Double microRNA AND logic gate detection platform and method based on allosteric strategy engineering DNAzyme

Abstract

The invention discloses a double-microRNA AND logic gate detection platform and method based on allosteric strategy engineering DNAzyme. The detection platform is composed of a DNA tetrahedron, wherein the DNA tetrahedron is composed of an E6 DNAzyme chain, two locking chains, a report hairpin probe and four oligonucleotide chains S1-S4; detecting the complementary hybridization of the first two locking chains and the E6 DNAzyme chain, so that the first two locking chains lose the cleavage activity; during detection, the two locking chains are combined with a target miRNA to be detected in a sample, so that the E6 DNAzyme chain recovers the cleavage activity, the cleavage report hairpin probe releases a fluorescence signal; the tetrahedron serving as a supporting framework improves the stability and the reaction rate of the detection platform; according to the present invention, the logic operation detection of the two microRNAs such as miR-10b and miR-155 with high breast cancer expression is achieved, and the method is more suitable for the direct detection in the biological sample.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a dual microRNA AND logic gate detection platform and method based on an allosteric strategy engineered DNAzyme. Background Art

[0002] MicroRNAs (miRNAs) are a class of small non-coding RNAs that are widely involved in regulating gene expression and are closely related to the occurrence and progression of diseases. Studies have shown that early detection of microRNAs can help improve the early diagnosis rate of tumors and improve patient prognosis. However, due to the lack of tissue or disease specificity of microRNAs, the clinical significance of single microRNA detection is limited. Therefore, comprehensive judgment of multiple microRNA changes caused by tumor pathological processes is of great significance for improving tumor detection rates and avoiding misjudgment and missed diagnosis. Establishing a detection platform that can realize logical detection of multiple microRNAs will also be of practical significance. DNAzyme, due to its high programmability and powerful nucleic acid cleavage ability, has shown great potential in information processing and logical computing in recent years. The use of engineered DNAzyme as a logical computing element has been reported by scholars. We envision that applying the logical computing advantages of DNAzyme to the logical detection of biomarkers will help enrich the arsenal of logical detection and provide more technical reserves for the early and accurate diagnosis of tumors. This research has rarely been reported. Summary of the invention

[0003] In view of this, one of the objects of the present invention is to provide a dual microRNA AND logic gate detection platform based on an allosteric strategy engineered DNAzyme; a second object of the present invention is to provide a method for detecting miR-10b and miR-155 based on the detection platform.

[0004] In order to achieve the above object, the present invention provides the following technical solutions: A dual microRNA AND logic gate detection platform based on allosteric engineering DNAzyme The detection platform is composed of a DNA tetrahedron consisting of an E6 DNAzyme chain, two locking chains, a reporter hairpin probe and four oligonucleotide chains S1-S4; the two locking chains can respectively hybridize with the 5' end and the 3' end of the E6 DNAzyme chain to block the core catalytic sequences at both ends, thereby making it lose its cutting activity; the two locking chains can also simultaneously bind to two target miRNAs to be detected, so that the E6 DNAzyme chain can allosterically restore the active structure, and its two side arms can hybridize with the sequences on both sides of the rA site on the reporter hairpin probe, and cleave the rA site in the presence of a metal cofactor so that the reporter hairpin probe is cut and separated, releasing a fluorescent signal; the DNA tetrahedron serves as a fixed skeleton, and the E6 DNAzyme chain and the reporter hairpin probe can be fixed on the vertices of the tetrahedron, thereby improving the stability of the detection platform.

[0005] In some embodiments of the present invention, a toehold region is designed at the 5' end or the 3' end of the two locked strands.

[0006] In some embodiments of the present invention, both ends of the reporter hairpin probe are modified with a fluorescent group and a quenching group.

[0007] In some embodiments of the present invention, when the two target miRNAs to be detected are miR-10b and miR-155, the sequence of the E6DNAzyme chain is selected from one of SEQ ID No.7~11, the sequences of the two locked chains are shown in SEQ ID No.12~13, the reporter hairpin probe sequence is shown in SEQ ID No.15, and the sequences of the four oligonucleotide chains S1-S4 are shown in SEQ ID No.3~6.

[0008] In some embodiments of the present invention, the sequence of the E6 DNAzyme chain is selected from SEQ ID No.10.

[0009] The method for detecting miR-10b and miR-155 based on the detection platform is characterized by comprising the following steps: Four oligonucleotide chains S1-S4, E6 DNAzyme chain, and two locking chains were added to the buffer in an equimolar ratio, annealed, and the locked E6 DNAzyme chain was fixed on one vertex of the tetrahedron; then, after the first incubation with a reporter hairpin probe at a 3-fold corresponding molar concentration, the reporter hairpin probe was fixed on the other vertices of the tetrahedron to form a fully assembled functional tetrahedron; finally, in Mg 2+ , Mn 2+ In the presence of 5-nitro-4-nitro-2-thiocyanate, the functionalized tetrahedron was incubated with samples containing target miR-10b and miR-155 for a second time, and then fluorescence detection analysis was performed.

[0010] In some embodiments of the present invention, the concentration of the functionalized tetrahedron is 200 nM, Mg 2+ and Mn 2+ The concentration is 0.5 mM.

[0011] In some embodiments of the present invention, the buffer is HEPES 10 mM; pH=7.3; containing NaCl 150 mM.

[0012] In some embodiments of the present invention, the annealing is: 95°C for 5 min; 65°C for 30 min; 50°C for 30 min; 42°C for 30 min; 37°C for 30 min; 22°C for 30 min; and stored at 4°C.

[0013] In some embodiments of the present invention, the first incubation is incubation at 37° C. for 1 hour, and the second incubation is incubation at 37° C. for 3 hours.

[0014] The beneficial effects of the present invention are as follows: utilizing the allosteric characteristics of E6 DNAzyme, designing it as a molecular recognition element for AND logic detection, realizing the logic operation detection of microRNA-10b (miR-10b) and microRNA-155 (miR-155) which are highly expressed in breast cancer, and using DNA tetrahedron as a skeleton, fixing the E6 DNAzyme logic recognition element and the reporter hairpin probe on the vertices of the tetrahedron, and converting the random collision cutting process into "walking" in a confined space will help improve the response speed and enhance the stability and sensitivity of the detection platform. In addition, after hybridization to the tetrahedron, the higher local concentration of nucleic acid will help enhance the anti-biodegradability of the DNAzyme element and the reporter probe, thereby being more suitable for direct detection in biological samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 Schematic diagram of the reconstruction of E6 DNAzyme into a logic calculator.

[0016] Figure 2 PAGE analysis of successful E6 DNAzyme modification.

[0017] Figure 3 PAGE and AFM analysis of the tetrahedral framework (A) and functionalized tetrahedron (B).

[0018] Figure 4Optimization of experimental conditions; (A) Number of bases in the swing arm of E6 DNAzyme; (B) Concentration of functionalized tetrahedrons; (C) Reaction time; Data are expressed as mean±SD (n = 3).

[0019] Figure 5 The effect of the addition of tetrahedron on the reaction rate of the platform.

[0020] Figure 6 The effect of the addition of tetrahedrons on the signal-to-noise ratio of the platform.

[0021] Figure 7 The effect of tetrahedron addition on the degradation resistance of the platform.

[0022] Figure 8 Sensitivity analysis of the platform.

[0023] Figure 9 This is a specificity analysis of the platform. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0025] The present invention aims to utilize the allosteric characteristics of E6 DNAzyme and design it as a molecular element for AND logic detection to achieve the logic operation detection of microRNA-10b (miR-10b) and microRNA-155 (miR-155) which are highly expressed in breast cancer. The specific implementation strategy is as follows: Figure 1 The specific sequence information is shown in Figure 1 As shown in the figure, through sequence design, the sequence of E6 DNAzyme (1-2-3-4-5-6-7-4 ＊ -3 ＊ -8-9) can be used with two locking sequences (10-5 ＊ -4 ＊ -3 ＊ and 3-4-7 ＊ -11) hybridization, which results in the forced separation of its core catalytic sequences (2 and 8) and the loss of cleavage activity. ＊ ) and miR-155 (11 ＊ -7-4 ＊ ) are present at the same time, they displace the lock sequence through a toehold-mediated strand displacement reaction, and the E6 DNAzyme sequence can achieve internal hybridization (3-4 and 4 * -3 *) achieves conformational change, bringing the core sequences at both ends closer together to restore cleavage activity. In the presence of divalent metal ions, the activated E6 DNAzyme arms (1 and 9) bind to the rA site (9) on the reporter hairpin probe. * and 1 ＊ ) and the surrounding hairpin loop hybridizes to the rA site, cleaving the reporter hairpin probe to release a fluorescent signal.

[0026] It is worth noting that when only one microRNA is present, it is not enough to unlock the E6 DNAzyme. At the same time, in order to achieve more sensitive and stable output, a DNA tetrahedron is used as the skeleton. The short chain extending from one vertex of the tetrahedron can hybridize with the 5' end of the E6 DNAzyme, and the short chains extending from the remaining three vertices can hybridize with the 5' end of the reporter hairpin probe, thereby fixing the E6 DNAzyme and the reporter hairpin probe on the vertices of the tetrahedron in a ratio of 1:3. This will turn the random collision cutting process into a "walk" in a confined space, which will help improve the response speed and enhance the detection performance of the detection platform. In addition, after hybridization to the tetrahedron, the higher local concentration of nucleic acids will help enhance the anti-biodegradability of the DNAzyme element and the reporter probe, making it more suitable for direct detection in biological samples. A series of experiments proved that our invention successfully realized the AND logic detection of two microRNAs.

[0027] Table 1. DNA / RNA sequences and modifications used in the present invention Sequence Name Sequence Information (5’- 3’) hsa-miR-10b-5p UACCCUGUAGAACCGAAUUUGUG (SEQ ID No.1) hsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID No.2) S1 ACCCGCTAATGCCGCTCCATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA(SEQ ID No.3) S2 ATCCTCCGCACGCCTACCACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG(SEQ ID No.4) S3 ATCCTCCGCACGCCTACCACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID No.5) S4 ATCCTCCGCACGCCTACCACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG(SEQ ID No.6) E6 DNAzyme-25ntneck GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID No.7) E6 DNAzyme -30ntneck GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID No.8) E6 DNAzyme -35ntneck GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID No.9) E6 DNAzyme -40ntneck GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID No.10) E6 DNAzyme -45ntneck GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID No.11) Locking chain formiR-10b CACAAATTCGGTTCTACAGGGTCGTATC (SEQ ID No.12) Locking chain formiR-155 TGACGACCCCTATCACGATTAGCATTAA (SEQ ID No.13) 10-23 hairpin-13bases in stem GGTAGGCGTGCGGAGGATTCGTCCAGGTCGTGTTTTTTTTTTCTGGACGAT / rA / GGCCGCGGCCAGGCTAGCTACAACGACCTGGACGA (SEQ ID No.14) BHQ1 and FAMlabelled 10-23hairpin GGTAGGCGTGCGGAGGAT / iBHQ1dT / CGTCCAGGTCGTGTTTTTTTTTTCTGGACGAT / rA / GGCCGCGGCCAGGCTAGCTACAACGACCTGGACGA / FAM / (SEQ ID No.15) miR-155 SM UUAAUGCUAAUGGUGAUAGGGGUU (SEQ ID No.16)(The mutant position is italicized andbolded) miR-10b DM UACCCUGUAGGACCAAAUUUGUG (SEQ ID No.17)(The mutant position is italicized andbolded) miR-155 TM UUAAUGCAAAUGGUGAUCGGGGUU (SEQ ID No.18)(The mutant position is italicized and bolded) miR-21 UAGCUUAUCAGACUGAUGUUGA (SEQ ID No.19) let-7a UGAGGUAGUAGGUUGUAUAGUU (SEQ ID No.20) Note: All DNA and RNA oligonucleotides in the present invention were synthesized by Takara Biotech (Dalian) Co., Ltd. and Shanghai Shenggong Biotech Co., Ltd. and purified by HPLC.

[0028] Example 1. Functional verification of the E6 DNAzyme logic operator based on the allosteric strategy The designed E6 DNAzyme element (SEQ ID No.10) and miR-10b locker (SEQ ID No.12), miR-155 locker (SEQ ID No.13) (ratio of 1:1:1, final concentration of 500nM) were added to the annealing buffer (HEPES 10mM; pH=7.3; containing NaCl 150mM), and the reaction was carried out at 95℃ for 5min; 65℃ for 30min; 50℃ for 30min; 42℃ for 30min; 37℃ for 30min; 22℃ for 30min to fully block the E6 DNAzyme element, and then the reporter hairpin (non-labeled hairpin 500nM, SEQ ID No.14), mimic target miR-10b (SEQ ID No.1, 100nM), mimic target miR-155 (SEQ ID No.2, 100nM) and the corresponding divalent metal ions were added to make Mg 2+ The concentration reached 0.5mM, Mn 2+ The concentration reached 0.5 mM, incubated at 37°C for 2 hours, and then PAGE analysis was performed. The change in fluorescence intensity was detected after the reaction of adding the labeled reporter hairpin.

[0029] The results are as follows Figure 2 As shown, lanes 6-9 of PAGE showed that E6 DNAzyme could be activated only when miR-10b and miR-155 were present at the same time, while E6 DNAzyme could not be activated when one of the miRs was present or neither of them was present. That is, the AND logic element based on E6 DNAzyme was successfully established.

[0030] Example 2. Synthesis of detection platform The seven chains of S1~S4 (SEQ ID No.3~6), E6 DNAzyme chain (SEQ ID No.10), miR-10b locker, and miR-155 locker were mixed in buffer (HEPES 10mM; pH=7.3; containing 150mM NaCl) with equal molar concentrations, and incubated at 95℃ for 5min; 65℃ for 30min; 50℃ for 30min; 42℃ for 30min; 37℃ for 30min; 22℃ for 30min; and stored at 4℃; programmed gradient cooling to form basic tetrahedrons, and then added with 3 times the corresponding molar concentration of reporter hairpins, and incubated at 37℃ for 1h to form a fully assembled functional tetrahedral structure. The reporter hairpin was heated to 95℃ in buffer (HEPES 10mM; pH=7.3; containing 150mM NaCl) in advance and cooled naturally to ensure that the hairpin structure was fully formed, and then PAGE analysis and AFM analysis were performed.

[0031] The results are as follows Figure 3 As shown, the increase in molecular weight of the complex in PAGE indicates the successful assembly of the DNA tetrahedron backbone and the functionalized tetrahedron. The difference in appearance between the two can also be clearly observed in the AFM image, and the four arms extending from the four vertices of the tetrahedron clearly shown by AFM further illustrate the success of the assembly.

[0032] Example 3. Optimization of detection conditions Refer to Example 2 to construct a functionalized tetrahedron solution in Mg 2+ 0.5mM, Mn 2+ Under 0.5 mM conditions, incubation was carried out with the mimic targets miR-10b and miR-155, and the reporter hairpins were labeled with FAM and BHQ (SEQ ID No. 15). The neck length of the E6 DNAzyme chain, the optimal tetrahedron concentration and the incubation time in the system were changed in turn. Other conditions remained unchanged. The reaction was carried out at 37°C for a corresponding length of time, and then fluorescence detection analysis was performed.

[0033] The results are as follows Figure 4 As shown, several important parameters were optimized to obtain the best performance of miRNAs logic detection, and the results showed that the optimal length of the swing neck of the E6 DNAzyme chain was 40 nt to ensure that the E6 DNAzyme had enough reaction and walking space between the functional hairpins, the optimal tetrahedron detection concentration was 200 nM, and the optimal in vitro incubation time was 3 h.

[0034] Example 4. Effect of tetrahedron addition on system reaction rate and signal-to-noise ratio Referring to Example 2, a functionalized tetrahedron solution (concentration of 200 nM) and a tetrahedron removal solution (E6 DNAzyme chain 200 nM, hairpin concentration 600 nM) were prepared. The concentrations of other components were the same (hairpins were labeled with FAM and BHQ-1). The buffer was an annealing buffer. Then, miR-10b (10 nM), miR-155 (10 nM) and the corresponding divalent metal ions (Mg 2+ 0.5mM, Mn 2+ 1mM), the fluorescence intensity was detected every half an hour using a spectrophotometer, and then the curve was drawn.

[0035] In order to better explain this process, some physical and chemical parameters were first analyzed theoretically. According to the collision frequency theory V = 1 / CN (V represents the volume of the reaction system, C represents the concentration, and N is the Avogadro constant), for a free reaction system, the local sphere volume of the collision between E6DNAzyme and the reporter hairpin was calculated to be 2.076x10 -18L, with a radius of 79.14 nm. When E6DNzyme and the reporter hairpin were confined to a smaller area by the tetrahedron, the distance between E6 DNAzyme and the reporter hairpin was reduced to 17 nm (including the connecting segment of the two units and the side length of the tetrahedron, which is about 50 nt). The local concentration increased to 80.72 µM, which is about 100 times that of the free system. The experimental results also confirmed that due to spatial constraints, the reaction system with DNA tetrahedron as the scaffold does show a faster reaction rate ( Figure 5 ) and higher signal-to-noise ratio ( Figure 6 ).

[0036] Example 5. Stability in serum Referring to Example 2, a functionalized tetrahedron solution and a reporter hairpin solution (both unlabeled) with the same hairpin concentration were prepared, with a concentration of 600 nM, and an annealing buffer, followed by the addition of fetal bovine serum to a fetal bovine serum concentration of 10%. The solutions were incubated at 37°C for 0 / 0.5 / 1 / 2 / 5 / 8 / 10 hours, and then subjected to PAGE electrophoresis. Correspondingly, the labeled solution was reacted with FBS, and the fluorescence growth was analyzed.

[0037] When DNAzyme elements and reporter hairpin probes are integrated into the tetrahedron, its biological resistance is significantly enhanced due to the increase in local nucleic acid concentration. Figure 7 As shown in the figure, the PAGE results show that the free functional hairpin was significantly digested after only 2 hours of incubation in 10% FBS solution. However, after the functional tetrahedron was incubated in the same solution for 10 hours, the band on PAGE only slightly became lighter, indicating the good anti-degradation property of the platform.

[0038] Example 6. Sensitivity and specificity verification Referring to Example 2, a reaction solution containing functionalized tetrahedrons was prepared. Under the experimental conditions optimized in Example 3, different concentrations of miR-10b, miR-155 or other targets containing mutation sites (miR-155 SM, miR-10b DM, miR-155 TM) and corresponding divalent metal ions were added to make Mg 2+ The concentration reached 0.5mM, Mn 2+ The concentration reached 0.5 mM and incubated at 37°C for 3 h before fluorescence analysis.

[0039] In terms of sensitivity, the results are as follows Figure 8 As shown, the functionalized tetrahedron has good logic detection performance, and the fluorescence signal increases significantly with the increase of the concentration of the two miRNAs. The linear range of logic detection of miR-10b and miR-155 (ratio of 1:1) is 100pm ~ 100nm, and the limit of detection (LOD) is calculated to be 98.97 pM (3σ principle).

[0040] Specific results such as Fig. 9 As shown, it is shown that only when miR-10 and miR-155 are present at the same time, a strong fluorescence signal is generated, regardless of whether the system contains only these two miRNAs or other miRNAs are mixed (a 1:1:1:1 mixture of miR-10b, miR-155, miR-21 and let-7a). When any of the two targets is replaced by other miRNAs, the fluorescence signal is significantly weakened. More interestingly, when any target is replaced by an analog with 1-3 base mutations, the fluorescence signal is also significantly reduced, indicating that our platform has the ability to identify single-base mutation targets.

[0041] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A dual microRNA AND logic gate detection platform based on allosteric strategy engineered DNAzyme, characterized in that: The detection platform is composed of a DNA tetrahedron consisting of an E6 DNAzyme chain, two locking chains, a reporter hairpin probe and four oligonucleotide chains S1-S4; the two locking chains can respectively hybridize with the 5' end and the 3' end of the E6 DNAzyme chain to block the core catalytic sequences at both ends, thereby making it lose its cutting activity; the two locking chains can also simultaneously bind to two target miRNAs to be detected, so that the E6 DNAzyme chain can allosterically restore the active structure, and its two side arms can hybridize with the sequences on both sides of the rA site on the reporter hairpin probe, and cleave the rA site in the presence of a metal cofactor so that the reporter hairpin probe is cut and separated, releasing a fluorescent signal; the DNA tetrahedron serves as a fixed skeleton, and the E6 DNAzyme chain and the reporter hairpin probe can be fixed on the vertices of the tetrahedron, thereby improving the stability of the detection platform.

2. The detection platform according to claim 1, characterized in that: A toehold region is designed at the 5' end or 3' end of the two locked strands.

3. The detection platform according to claim 1, characterized in that: Both ends of the reporter hairpin probe are modified with a fluorescent group and a quenching group.

4. The detection platform according to claim 1, characterized in that: When the two target miRNAs to be detected are miR-10b and miR-155, the sequence of the E6 DNAzyme chain is selected from one of SEQ ID No.7~11, the sequences of the two locked chains are shown in SEQ ID No.12~13, the reporter hairpin probe sequence is shown in SEQ ID No.15, and the sequences of the four oligonucleotide chains S1-S4 are shown in SEQ ID No.3~6.

5. The detection platform according to claim 4, characterized in that: The sequence of the E6 DNAzyme chain is selected from SEQ ID No.

10.

6. A method for detecting miR-10b and miR-155 based on the detection platform according to any one of claims 1 to 5, characterized in that: The following steps are included: Four oligonucleotide chains S1-S4, E6 DNAzyme chain, and two locking chains were added to the buffer in an equimolar ratio, annealed, and the locked E6 DNAzyme chain was fixed on one vertex of the tetrahedron; then, after the first incubation with a reporter hairpin probe at a 3-fold corresponding molar concentration, the reporter hairpin probe was fixed on the other vertices of the tetrahedron to form a fully assembled functional tetrahedron; finally, in Mg 2+ , Mn 2+ In the presence of 5-nitro-4-nitro-2-thiocyanate, the functionalized tetrahedron was incubated with samples containing target miR-10b and miR-155 for a second time, and then fluorescence detection analysis was performed.

7. The method according to claim 6, characterized in that The concentration of the functionalized tetrahedron is 200 nM, Mg 2+ and Mn 2+ The concentration is 0.5 mM.

8. The method according to claim 6, characterized in that The buffer solution is HEPES 10 mM, pH=7.3, and contains NaCl 150 mM.

9. The method according to claim 6, characterized in that The annealing was as follows: 95°C for 5 min; 65°C for 30 min; 50°C for 30 min; 42°C for 30 min; 37°C for 30 min; 22°C for 30 min; and stored at 4°C.

10. The method according to claim 6, characterized in that The first incubation was at 37° C. for 1 h, and the second incubation was at 37° C. for 3 h.

Images