InDel molecular marker primer for identifying soybeans with high palmitic acid content and application of InDel molecular marker primer

Abstract

The invention discloses an InDel molecular marker primer for identifying soybeans with high palmitic acid content and application of the InDel molecular marker primer. The nucleotide sequence of an upstream primer of the InDel molecular marker primer is as shown in SEQ ID NO.1, and the nucleotide sequence of a downstream primer of the InDel molecular marker primer is as shown in SEQ ID NO.2. Aiming at a QTLqPA21 interval, in combination with amphiphilic re-sequencing data, an Indel site with a difference basic group greater than 15 bp is screened out, and an InDel molecular marker is designed aiming at basic group deletion existing at Chr025018100. According to the InDel molecular marker, an InDel primer sequence is designed, PCR amplification is carried out, a detection result is observed, and the palmitic acid content phenotype is identified. The primer disclosed by the invention can be used for identifying and screening phenotypes of the palmitic acid content of soybeans, and can be used for rapidly, accurately and effectively breeding soybean varieties with high palmitic acid content, so that the breeding process of crops is accelerated, and the breeding efficiency and success rate are improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to InDel molecular marker primers for identifying soybeans with high palmitic acid content and applications thereof. Background Art

[0002] Soybean is the main raw material for extracting vegetable oil, which mainly contains five important fatty acid components: palmitic acid (PA), stearic acid (SA), oleic acid (OA), linoleic acid (LA) and linolenic acid (LNA). Palmitic acid and stearic acid are saturated fatty acids, while oleic acid, linoleic acid and linolenic acid are unsaturated fatty acids. The ratio of various fatty acid components in soybean oil directly determines the flavor, shelf life, nutritional value, etc. of soybean oil. With the improvement of human living standards, people's requirements for diet are becoming more and more stringent, and people are pursuing healthier food. Saturated fat is a fatty acid without double bonds. Excessive intake can cause sudden onset of high blood pressure, cholesterol and coronary heart disease.

[0003] Soybean seed quality-related traits are regulated by multiple genes and are a type of quantitative trait. The genetic mechanism is relatively complicated and easily affected by environmental factors. Many scholars at home and abroad have conducted QTL positioning studies on soybean protein, fat, and fatty acid components, but the QTLs detected in different environments or different genetic backgrounds are different, and few QTLs have been repeatedly detected.

[0004] This study mainly uses the RIL population constructed by "Jidu 17×Jidu 12" as the material, and locates QTLs for the protein, fat and fatty acid components of soybean grains harvested in Shijiazhuang for two years and Sanya and finds stable genetic loci. The correlation between the fatty acid components was analyzed, and the main genetic loci regulating the fatty acid content of soybeans and the interaction between loci were found and analyzed, laying the foundation for molecular marker-assisted breeding of high-quality soybeans. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide InDel molecular marker primers for identifying soybeans with high palmitic acid content and applications thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] An InDel molecular marker primer for identifying soybeans with high palmitic acid content, wherein the upstream primer nucleotide sequence of the InDel molecular marker primer is shown as SEQ ID NO.1, and the downstream primer nucleotide sequence is shown as SEQ ID NO.2.

[0008] The application of InDel molecular marker primers whose upstream primer nucleotide sequence is shown as SEQ ID NO.1 and downstream primer nucleotide sequence is shown as SEQ ID NO.2 in identifying soybeans with high palmitic acid content.

[0009] An InDel molecular marker for identifying soybeans with high palmitic acid content, wherein the InDel molecular marker is a sequence amplified by using a soybean genome as a template and an InDel molecular marker primer; wherein the upstream primer nucleotide sequence of the InDel molecular marker primer is shown as SEQ ID NO.1, and the downstream primer nucleotide sequence is shown as SEQ ID NO.2; and the nucleotide sequences amplified by the InDel molecular marker primer are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0010] A kit for identifying soybeans with high palmitic acid content, comprising the InDel molecular marker primer according to claim 1.

[0011] The method for identifying soybeans with high palmitic acid content using InDel molecular marker primers whose upstream primer nucleotide sequence is shown in SEQ ID NO.1 and whose downstream primer nucleotide sequence is shown in SEQ ID NO.2 comprises the following steps:

[0012] (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain a PCR amplification product;

[0013] (2) Detect the amplified product by agarose gel electrophoresis and observe the electrophoresis detection results.

[0014] Further preferably, the reaction system of PCR amplification in step (1) is: in a 20 μL reaction system, 1 μL of DNA template, 1 μL of forward primer and 1 μL of reverse primer, 6 μL of ddH2O and 10 μL of 2×Mix

[0015] Further preferably, the reaction procedure of PCR amplification in step (1) is: pre-denaturation at 95°C for 3 min; denaturation at 93°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 5 min, and storage at 4°C.

[0016] Further preferably, the mass concentration of agarose gel in step (2) is 6%.

[0017] Further preferably, when the length of the amplified product is 458bp, the genetic marker band type of the soybean to be tested is A; when the length of the amplified product is 501bp, the genetic marker band type of the soybean to be tested is B; the palmitic acid content is: the soybean with genetic marker band type A is greater than or is candidate greater than the soybean with genetic marker band type B.

[0018] Application of the InDel molecular marker primers whose upstream primer nucleotide sequence is shown as SEQ ID NO.1 and whose downstream primer nucleotide sequence is shown as SEQ ID NO.2 or the InDel molecular marker according to claim 3 in soybean molecular marker-assisted breeding.

[0019] The beneficial effects of the above technical solution are as follows: the present invention targets the QTLqPA_2_1 interval, combines the parental resequencing data, screens out the Indel site with a difference base greater than 15 bp, and designs the InDel molecular marker for the base deletion at Chr02_5018100. According to the InDel molecular marker, the InDel primer sequence is designed, PCR amplification is performed, the test results are observed, and the palmitic acid content phenotype is identified. The primers of the present invention can be used for the identification and screening of the palmitic acid content phenotype of soybeans, and can quickly, accurately and effectively breed soybean varieties with high palmitic acid content, accelerate the crop breeding process, and improve the efficiency and success rate of breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the histogram of palmitic acid content of parents in Shijiazhuang in 2022, 2023 and 2024;

[0021] Figure 2 This is a schematic diagram of the distribution of palmitic acid content in the Shijiazhuang RIL population, where Skew: shows the skewness of the population distribution relative to the mean; Kurt: the concentrated peak of the population data;

[0022] Figure 3 It is a schematic diagram of the electrophoresis results of materials 1 to 48;

[0023] Figure 4 It is a schematic diagram of the electrophoresis results of materials No. 49 to 96;

[0024] Figure 5 It is a schematic diagram of the electrophoresis results of materials No. 97 to 144;

[0025] Figure 6 It is a schematic diagram of the electrophoresis results of materials No. 145 to 168;

[0026] Figure 7 This is a schematic diagram of the Indel marker typing of the RIL population and the results of the palmitic acid content in the grains;

[0027] Figure 8 This is a schematic diagram of the QTL location of protein, fat and fatty acid content on chromosome Chr02 of the population, where pro: protein content; oil: fat content; PA: palmitic acid content. DETAILED DESCRIPTION

[0028] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0029] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0030] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0031] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0032] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0033] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1: Extraction of soybean fatty acid components

[0035] The seeds were selected to be dry, undamaged, uniform in size and full in size. Ten seeds were selected from each plant for grinding. Each sample was cleaned after grinding to prevent mixing. 0.1 g of the ground soybean powder was weighed and placed in a 2 mL centrifuge tube for later use.

[0036] Fatty acid extraction steps:

[0037] (1) Add 1 mL of petroleum ether to the centrifuge tube containing soybean powder and shake for 1 hour;

[0038] (2) Centrifuge for 10 minutes at 4000 r / min, then pipette 800 μL of supernatant into a 10 mL centrifuge tube, add 1.5 mL of methanol / KOH, mix thoroughly, and let stand for 1 hour;

[0039] (3) After standing, add 5 mL of distilled water to separate the oil;

[0040] (4) Pipette 150 μL of the upper layer of oil into a 2.0 mL sample bottle, and then add 450 mL of petroleum ether to make up the volume for detection.

[0041] Example 2: Detection of fatty acid components by gas chromatograph

[0042] This study used an Agilent 6890 gas chromatograph for detection, with a chromatographic column model: Agilent DB-23 capillary column (30m×0.25mm, 0.25μm); injection method: automatic injection; injection needle specification: 10μL, each injection volume: 2μL; split ratio: 20:1; column box temperature: 180-220℃; front inlet temperature: 250℃, front inlet pressure: 5.4psi; total front inlet flow: 17mL / min; carrier gas: nitrogen 25mL / min, hydrogen: 30mL / min, air: 400mL / min; programmed heating method: initial temperature 150℃, equilibration time 2min, heating to 220℃ at 5℃ / min-1 and maintaining for 11min; detector: flame ionization detector (FID), temperature: 250℃; each sample was tested for 18min, sample detection interval was 1min, and data sampling frequency was 20Hz / 0.1min.

[0043] The output spectrum was analyzed by Agilent Chem Station software equipped with an Agilent 6890 gas chromatograph. The relative contents (%) of the five fatty acids were calculated based on the ratio of the target fatty acid signal peak area to the total area of ​​each fatty acid signal peak using the area normalization method. Each material was tested three times.

[0044] Example 3, Result Analysis

[0045] (1) Analysis of palmitic acid content differences between the two parental materials

[0046] The palmitic acid content of the parental grains from different years and different environments was analyzed. Figure 1The fatty acid content of the two parents planted in Shijiazhuang in 2022 is shown in the figure. The palmitic acid content of the female parent Jidou 17 is 11.27%, and the palmitic acid content of the male parent Jidou 12 is 12.8%. The comparison of the fatty acid content of the parents planted in Shijiazhuang in 2023 shows that Figure 3-6 As shown: the palmitic acid content of the female parent Jidou 17 is 11.72%, and the palmitic acid content of the male parent Jidou 12 is 13.09%. Compared with the female parent Jidou 17, the palmitic acid content of the male parent Jidou 12 is significantly higher by 1.37 percentage points. This shows that there are differences in palmitic acid content between the parents. The fatty acid content of Jidou 17 and Jidou 12 harvested in Sanya in 2024 is compared. The palmitic acid content of the female parent Jidou 17 is 11.88%, and the palmitic acid content of the male parent Jidou 12 is 13.13%. Compared with the female parent Jidou 17, the palmitic acid content of the male parent Jidou 12 is significantly higher by 1.25 percentage points.

[0047] (2) Phenotypic variation and genetic analysis of fatty acid content in RIL population

[0048] As shown in Table 1, the maximum palmitic acid content in the RIL population harvested in Shijiazhuang in 2022 was 13.28%, the minimum was 10.21%, the average content was 11.94%, the standard deviation between populations was 0.55, and the coefficient of variation of palmitic acid was 4.65%. The maximum palmitic acid content in the RIL population harvested in Shijiazhuang in 2023 was 13.61%, the minimum was 10.63%, the average content was 12.09%, the standard deviation between populations was 0.51; the coefficient of variation of palmitic acid was 4.20%. The heritability of palmitic acid in the RIL population planted in Shijiazhuang from 2022 to 2023 was 0.83. The maximum value of palmitic acid content in the RIL population harvested in Sanya in 2024 was 14.05%, the minimum value was 10.91%, the average content of palmitic acid in the population was 12.38%, and the standard deviation between populations was 0.54. The coefficient of variation of palmitic acid within the population is 4.40%. The minimum heritability of palmitic acid content in Sanya cultivation in 2024 is 0.77.

[0049] The above data results indicate that the palmitic acid content of this population is subject to genetic regulation, so QTL positioning analysis can be carried out on the palmitic acid content in the grains of the RIL population.

[0050] Table 1 Phenotypic variation and genetic analysis of palmitic acid content in Shijiazhuang and Sanya RIL populations from 2022 to 2024

[0051]

[0052] The distribution kurtosis of palmitic acid content in the 2023 population was 0.22 and the skewness was -0.30; the distribution kurtosis of palmitic acid content in the RIL population material harvested in Sanya in 2024 was 0.07 and the skewness was -0.18. The fatty acid content of the RIL population in the three years showed an approximately normal distribution, which is a typical quantitative trait, such as Figure 2 shown.

[0053] Example 4: QTL Mapping of Fatty Acid Composition in RIL Population

[0054] In order to deeply analyze the genetic basis of soybean fatty acid composition, this study used the RIL population constructed by Jidou 17 and Jidou 12 to analyze the palmitic acid content of soybean seeds planted in Shijiazhuang in 2022-2023 and Sanya in 2024. Based on the constructed map, QTL IciMaping 4.1 was used to locate the QTL of fatty acid content in the RIL population.

[0055] The results are shown in Table 2. Six QTLs related to palmitic acid content were located in Shijiazhuang in 2022-2023 by QTL IciMaping 4.1, with LOD values ​​ranging from 2.93 to 6.64 and contribution rates of 5.07% to 12.54%, respectively distributed on chromosomes 2, 3, 8, 9, and 12. Among them, a QTL locus with a larger LOD value was located, qPA-2-1 on chromosome 2, with a positioning interval of Chr02_4627941-Chr02_5028055 and an LOD value of 6.64, explaining 12.54% of the phenotypic variation. Three QTLs related to palmitic acid content were detected, including two pairs of QTLs located on chromosome 2, namely qPA_2_1 and qPA_2_3, qPA_2_2 and qPA_2_4, with the positioning intervals of Chr02_4627941-Chr02_5028055 and Chr02_46571256-Chr02_47262439, with LOD values ​​of 3.94, 6.64 and 3.93, 4.51, respectively, and the phenotypic contribution rates of 7.92%, 12.54% and 7.71%, 8.5%, respectively. qPA_8_1 and qPA_8_2 located on chromosome 8, with the positioning intervals of Chr08_44829555-Chr08_45597124, with LOD values ​​of 3.45 and 3.68, respectively, explained 8.30% and 9.00% of the phenotypic variation, respectively.

[0056] QTL IciMapping 4.1 was used to locate the palmitic acid content QTL of soybean seeds harvested in Sanya in 2024, and two related QTLs were located, namely qPA_5_1 on chromosome 5, with an LOD value of 3.62, explaining 8.20% of the phenotypic variation. qPA_8_3 on chromosome 8 was also repeatedly detected in Shijiazhuang in two years, with an LOD value of 3.93, explaining 8.91% of the phenotypic variation.

[0057] Table 2 QTL mapping results of palmitic acid content in RIL population (QTL L iciMapping 4.1)

[0058]

[0059] Example 5. Development and application of Indel markers

[0060] like Figure 8 As shown, for the qPA_2_1 interval, combined with the parental resequencing data, Indel sites with a difference of more than 15 bp were screened, and primers were designed according to the flanking sequences. The results showed that between the parents, there were 15 Indel sites with a difference of more than 15 bp in the 4600000-5100000 bp interval on the chr02 chromosome.

[0061] Table 3 Detailed information of 15 Indel sites in the interval

[0062]

[0063]

[0064]

[0065] Design PCR primers for amplification and analyze them in combination with phenotypic data. The reaction system and amplification conditions for PCR amplification are as follows:

[0066] Table 4 PCR amplification reaction system

[0067]

[0068] Table 5 PCR amplification conditions are as follows:

[0069]

[0070]

[0071] Agarose gel preparation: Take 6g agarose powder, add 100ml 1×TAE buffer, and heat in a microwave oven until fully melted. Set the electrophoresis instrument voltage to 130v, and the electrophoresis time is about three and a half hours.

[0072] The results showed that the Indel at Chr02_5018100 was GT / GTGAGGTACGATAGGGGGGAGCTCGTTGCGGCGGAGCAAGTCGA T. The PCR primer sequences were designed according to the flanking sequences as follows: Chr02_5018100 FP: AGTGTGTTTTGGATGAGGTAA (SEQ ID NO. 1); Chr02_5018100 FP: GTTTAAGGGATTTTCTGCTCA (SEQ ID NO. 2).

[0073] When the length of the amplified product is 458 bp, the gene marker band type of the soybean to be tested is A, and the nucleotide sequence of 458 bp is shown in SEQ ID NO.3;

[0074] When the length of the amplified product is 501 bp, the gene marker band type of the soybean to be tested is B, and the 501 bp nucleotide sequence is shown in SEQ ID NO.4; the palmitic acid content is as follows: soybeans with gene marker band type A are greater than or are candidate greater than soybeans with gene marker band type B.

[0075] The Indel marker developed in this study was used to perform PCR amplification and electrophoresis on the high-generation materials of the RIL population, and the electrophoresis detection results were observed. For details, see the attached Figure 3-6 .

[0076] The marker was used to perform typing on 196 materials in the Jidou 17×Jidou 12 population. The ones with the same band type as the parent Jidou 12 were marked as A, those with the same band type as the parent Jidou 17 were marked as B, and H was a heterozygous type. Figure 7 As shown in Tables 6 and 7, combined with the phenotypic data results, there were 67 materials with type A in 2022, and the corresponding mean palmitic acid content was 0.1203; there were 69 materials with type B, and the corresponding mean palmitic acid content was 0.1180. There were significant differences between groups A and B, with a P value of 0.0155. There were 73 materials with type A in 2023, and the corresponding palmitic acid content was 0.1216; there were 87 materials with type B, and the corresponding palmitic acid content was 0.1199. There were significant differences between groups A and B, with a P value of 0.0397. There were 72 materials with type A in 2024, and the corresponding palmitic acid content was 0.1249; there were 86 materials with type B, and the corresponding palmitic acid content was 0.1221. There were significant differences between groups A and B, with a P value of 0.0019.

[0077] Table 6 Specific results of Indel marker typing in RIL population

[0078]

[0079]

[0080]

[0081]

[0082]

[0083] Table 7 Indel marker typing of RIL population and the results of association analysis on palmitic acid content in grains

[0084]

[0085] The analysis results in Table 7 show that the differences in palmitic acid content of the two gene marker bands formed in the subpopulations composed of soybeans of band type 2022, band type 2023 and band type 2024 all reached a significant level (P<0.05).

[0086] This marker can effectively distinguish two gene marker band types and has a co-dominant characteristic; this marker can be used to assist in screening soybean offspring materials with high palmitic acid content.

[0087] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0088] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0089] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. An InDel molecular marker primer for identifying soybeans with high palmitic acid content, characterized in that: The nucleotide sequence of the upstream primer of the InDel molecular marker primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. Use of the InDel molecular marker primer according to claim 1 in identifying soybeans with high palmitic acid content.

3. An InDel molecular marker for identifying soybeans with high palmitic acid content, characterized in that: The InDel molecular marker is a sequence amplified using the soybean genome as a template and the InDel molecular marker primer; the upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2; the nucleotide sequence amplified by the InDel molecular marker primer is shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. A kit for identifying soybeans with high palmitic acid content, characterized in that: The kit comprises the InDel molecular marker primer according to claim 1.

5. A method for identifying soybeans with high palmitic acid content using the InDel molecular marker primers according to claim 1, characterized in that: The following steps are involved: (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain a PCR amplification product; (2) Detect the amplified product by agarose gel electrophoresis and observe the electrophoresis detection results.

6. The method according to claim 5, characterized in that The reaction system of step (1) PCR amplification is as follows: in a 20 µL reaction system, 1 µL of DNA template, 1 µL of forward primer and 1 µL of reverse primer, 6 µL of ddH2O and 10 µL of 2×Mix.

7. The method according to claim 5, characterized in that The reaction procedure of step (1) PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 93°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 5 min, and storage at 4°C.

8. The method according to claim 5, characterized in that The mass concentration of agarose gel in step (2) is 6%.

9. The method according to claim 5, characterized in that When the length of the amplified product is 458bp, the gene marker band type of the soybean to be tested is A; when the length of the amplified product is 501bp, the gene marker band type of the soybean to be tested is B; the palmitic acid content is: soybeans with gene marker band type A are greater than or are candidate greater than soybeans with gene marker band type B.

10. Use of the InDel molecular marker primer according to claim 1 or the InDel molecular marker according to claim 3 in soybean molecular marker-assisted breeding.

Images