCR reaction products continue to accumulate, and the fluorescence signal intensity also increases proportionally. After each cycle, a fluorescence intensity signal is collected, so that the change in product quantity can be monitored by the change in fluorescence intensity, thereby obtaining a fluorescence amplification curve.

[0005] Because miRNA sequences are short and cannot be directly used for qPCR reactions, they are usually extended while reverse-transcribed. The current methods for identifying and synthesizing the first chain of miRNA require reverse transcription of microRNA to obtain extended cDNA, and then qPCR quantification. The process is cumbersome and time-consuming, increasing the workload of the experimenter, and the lid is opened many times during the experiment, increasing the risk of experimental contamination. Summary of the invention

[0006] In view of the above technical problems, the present invention provides a primer set and method for detecting miRNA by one-pot real-time fluorescence quantitative PCR, which has a simple operation process and high specificity.

[0007] The technical solution adopted by the present invention to achieve the technical purpose is: The present invention provides a primer set for detecting miRNA by one-pot real-time fluorescence quantitative PCR, comprising a specific stem-loop primer LP, a specific linker primer, a universal upstream primer F, a universal downstream primer R and a specific probe P, wherein: The specific stem-loop primer LP is a stem-loop structure, one part of which is a non-specific universal sequence, and the other part is a specific sequence that is complementary to the 3' end of the target miRNA sequence, and the length is 10-12 bp; The specific Linker primer has a part that is a non-specific universal sequence and a part that is a specific sequence that is consistent with the 5' end of the target miRNA sequence, and has a length of 10 to 12 bp; The universal upstream primer F and the universal downstream primer R are respectively derived from the universal sequence parts on the specific Linker primer and the specific stem-loop primer LP; The specific probe P is a modified probe with a length of 13-18 bp, a fluorescent group modified at the 5' end, and a quenching group modified at the 3' end.

[0008] Preferably, the 3' end of the specific Linker primer may be unmodified, or may be phosphorylated or C3Spacer modified to improve the specificity of amplification of mature miRNA and precursor miRNA.

[0009] Preferably, the 5' end of the specific probe P is modified with CY5, and the 3' end is modified with MGB.

[0010] Preferably, certain bases in the specific probe P can also be modified by LNA as needed, and the four bases A / G / C / T can be modified, which can not only meet the experimental needs but also improve the reaction specificity. Regardless of which modification is selected, the Tm value of the specific probe P should be designed to be 65-75°C, more preferably about 70°C.

[0011] The present invention also provides a one-pot real-time fluorescence quantitative PCR method for detecting miRNA, which is implemented by the above primer set and includes: 1) Reverse transcription of the specific stem-loop primer LP and the target miRNA under the action of reverse transcriptase to obtain the first strand of cDNA, and then inactivate the reverse transcriptase and activate the hot start Taq enzyme; 2) The specific linker primer and the first strand of cDNA obtained in step 1) are specifically bound at 35-50°C, and then the hot-start Taq enzyme is used to extend the cDNA at 50-72°C to obtain double-stranded DNA; 3) The universal upstream primer F, universal downstream primer R, specific probe P and double-stranded DNA obtained in step 2) are subjected to amplification reaction under the action of hot-start Taq enzyme, and real-time fluorescence signal collection is performed. By analyzing the signal, a fluorescence amplification curve is obtained, and finally the quantification of miRNA is completed.

[0012] Preferably, in step 1), the reverse transcription temperature is 42-50° C. and the time is 5-30 min.

[0013] Preferably, in step 1), the reverse transcriptase is inactivated and the hot start Taq enzyme is activated at 95° C. for 30 s to 5 min.

[0014] Preferably, in step 2), if the specific linker primer is phosphorylated at the 3' end or C3 spacer modified, a further lengthened ssDNA is obtained.

[0015] Preferably, in step 3), the amplification reaction is carried out under the conditions of 95° C. for 5-15 s, 56-62° C. for 30 s-1 min, and 40-50 cycles.

[0016] The beneficial effects of the present invention are: The specially designed primer set of the present invention includes a specific stem-loop primer LP, a specific linker primer, a universal upstream primer F, a universal downstream primer R and a specific probe P, which can ensure the specificity of amplification; all reagents required for the reaction are added to the reaction system at one time, and the experimental process is simple and easy to operate; the reverse transcription and qPCR processes are carried out in one reaction tube, avoiding the repeated opening process, reducing the risk of contamination, and reducing human errors; the entire reaction time is greatly shortened compared to the two-step fluorescent quantitative PCR, saving experimental time; the design of the universal upstream primer and the universal downstream primer makes the multiple amplification of miRNA possible. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The figure is an overall flow chart of the method of the present invention.

[0018] Figure 2This is the amplification reaction curve of Example 1 of the present invention.

[0019] Figure 3 This is the amplification reaction curve of Example 2 of the present invention.

[0020] Figure 4 This is the amplification reaction curve of Example 3 of the present invention.

[0021] Figure 5 This is the amplification sensitivity test result of Test Example 1 of the present invention.

[0022] Figure 6 This is the amplification specificity detection result of Test Example 2 of the present invention.

[0023] Figure 7 This is the multiple amplification curve of Test Example 3 of the present invention.

[0024] Figure 8 This is the multiple detection result of the application example of the present invention. DETAILED DESCRIPTION

[0025] In order to explain the present invention more clearly, the present invention is further described in detail below in conjunction with embodiments and with reference to the accompanying drawings. It should be understood by those skilled in the art that the content described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0026] Example 1: miRNA one-pot amplification of hsa-miR-29c-3p standard The hsa-miR-29c-3p standard was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: UAGCACCAUUUGAAAUCGGUUA, and the synthesized hsa-miR-29c-3p standard was diluted to 10 using TE buffer. 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL.

[0027] The hsa-miR-29c-3p one-pot detection primer probe sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: Table 1 Primer and probe sequences for one-pot detection of hsa-miR-29c-3p

[0028] The synthesized primer probe is in dry powder state. After centrifugation at 12000rpm for 5min, add the corresponding volume of TE buffer according to the synthesis report, vortex mix and let stand at room temperature for 10min. Vortex mix again for 5min. After instantaneous centrifugation, it will be 100μM primer probe mother solution. Pipette 10μL of primer probe solution into 1.5mL centrifuge tubes, add 90μTE buffer, vortex mix thoroughly and centrifuge to get 10μM solution, and place at -20℃ for use.

[0029] Preparation of reaction system: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.2 μL 10 μM MiR-29c-3p-LP primer (final concentration 0.1 μM), 0.2 μL 10 μM MiR-29c-3p-Linker primer (final concentration 0.1 μM), 1 μL 10 μM OSPrimerF (final concentration 0.5 μM), 1 μL 10 μM OSPrimerR (final concentration 0.5 μM), 0.2 μL 10 μM MiR-29c-3p-P (final concentration 0.1 μM), add 5 μL of the above-mentioned diluted Hsa-miR-29c-3p standard respectively, and make up the volume to 20 μL with DEPC water.

[0030] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0031] Experimental results: After the reaction, the standard curve was constructed by Ct value and the amplification efficiency was calculated. The results showed that R2 was 0.9996 and the amplification efficiency was 96.63%. Figure 2 As shown, it was demonstrated that the miRNA one-pot method can amplify the hsa-miR-29c-3p standard well.

[0032] Example 2: One-pot amplification of hsa-let-7f-5p standard by miRNA The hsa-let-7f-5p standard was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: UGAGGUAGUAGAUUGUAUAGUU; the synthesized hsa-let-7f-5p standard was diluted to 10 using TE buffer. 8 copies / μL, 10 7 copies / μL, 10 6copies / μL, 10 5 copies / μL.

[0033] The hsa-let-7f-5p one-pot detection primer probe sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: Table 2 Primer and probe sequences for one-pot detection of hsa-let-7f-5p

[0034] The synthesized primer probe is in dry powder state. After centrifugation at 12000rpm for 5min, add the corresponding volume of TE buffer according to the synthesis report, vortex mix and let stand at room temperature for 10min. Vortex mix again for 5min. After instantaneous centrifugation, it will be 100μM primer probe mother solution. Pipette 10μL of primer probe solution into 1.5mL centrifuge tubes, add 90μTE buffer, vortex mix thoroughly and centrifuge to get 10μM solution, and place at -20℃ for use.

[0035] Preparation of reaction system: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.2 μL 10 μM Let-7f-5p-LP (final concentration 0.1 μM), 0.2 μL 10 μM Let-7f-5p-Linker (final concentration 0.1 μM), 1 μL 10 μM OSPrimerF (final concentration 0.5 μM), 1 μL 10 μM OSPrimerR (final concentration 0.5 μM), 0.2 μL 10 μM Let-7f-5p-P (final concentration 0.1 μM), add 5 μL of the above-diluted has-let-7f-5p standard respectively, and make up the volume to 20 μL with DEPC water.

[0036] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0037] Experimental results: After the reaction, the standard curve was constructed by Ct value and the amplification efficiency was calculated. The results showed that R 2 is 0.9981, and the amplification efficiency is 93.45%. Figure 3 As shown, it is shown that the miRNA one-pot method can amplify the hsa-let-7f-5p standard well.

[0038] Example 3: miRNA one-pot amplification of hsa-miR-92a-3p standard The hsa-miR-92a-3p standard was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: UAUUGCACUUGUCCCGGCCUGU. The synthesized hsa-miR-92a-3p standard was diluted to 10 using TE buffer. 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL.

[0039] The hsa-miR-92a-3p one-pot detection primer probe sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequence is as follows: Table 3 Primer and probe sequences for one-pot detection of hsa-miR-92a-3p

[0040] The synthesized primer probe is in dry powder state. After centrifugation at 12000rpm for 5min, add the corresponding volume of TE buffer according to the synthesis report, vortex mix and let stand at room temperature for 10min. Vortex mix again for 5min. After instantaneous centrifugation, it will be 100μM primer probe mother solution. Pipette 10μL of primer probe solution into 1.5mL centrifuge tubes, add 90μTE buffer, vortex mix thoroughly and centrifuge to get 10μM solution, and place at -20℃ for use.

[0041] Reaction system preparation: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.2 μL 10 μM MiR-92a-3p-LP primer (final concentration 0.1 μM), 0.2 μL 10 μM MiR-92a-3p-Linker primer (final concentration 0.1 μM), 1 μL 10 μM OSPrimerF (final concentration 0.5 μM), 1 μL 10 μM OSPrimerR (final concentration 0.5 μM), 0.2 μL 10 μM MiR-92a-3p-P (final concentration 0.1 μM), add 5 μL of the above-mentioned diluted hsa-miR-92a-3p standard respectively, and make up the volume to 20 μL with DEPC water.

[0042] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0043] Experimental results: After the reaction, the standard curve was constructed by Ct value and the amplification efficiency was calculated. The results showed that R2 was 0.9994 and the amplification efficiency was 100.33%. Figure 4 As shown, it was demonstrated that the miRNA one-pot method can amplify the hsa-miR-92a-3p standard well.

[0044] Test Example 1: One-pot amplification sensitivity test of hsa-let-7f-5p The synthetic hsa-let-7f-5p standard was diluted to 10 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 2 copies / μL.

[0045] The has primer probe used was the primer probe prepared in Example 2.

[0046] Preparation of reaction system: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.2 μL 10 μM Let-7f-5p-LP (final concentration 0.1 μM), 0.2 μL 10 μM Let-7f-5p-Linker (final concentration 0.1 μM), 1 μL 10 μM OSPrimerF (final concentration 0.5 μM), 1 μL 10 μM OSPrimerR (final concentration 0.5 μM), 0.2 μL 10 μM Let-7f-5p-P (final concentration 0.1 μM), add 5 μL of the above-mentioned diluted hsa-let-7f-5p standard respectively, and make up the volume to 20 μL with DEPC water.

[0047] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0048] Experimental results: After the reaction, the linear range of hsa-let-7f-5p one-pot amplification was determined to be 10 9 copies / μL-10 3 copies / μL, the sensitivity can reach 10 copies / μL, such as Figure 5 shown.

[0049] Test Example 2: One-pot amplification specificity detection of hsa-let-7f-5p The hsa-let-7f-5p and hsa-let-7i-5p standards were synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific sequences are as follows: hsa-let-7f-5p: UGAGGUAGUAGAUUGUAUAGUU (SEQ ID NO. 12); hsa-let-7i-5p:UGAGGUAGUAGUUUGUGCUGUU (SEQ ID NO.13); Dilute the synthetic hsa-let-7f-5p standard and hsa-let-7i-5p standard to 10% using TE buffer. 6 copies / μL.

[0050] The primer probe used was the primer probe prepared in Example 2.

[0051] Reaction system preparation: 4μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1μL reverse transcriptase mixture (Suzhou Mairuike), 2μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.2μL 10μM Let-7f-5p-LP (final concentration 0.1μM), 0.2μL 10μM Let-7f-5p-Linker (final concentration 0.1μM), 1μL 10μM OSPrimerF (final concentration 0.5μM), 1μL 10μM OSPrimerR (final concentration 0.5μM), 0.2μL 10μM Let-7f-5p-P (final concentration 0.1 μM), add 5 μL of the above-diluted hsa-let-7f-5p standard (10^7 copies / μL) and hsa-let-7i-5p (10^7 copies / μL), and make up the volume to 20 μL with DEPC water.

[0052] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0053] Experimental results: The sequences of hsa-let-7f-5p and hsa-let-7i-5p differ by 4 bases, but the Ct value of hsa-let-7f-5p detection (12.76) differs by 19.13 from the Ct value of hsa-let-7i-5p sequence detection (31.89) at the same concentration, indicating that the hsa-let-7i-5p sequence has no interference with the detection of hsa-let-7f-5p and can specifically detect the hsa-let-7f-5p sequence. Figure 6 shown.

[0054] Test Example 3: One-pot multiplex amplification of miRNA According to Example 1, Example 2, and Example 3, the hsa-miR-29c-3p standard, the hsa-let-7f-5p standard, and the hsa-miR-92a-3p standard were diluted to 10 7 copies / μL and mixed together as a sample.

[0055] Reaction system preparation: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.1 μL 10 μM MiR-29c-3p-LP (final concentration 0.05 μM), 0.1 μL 10 μM MiR-29c-3p-Linker (final concentration 0.05 μM), 0.2 μL 10 μM MiR-29c-3p-P (final concentration 0.1 μM, FAM fluorescence); 0.1 μL 10 μM Let-7f-5p-LP (final concentration 0.05 μM), 0.1 μL 10 μM Let-7f-5p-Linker (final concentration 0.05 μM), 0.2 μL 10 μM Let-7f-5p-P (final concentration 0.1μM, ROX fluorescence); 0.1μL of 10μM MiR-92a-3p-LP (final concentration 0.05μM), 0.1μL of 10μM MiR-92a-3p-Linker (final concentration 0.05μM), 0.2μL of 10μM MiR-92a-3p-P (final concentration 0.1μM, CY5 fluorescence); 1μL of 10μM OSPrimerF (final concentration 0.5μM), 1μL of 10μM OSPrimerR (final concentration 0.5μM), add 5μL of the above diluted standard mixture, and make up the volume to 20μL with DEPC water.

[0056] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0057] Experimental results: Through the analysis of amplification curves and Ct values, the miRNA one-pot amplification method of the present invention can perform good multiple amplification of miRNA, such as Figure 7 shown.

[0058] Application example: miRNA one-pot method for multiplex detection of clinical serum samples Human serum / plasma miRNA nucleic acid extraction and purification kit (column extraction method) (Suzhou Miruike) was used to extract miRNA from normal human serum samples. The specific extraction steps are as follows: 1) Take a 1.5 mL RNase-free centrifuge tube; 2) Take out a serum sample from the -80℃ refrigerator, wait for it to completely melt, vortex thoroughly to mix, centrifuge for 10 seconds, and then pipette 100μL of serum into the corresponding 1.5mL centrifuge tube; 3) Add 200 μL of lysis buffer and 10 μL of proteinase K to a 1.5 mL centrifuge tube, vortex thoroughly to mix, and centrifuge briefly for 10 seconds; 4) Incubate in a metal bath at 65°C for 10 min, then take out and cool to room temperature; 5) Add 600 μL of anhydrous ethanol to each cooled 1.5 mL centrifuge tube, vortex thoroughly to mix, and centrifuge briefly; 6) Take one extraction column, pipette 650 μL of the mixed solution in the 1.5 mL centrifuge tube and add it to the extraction column with the corresponding number, centrifuge at 12,000 rpm for 1 min, and discard the filtrate; 7) Place the elution column back into the collection tube and repeat step 6) to pass all the sample mixture through the extraction column and discard the filtrate; 8) Put the elution column back into the collection tube, add 500 μL of washing solution 1, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate; 9) Place the elution column back into the collection tube, add 500 µL of wash solution 2, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate; 10) Repeat step 9) once; 11) Place the elution column back into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove the remaining liquid; 12) Place the elution column in a new 1.5 mL centrifuge tube, add 60 µL of elution buffer to the center of the elution column, and place at room temperature for 2 minutes; 13) Centrifuge at 12,000 rpm for 1 min, discard the elution column, collect the filtrate at the bottom of the centrifuge tube as the extracted sample, and store it at -80℃ for later use.

[0059] Reaction system preparation: 4 μL 5×miRNA RT Mix (Suzhou Mairuike) (final concentration 1×), 1 μL reverse transcriptase mixture (Suzhou Mairuike), 2 μL 10×miRNA qPCR Master Mix (Suzhou Mairuike) (final concentration 1×), 0.1 μL 10 μM MiR-29c-3p-LP (final concentration 0.05 μM), 0.1 μL 10 μM MiR-29c-3p-Linker (final concentration 0.05 μM), 0.2 μL 10 μM MiR-29c-3p-P (final concentration 0.1 μM, FAM fluorescence); 0.1 μL 10 μM Let-7f-5p-LP (final concentration 0.05 μM), 0.1 μL 10 μM Let-7f-5p-Linker (final concentration 0.05 μM), 0.2 μL 10 μM Let-7f-5p-P (final concentration 0.1μM, ROX fluorescence); 0.1μL of 10μM MiR-92a-3p-LP (final concentration 0.05μM), 0.1μL of 10μM MiR-92a-3p-Linker (final concentration 0.05μM), 0.2μL of 10μM MiR-92a-3p-P (final concentration 0.1μM, CY5 fluorescence); 1μL of 10μM OSPrimerF (final concentration 0.5μM), 1μL of 10μM OSPrimerR (final concentration 0.5μM), add 5μL of the above diluted standard mixture, and make up the volume to 20μL with DEPC water.

[0060] After vortex mixing and centrifugation, the reaction was carried out on an ABI Step One Plus fluorescent quantitative PCR instrument. The reaction program was as follows: 50°C for 10 min, 95°C for 3 min; 37°C for 30 s, 72°C for 30 s; 95°C for 10 s, 58°C for 30 s, and 40 cycles.

[0061] Experimental results: Through the analysis of amplification curves and Ct values, the miRNA one-pot amplification method of the present invention can perform good multiple amplification of serum sample miRNA, such as Figure 8 shown.

[0062] Obviously, the above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention.

Claims

1. A method for detecting miRNA by one-pot real-time fluorescence quantitative PCR, characterized in that: The detection of miRNA by a primer set using one-pot real-time fluorescence quantitative PCR is achieved, wherein the primer set includes a specific stem-loop primer LP, a specific linker primer, a universal upstream primer F, a universal downstream primer R and a specific probe P, wherein: the specific stem-loop primer LP is a stem-loop structure, a part of which is a non-specific universal sequence, and a part of which is a specific sequence complementary to the 3' end of the target miRNA sequence, and the length is 10-12 bp; the specific linker primer, a part of which is a non-specific universal sequence, and a part of which is a specific sequence consistent with the 5' end of the target miRNA sequence, and the length is 10-12 bp, and the 3' end of the specific linker primer is phosphorylated or C3 spacer modified; the universal upstream primer F and the universal downstream primer R are derived from the universal sequence parts on the specific linker primer and the specific stem-loop primer LP, respectively; the specific probe P is a modified probe, the length is 13-18 bp, the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group; the method includes: 1) The specific stem-loop primer LP and the target miRNA were reverse transcribed under the action of reverse transcriptase to obtain the first strand of cDNA, and then the reverse transcriptase was inactivated at 95°C for 3 min while the hot start Taq enzyme was activated. The reverse transcription temperature was 50°C and the time was 10 min. 2) The specific linker primer and the first strand of cDNA obtained in step 1) are specifically bound at 35-50°C, and then the cDNA is extended by hot-start Taq enzyme at 50-72°C to obtain double-stranded DNA. If the specific linker primer is phosphorylated at the 3' end or C3 spacer modified, a further extended ssDNA is obtained; 3) The universal upstream primer F, universal downstream primer R, specific probe P and double-stranded DNA obtained in step 2) are amplified under the action of hot-start Taq enzyme at 95°C for 10s, 58°C for 30s, and 40 cycles, and real-time fluorescence signal acquisition is performed. By analyzing the signal, a fluorescence amplification curve is obtained, and finally the quantification of miRNA is completed.

Images