Rapid detection method for upstream 20bp indel polymorphism of cattle OR2AD1 gene and application of rapid detection method

Abstract

The invention discloses a rapid detection method for polymorphism of upstream 20bp indel of a cattle OR2AD1 gene and application of the rapid detection method, and belongs to the field of molecular genetics. The detection method comprises the following steps: designing upstream and downstream primers of the site according to the characteristic that 20bp indel insertion exists in an OR2AD1 gene promoter region, and expressing the upstream and downstream primers by P; jugular vein blood collection and genome DNA extraction are carried out on detected different varieties of cattle, PCR amplification is carried out through a primer pair P, finally, the indel polymorphism of the gene is detected through agarose gel electrophoresis, when 20 bp indel insertion exists, the gene is the II genotype, when 20 bp deletion exists, the gene is the DD genotype, and when the site is a heterozygous individual, the gene is the ID genotype. Meanwhile, genotype distribution and allele frequency of different varieties of cattle are analyzed, correlation analysis is carried out on the genotype distribution and allele frequency and body weight and body size characters of a Xiannan cattle group, and the method is used for auxiliary selection and molecular breeding of cattle.

Description

Technical Field

[0001] The invention specifically relates to a rapid detection method for 20bp indel polymorphism upstream of cattle OR2AD1 gene and application of the detection method, belonging to the field of molecular genetics. Background Art

[0002] The sense of smell of vertebrates plays a key role in many aspects, such as locating prey or food, mating behavior, avoiding predators, and social communication. The sense of smell is mainly composed of olfactory receptors (OR) that capture volatile odorants, generate nerve impulses, and transmit them to the cerebral cortex through the olfactory nerve to produce smell. OR genes are encoded by a multigene superfamily, and their number is huge. In mammals, they are second only to immune system encoding genes, accounting for 3% to 5% of the total number of genes in the mammalian genome. During development, each olfactory neuron "selects" to produce only one OR. Once the olfactory neuron recognizes a functional receptor, it will stop producing other ORs. The OR gene coding region is about 1 kb long and has no introns. In cattle, the olfactory receptor family 2 subfamily AD member 1 (OR2AD1) gene is located on chromosome 23 and contains one exon. Studies have shown that OR2A2 gene CNV is associated with phenotypes such as residual feed intake and dry matter intake in cattle. The present invention detected the distribution of 20bp indel polymorphism upstream of OR2AD1 gene in different cattle breeds, and laid a foundation for screening out homozygous high-quality local cattle populations and molecular genetic markers closely related to cattle growth traits through association analysis with weight and body size traits of Xia Nan cattle population. Summary of the invention

[0003] The purpose of the present invention is to provide a rapid detection method for the 20 bp indel polymorphism upstream of the cattle OR2AD1 gene and its application.

[0004] 1. In order to achieve the above objectives, the technical solution adopted by the present invention is:

[0005] (1) A primer for detecting the genotype of a cattle economic trait locus, comprising a primer pair P:

[0006] Upstream primer PF: 5′-GGCACCAAAAACACATTGCAC-3′;

[0007] Downstream primer PR: 5′-TCCTCCGCTTTTTCCTGCTT-3′.

[0008] (2) using the whole genome DNA of the bovine to be tested containing the OR2AD1 gene as a template, and using primer pair P as a primer to simultaneously PCR amplify a 20 bp sequence including -611 to -591 upstream of the bovine OR2AD1 gene to obtain an amplified product;

[0009] (3) The amplified product was subjected to agarose gel electrophoresis to detect the nucleotide polymorphism of the 20 bp indel upstream of the bovine OR2AD1 gene, and the different genotypes of the bovine OR2AD1 gene were identified based on the agarose gel electrophoresis results. When the 20 bp indel was inserted, the amplified product was a single band with a band size of 124 bp, which was named II genotype; when a 20 bp deletion occurred, the amplified product was a single band with a band size of 104 bp, which was named DD genotype; when the locus was a heterozygous individual, the amplified product was two bands with band sizes of 124 bp and 104 bp, respectively, which was named ID genotype.

[0010] (4) The method for rapid detection of 20 bp indel polymorphism upstream of the bovine OR2AD1 gene according to claim 1, characterized in that the 20 bp indel site is located between -611 and -591 upstream of the bovine OR2AD1 gene, wherein the accession number of the bovine gene sequence is NC_037350.1.

[0011] (5) The rapid detection method for the 20 bp indel polymorphism upstream of the bovine OR2AD1 gene according to claim 1 is characterized in that the amplification reaction system is: 2×Taq PCR MasterMix 5.00 μL, ddH 2 O 3.00μL, P-F 0.5μL, PR 0.5μL, DNA template 1.0μL. The PCR amplification reaction program was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 53℃ annealing for 15s, 72℃ extension for 15s, 30 cycles; 72℃ extension for 5min; 4℃ storage.

[0012] (6) The method for rapid detection of 20 bp indel polymorphism upstream of the bovine OR2AD1 gene according to claim 1, characterized in that the mass fraction of agar used in the agarose gel electrophoresis detection is 3.0%.

[0013] (7) The rapid detection method for detecting the 20 bp indel polymorphism upstream of the bovine OR2AD1 gene according to claim 1 is characterized in that: the voltage of the agarose gel electrophoresis in step 5 is 120 V and the electrophoresis time is 40 min.

[0014] 2. The technical solution adopted by the present invention is also to provide an application of a rapid detection method for the polymorphism of 20bp indel upstream of the cattle OR2AD1 gene, which can be used for auxiliary selection and molecular breeding of cattle. By performing association analysis between the genotype and the weight and body size traits of Xia Nan cattle, the corresponding relationship between the genotype and the trait is determined, which is used for molecular breeding of cattle.

[0015] (1) The traits are growth traits, mainly including body weight and body size traits.

[0016] (2) The 20bp indel of the cattle OR2AD1 gene is located at positions 51 to 70 of the 124bp target fragment of the cattle OR2AD1 gene amplification. The II genotype inserts the 20bp indel sequence "AAAATTAATACAAGAAAAAA", and the DD genotype lacks the above sequence at the corresponding position. In the Xia Nan cattle population and other different breeds of cattle, the different genotypes of the 20bp indel upstream of the OR2AD1 gene are distributed as follows:

[0017] Table 1 Genotype distribution of 20 bp indel in OR2AD1 gene in different cattle breeds

[0018]

[0019] (3) The association analysis between the 20bp indel polymorphism of OR2AD1 gene and the weight and body size traits of Xia Nan cattle population showed that the polymorphism was significantly associated with some important growth traits of cattle. The D allele, i.e. the deletion of 20bp in total, was beneficial to the growth of cattle, and the DD genotype was the dominant genotype.

[0020] (4) The present invention uses agarose gel electrophoresis to detect the results of PCR products, which is a method for screening and detecting molecular genetic markers closely related to cattle growth traits at the DNA level. The molecular biological method established by the present invention is simple to operate, low in cost, and short in cycle, greatly improving the accuracy of genotype determination at the site, and does not require special instruments, which is easy to promote and popularize. Experiments have shown that this method can effectively determine the genotype of the two indel polymorphisms upstream of the cattle OR2AD1 gene, and can be used for molecular marker-assisted selection of economic trait sites in cattle, thereby establishing a homozygous high-yield local cattle population. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Agarose gel electrophoresis of the amplified product of bovine OR2AD1 gene;

[0022] Figure 2 Sequencing diagram of insertion and deletion genotypes of the cattle OR2AD1 gene. The dashed box in the upper figure is the 20bp insertion sequence upstream of the OR2AD1 gene, and the arrow in the lower figure is the 20bp indel insertion site. DETAILED DESCRIPTION

[0023] The following Example 1 is only used to further illustrate the present invention in detail, but does not constitute any limitation to the present invention.

[0024] This embodiment 1 mainly includes the following steps:

[0025] (1) Preparation and preservation of samples

[0026] Animal materials: Blood DNA of Xia Nan cattle, Jiaxian Red cattle, Nanyang cattle, Wandong cattle, Yanbian cattle, Xinjiang brown cattle, Dabieshan cattle, De Nan cattle, Simmental cattle, Holstein cattle, and Limousin cattle were provided by the cattle breeding room of the Animal Husbandry Institute of Henan Academy of Agricultural Sciences. DNA samples were stored in a -20℃ refrigerator for future use.

[0027] (2) Primer design

[0028] The primer pair P was designed using the OR2AD1 gene sequence (GenBank Accession NC_037353.1) as a template.

[0029] Upstream primer PF: 5′-GGCACCAAAAACACATTGCAC-3′;

[0030] Downstream primer PR: 5′-TCCTCCGCTTTTTCCTGCTT-3′.

[0031] (3) PCR amplification

[0032] Using primer pair P as primer, a 10.0 μL amplification system was established: 5.00 μL 2× Taq PCR MasterMix (purchased from Beijing Kangwei Company), ddH 2 O 3.00μL, PF 0.5μL, PR 0.5μL, DNA template 1.0μL.

[0033] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 15 s, 38 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0034] (4) Agarose gel electrophoresis

[0035] Weigh 2.5g of agarose, transfer to a conical flask, add 100ml of 1×TBE, shake slightly to suspend it, heat in a microwave oven on medium heat, take it out after boiling and cool it to 65℃, add 5ul of DNA nucleic acid dye, mix it thoroughly and quickly pour the agarose solution into the prepared gel plate, pay attention to prevent bubbles. After 20 minutes, when the agarose gel is completely cooled and solidified, pull out the comb and move the gel into the electrophoresis tank. Take 8ul of PCR amplification product, load it into the comb hole of the agarose gel, and electrophoresed at 120V for 40 minutes.

[0036] (5) Gel imaging system imaging

[0037] from Figure 1 It can be seen that lane 3 is an amplified product with a fragment size of 124bp, which is consistent with the theoretical design size. Therefore, it can be proved that the fragment of the promoter region of the bovine OR2AD1 gene has been successfully amplified. Among them, lane 1: DL2000 (2000, 1500, 1000, 750, 500, 250 and 100bp); lane 3 is a band with a band size of 124bp, named genotype II. The amplified products of lanes 5 and 6 are a band with a band size of 104bp, named genotype DD; lanes 2 and 4 are two bands with band sizes of 124bp and 104bp, named genotype ID genotype.

[0038] (6) Sequencing of amplified products

[0039] The PCR amplification products of individuals with different genotypes were selected for sequencing, and a 20 bp indel site was found in the promoter region of the bovine OR2AD1 gene. Figure 2 . When inserted, it is genotype II such as Figure 2 In the figure above, when missing, it is DD genotype. Figure 2 The lower figure shows that when the locus is a heterozygous individual, it is the ID genotype. The dashed box in the upper figure shows the 20bp insertion sequence, and the arrow in the lower figure shows the insertion site of the 20bp indel. The sequencing results are exactly the same as the genotype determined by agarose gel electrophoresis, confirming the effectiveness and accuracy of this detection method.

[0040] (6) Genotype distribution and allele frequency statistics of the 20 bp indel site upstream of the cattle OR2AD1 gene in different cattle breeds

[0041] The genotype and allele frequency distribution of the 20 bp indel upstream of the OR2AD1 gene in different cattle breeds are as follows:

[0042] Table 2 Distribution of genotype and allele frequencies of 20 bp indel in OR2AD1 gene in different cattle breeds

[0043]

[0044] (7) Association analysis between the 20 bp indel polymorphism upstream of the cattle OR2AD1 gene and body weight and body size traits in the Xianan cattle population

[0045] There are 612 individuals in the Xia Nan cattle population with partial and complete records of weight and body size traits for association analysis of the polymorphic locus. The measurement method is as follows: from birth to two years of age, weight, height, cross height, body oblique length, chest circumference, abdominal circumference, tube circumference and other weight and body size indicators are measured every six months. In addition, the above indicators are also measured at weaning (4 months of age), a total of 36 indicators.

[0046] (8) Association analysis model

[0047] SPSS (26.00) software was used to analyze the correlation between gene loci and economic traits. To ensure that the data of each trait was normally distributed, the least squares method was used to correct the data. According to the data characteristics, the multivariate linear model was used to analyze the genotype effect and the least significant difference method (LSD) was used to compare the differences between the genotypes. The results are shown in Table 3.

[0048] Table 3 Association analysis between the 20 bp indel site polymorphism of OR2AD1 gene and growth traits of Xianan cattle

[0049]

[0050]

[0051] Note: Different lowercase letters in the same row indicate significant differences (P<0.05).

[0052] The results of association analysis in Table 3 showed that the 20bp indel polymorphism upstream of the OR2AD1 gene was significantly correlated with the weight, height, body length at 6 months of age and abdominal circumference at 12 months of age of Xia Nan cattle (P<0.05); and extremely significantly correlated with abdominal circumference at 24 months of age (P<0.01). It can be used as a genetic marker for the selection of some growth traits of Xia Nan cattle, providing a scientific basis for the selection of Xia Nan cattle.

Claims

1. A rapid detection method for the 20 bp indel polymorphism upstream of the cattle OR2AD1 gene and its application, characterized in that: Mainly includes the following steps: (1) Based on the gene sequence of the promoter region of the bovine OR2AD1 gene, a pair of primers P were designed: Upstream primer PF: 5′-GGCACCAAAAACACATTGCAC-3′; Downstream primer PR: 5′-TCCTCCGCTTTTTCCTGCTT-3′. (2) using the sequence containing the bovine OR2AD1 gene as a template and the primers designed in step (1) to perform PCR amplification; (3) The nucleotide polymorphism of the bovine OR2AD1 gene was detected by agarose gel electrophoresis. When the promoter region contained a 20bp indel insertion, the amplified product was a single band with a band size of 124bp, which was named II genotype; when the promoter region contained a 20bp indel deletion, the amplified product was a single band with a band size of 104bp, which was named DD genotype; when the locus was a heterozygous individual, the amplified product was two bands with band sizes of 124bp and 104bp, respectively, which was named ID genotype.

2. A rapid detection method for the polymorphism of 20 bp indel upstream of the cattle OR2AD1 gene according to claim 1, characterized in that: The 20 bp indel site is located at -611 to -591 upstream of the bovine OR2AD1 gene, wherein the accession number of the bovine gene sequence is NC_037350.

1.

3. A rapid detection method for the polymorphism of 20 bp indel upstream of the cattle OR2AD1 gene according to claim 1, characterized in that: The amplification reaction system was: 2×Taq PCRMasterMix 5.00μL, ddH2O 3.00μL, PF 0.5μL, PR 0.5μL, DNA template 1.0μL. The PCR amplification reaction program was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 53℃ annealing for 15s, 72℃ extension for 15s, 38 cycles; 72℃ extension for 10min; 4℃ storage.

4. A rapid detection method for the polymorphism of 20 bp indel upstream of the cattle OR2AD1 gene according to claim 1, characterized in that: The mass fraction of agar used in the agarose gel electrophoresis detection is 3.0%.

5. The rapid detection method for detecting 20bp indel polymorphism upstream of cattle OR2AD1 gene according to claim 1, characterized in that, The voltage of agarose gel electrophoresis in step 5 is 120V, and the electrophoresis time is 40min.

6. The rapid detection method for detecting 20bp indel polymorphism upstream of cattle OR2AD1 gene according to claim 1, characterized in that: By performing correlation analysis between genotype and cattle weight and body size traits, wherein the traits are growth traits and body size traits, the detection method can be used for assisted selection and molecular breeding of cattle.

Images