Molecular marker of new functional allelic variant Sbdth1 of sorghum heading stage gene SbDTH1 and application

Abstract

The invention discloses a molecular marker of a new functional allelic variant Sbdth1 of a sorghum heading stage gene SbDTH1 and application of the molecular marker. The invention provides a functional allelic variant in a gene SbDTH1 for regulating and controlling the heading stage of sorghum, and a transposon is inserted at the fourth basic group behind a termination codon TGA. The allelic variants can prolong the heading time of sorghum. Molecular markers for high-throughput marker molecular marker detection are developed according to the allelic variants. The molecular marker has the advantages of flexibility, high efficiency, high flux, low cost and the like. The molecular marker can be used for detecting and screening allelic variants, is used for molecular marker breeding and breeding of new sorghum varieties suitable for the heading stage, and has important significance for enlarging regional planting of sorghum and improving the yield.

Description

Technical Field

[0001] The invention relates to the technical field of crop molecular marker-assisted breeding, and in particular to a molecular marker and application of a new functional allele variant Sbdth1 of a sorghum heading period gene SbDTH1. Background Art

[0002] Sorghum (Sorghum bicolor) is the fifth most popular cereal crop in the world and the staple food for more than 500 million people in Africa and Asia. In addition to being a valuable food source, sorghum also plays an important role in the brewing industry, feed industry, pigment industry and biomass energy, which has led to an increase in my country's demand for sorghum year by year. Therefore, it is extremely important to further increase sorghum production and expand sorghum planting areas.

[0003] Heading (flowering) time is one of the important agronomic traits of crops, and successful control of flowering time is critical to crop production because it ensures that plants reproduce under optimal conditions. Cereal sorghum is generally selected for early flowering to avoid drought or low temperatures and ensure reproduction, while other sorghum types, such as sweet sorghum, forage sorghum, and energy sorghum, are selected for a longer vegetative growth period to obtain higher biomass yield. The diversification of sorghum flowering time under long-day conditions suggests that multiple genes can be selected to breed photoperiod-insensitive varieties. Therefore, flowering time is a major limiting factor in crop breeding in terms of improving yield and regional adaptability.

[0004] Sorghum is a typical short-day plant. Differences in photoperiod sensitivity determine the flowering time of different sorghum varieties. Under temperate long-day conditions, many photoperiod-sensitive sorghum germplasms flower very late or even fail to produce heading, making them unsuitable for planting. Since photoperiod regulation of flowering is critical to crop yield and hybrid seed production, photoperiod regulation of flowering has been an important goal of sorghum improvement programs since the early 20th century.

[0005] Traditional sorghum breeding for broad adaptability is based on individual plant selection based on the flowering time of the breeding offspring. This method is not only time-consuming and labor-intensive, but also susceptible to environmental interference and has low accuracy. The best way to improve the efficiency of sorghum selection for broad adaptability is to develop specific molecular markers for auxiliary selection using the base differences in the target gene. Although many scholars have studied the heading period of sorghum, there are still few reports on genes that control the heading period of sorghum, and the molecular markers related to the heading period that have been reported are even rarer. Summary of the invention

[0006] By counting the heading date of the inbred line population of Tx430 / P898012 in 7 different environments, 5 QTL loci were located using quantitative trait loci (QTL), of which Ma1 and Ma6 on chromosome 6 and SbFT on chromosome 10 have been reported, and the candidate gene on chromosome 9 is ELF3, and the QTL control gene on chromosome 8 has not been reported. We cloned the candidate gene on chromosome 8 as SbDTH1, and verified and analyzed the function and regulatory mechanism of the SbDTH1 gene.

[0007] The present invention uses bioinformatics analysis to find that SbDTH1 encodes a bHLH transcription factor and is most closely related to the corn PIF4 gene. Subcellular localization experiments reveal that the SbDTH1 protein is located in the cell nucleus.

[0008] In order to analyze the sequence polymorphism of SbDTH1 gene, the published sequences of Tx430, P898012, Tx623 and RIO were compared. It was found that the varieties Tx430 and Tx623, which bloom earlier in autumn, both had a 6755bp insertion, while the varieties P898012 and RIO, which bloom later in autumn, lacked this fragment, which was speculated to be a functional variation. The transposon was converted into a molecular marker to count the heading date and the presence of the transposon in an F2 population (Tx430 / Hongyingzi) and a natural population (161 sorghum germplasms). It was found that the varieties with transposons had a longer average heading time than those without transposons, indicating that SbDTH1 regulates the heading date of sorghum and the insertion of the transposon is a functional variation.

[0009] The present invention provides a functional allele variant in the gene SbDTH1 regulating the heading period of sorghum, and inserts a transposon at the fourth base after the stop codon TGA. The allele variant can extend the heading period of sorghum. A molecular marker for high-throughput molecular marker detection is developed based on the allele variant.

[0010] The present invention is achieved through the following technical solutions:

[0011] The present invention provides

[0012] A molecular marker for a new functional allele Sbdth1 of a sorghum heading period gene SbDTH1. The molecular marker is used to mark a new functional allele Sbdth1 of a sorghum heading period gene SbDTH1. The allele Sbdth1 is a gene SbDTH1 on chromosome 8 of sorghum in which a transposon is inserted at the fourth base after the stop codon TGA. The allele Sbdth1 has a late heading period.

[0013] Preferably, the base number of the transposon is 6755 bp.

[0014] Preferably, the transposon insertion site is 2314 bp away from the start codon.

[0015] Preferably, the molecular marker comprises forward primers 1F and 2F; the reverse primer is 1R;

[0016] The sequence of 1F is SEQ ID NO.1:

[0017] DTH-dF-1:5'GCTCACACTCAACCACATGC 3';

[0018] The sequence of 2F is SEQ ID NO.2:

[0019] DTH-dF-2:5'GCTACAGGCACAGATGACGA 3';

[0020] The sequence of 1R is SEQ ID NO.3:

[0021] DTH-dR-2:5'TTTGTTGACCTCGGTCTGAA 3'.

[0022] Preferably, the molecular marker can identify the allelic variant Sbdth1;

[0023] Amplification using 2F and 1R showed a 675 bp band of the Sbdth1 genotype;

[0024] Amplification was performed using 1F and 1R, and the 615 bp band was of the DTH1 genotype.

[0025] Preferably, the molecular marker is used to detect whether a sorghum variety, line or germplasm resource has the Sbdth1 genotype.

[0026] Preferably, the molecular markers are used to detect the distribution of key functional alleles in sorghum germplasm resources.

[0027] Preferably, the molecular marker is used for molecular marker-assisted selection breeding of sorghum heading period genes.

[0028] The beneficial effect of the present invention is that the present invention finds the variable site regulating the heading period of sorghum through QTL positioning, namely, the transposon insertion on the SbDTH1 gene, and develops it into a molecular marker. The molecular marker closely linked to the heading period of sorghum is developed for early (low generation) selection of breeding, which plays an important role in reducing the time of breeding, improving the breeding of sorghum, and improving the economic benefits.

[0029] The present invention provides a sorghum heading period regulating gene

[0030] A new variant of SbDTH1 also provides a molecular marker for high-throughput detection of sorghum heading period genes that has important utilization value in breeding. It can quickly, flexibly, efficiently and high-throughput detect key variants in the SbDTH1 gene that cause changes in sorghum heading period. It can be used to detect the distribution of key functional alleles in sorghum germplasm resources, and can efficiently screen sorghum germplasm resources with ideal heading period and be applied to molecular marker-assisted selection breeding of sorghum heading period genes. It has important utilization value for using SbDTH1 to expand the planting range of sorghum. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Figure 2 shows the phylogenetic tree of SbDTH1.

[0032] Figure 2 Schematic diagram of the predicted SbDTH1 protein structure.

[0033] Figure 3 Figure 2 shows the subcellular localization of SbDTH1.

[0034] Figure 4 This is a schematic diagram of the SbDTH1 transposon.

[0035] Figure 5 This is a gel image of Tx430 and P898012 transposon amplification, where T indicates transposon insertion and P indicates no transposon insertion.

[0036] Figure 6 It is the statistics of the presence or absence of transposons and heading period in different populations.

[0037] Figure 7 This is a gel image of F2 population genotyping, where A is primer 2F / 1R; B is a gel image of primer 1F / 1R amplification.

[0038] Figure 8 This is a gel image of the Sbdth1 / SbDTH1 genotyping of a natural population, where A is primer 2F / 1R; B is a gel image of primer 1F / 1R amplification. DETAILED DESCRIPTION

[0039] Example 1 Bioinformatics analysis of SbDTH1

[0040] The SbDTH1 gene encodes a bHLH transcriptional regulatory factor, with an APB structure at 42aa of the N-terminus and a bHLH structure at 278aa. The amino acid sequence of SbDTH1 was blasted using NCBI, and the obtained proteins from different species were used to construct a phylogenetic tree using MEGA7. The results showed that the sorghum SbDTH1 protein was most closely related to the maize PIF4 gene (see Figure 1 ).

[0041] Example 2 SbDTH1 protein structure prediction

[0042] The tertiary structure of the protein encoded by SbDTH1 was predicted online by SWISS-MODEL. A model with high similarity was found in PDB according to the SbDTH1 protein sequence for tertiary modeling. The model with ID number 5gnj.3.A was selected here. The quality evaluation value of the model was between 0 and 1, and the sequence identity was higher than 60%. The tertiary structure of SbDTH1 constructed with this model as a reference was highly reliable and accurate (see Figure 2 ).

[0043] Example 3 Subcellular localization of SbDTH1

[0044] In order to understand the subcellular localization of SbDTH1, an SbDTH1-pBI121 expression vector with a GFP tag was constructed and transferred into Agrobacterium GV3101. The Agrobacterium was then transferred into the lower epidermis of leaves of Nicotiana benthamiana that had grown for about 5 weeks. After the injection, the leaves were cultured for 2 days. The fluorescence of the leaves was observed by a two-photon laser confocal microscope (Zeiss, Germany) with pBI121-GFP as a control. The subcellular localization results showed that the pBI121-GFP empty vector had fluorescence in the cell membrane, cytoplasm and nucleus, while the SbDTH1 gene had fluorescence only in the nucleus (see Figure 3 ), indicating that SbDTH1 is a nuclear protein.

[0045] Example 4 SbDTH1 polymorphism analysis

[0046] In order to explore the polymorphism of SbDTH1 gene, we compared the upstream 3000bp and downstream 2000bp of the SbDTH1 gene sequences of Tx430, P898012, RIO, Tx623 (heading period) varieties with published genomes, and found 14 polymorphic sites, 7 of which were located in the promoter, 6 in the exon, and 1 in the intron. Among them, 3 possible functional mutations were found in the sequence comparison of Tx430 and Tx623, which flower earlier in autumn, and P898012 and RIO, which flower later in autumn. The base substitutions at 1869bp and 2235bp were both synonymous mutations. There was a 6755bp transposon insertion (3bp away from the stop codon TGA) in Tx623 and Tx430, which flower earlier in autumn, but not in Rio and P898012, which flower later (see Figure 4 ), and it is speculated that the transposon is a functional mutation.

[0047]

[0048] Table 1 Statistics of nucleotide polymorphism sites in multiple varieties

[0049] The genotype with transposon insertion is named Sbdth1, and the genotype without transposon insertion is SbDTH1.

[0050] Example 5 Transposon conversion into molecular markers

[0051] We designed two pairs of primers for transposon, including forward primers 1F and 2F; the reverse primer is 1R.

[0052] The primer sequence for labeling Sbdth1 is as follows:

[0053] The sequence of 1F is SEQ ID NO.1:

[0054] DTH-dF-1:5'GCTCACACTCAACCACATGC 3';

[0055] The sequence of 2F is SEQ ID NO.2:

[0056] DTH-dF-2:5'GCTACAGGCACAGATGACGA 3';

[0057] The sequence of 1R is SEQ ID NO.3:

[0058] DTH-dR-2:5'TTTGTTGACCTCGGTCTGAA 3';

[0059] Using 1F and 1R for amplification, it was found that the Tx430 variety could amplify a 7375bp fragment, and the P898012 variety amplified a 615bp fragment, that is, the P898012 variety lacked 6755bp (see Figure 5 ); P898012 was SbDTH1 genotype.

[0060] Amplification with 2F and 1R revealed that Tx430 had a 675 bp target band, but P898012 had no target band (see Figure 5 ); Tx430 is the Sbdth1 genotype.

[0061] Example 6 Determination of functional variation

[0062] Using molecular markers to count the heading dates and presence of transposons in different populations, we found that in the F2 population (Tx430 / Hongyingzi) and natural populations, the varieties with transposon insertions had an average heading date later than those without transposons ( Figure 6 ), the results indicated that the SbDTH1 gene regulated the heading date of sorghum and the insertion of the transposon was a functional mutation.

[0063] Example 7 Genotyping of Recombinant Inbred Line Population

[0064] The materials used in the population were 192 F2 plants of the recombinant inbred line population constructed by Tx430 (Sbdth1) / Hongyingzi (DTH1). The heading time statistics were as follows: Figure 7 43 materials were Sbdth1 genotype, 52 materials were SbDTH1 genotype, 94 materials were heterozygous, and the material separation ratio of 1:2:1 was in line with the separation ratio. The results are as follows Figure 7 Shown

[0065] Example 8 Identification of the presence or absence of transposons in sorghum varieties from different sources

[0066] The experimental materials used for identification of transposons included 161 sorghum varieties from China and Africa. The heading time of 161 varieties was counted. Figure 8 shown.

[0067] The presence of transposons in 161 sorghum varieties from China and Africa was identified by 1% agarose gel electrophoresis. 79 varieties contained transposons, while 82 varieties did not.

[0068] The above is only a preferred implementation of this patent. It should be pointed out that for ordinary technicians in this technical field, several improvements and substitutions can be made without departing from the technical principles of this patent. These improvements and substitutions should also be regarded as the scope of protection of this patent.

Claims

1. A molecular marker for a novel functional allele variant Sbdth1 of a sorghum heading date gene SbDTH1, characterized in that: The molecular marker is used to mark a new functional allele variant Sbdth1 of a sorghum heading period gene SbDTH1. The allele variant Sbdth1 is a sorghum chromosome 8 gene SbDTH1 with a transposon inserted at the fourth base after the stop codon TGA. The allele variant Sbdth1 has a late heading period.

2. The molecular marker according to claim 1, characterized in that: The base number of the transposon is 6755 bp.

3. The molecular marker according to claim 1, characterized in that: The site where the transposon is inserted is 2314 bp.

4. The molecular marker according to claim 1, characterized in that: The molecular marker comprises forward primers 1F and 2F; the reverse primer is 1R; The sequence of 1F is SEQ ID NO.1: DTH-dF-1:5'GCTCACACTCAACCACATGC 3'; The sequence of 2F is SEQ ID NO.2: DTH-dF-2:5'GCTACAGGCACAGATGACGA 3'; The sequence of 1R is SEQ ID NO.3: DTH-dR-2:5'TTTGTTGACCTCGGTCTGAA 3'.

5. The molecular marker according to claim 1, characterized in that: The molecular marker can identify the allelic variant Sbdth1; Amplification using 2F and 1R showed a 675 bp band of the Sbdth1 genotype; Amplification was performed using 1F and 1R, and the 615 bp band was of the DTH1 genotype.

6. The use of molecular markers according to claim 5, characterized in that: The molecular marker is used to detect whether sorghum varieties, lines or germplasm resources are of the Sbdth1 genotype.

7. The use of molecular markers according to claim 5, characterized in that: The molecular markers are used to detect the distribution of key functional allele variations in sorghum germplasm resources.

8. The use of molecular markers according to claim 5, characterized in that: The molecular marker is used for molecular marker-assisted selection breeding of sorghum heading period genes.

Images