HPV (human papillomavirus) nucleic acid detection kit based on digital PCR (polymerase chain reaction) method

Abstract

The invention relates to an HPV (human papillomavirus) nucleic acid detection kit based on a digital PCR (dPCR) method and a use method of the HPV nucleic acid detection kit. The detection kit disclosed by the invention comprises a dPCR primer premix solution, wherein the dPCR primer premix solution comprises primers and probes of the HPV16 type, the HPV18 type and an internal standard. The detection kit disclosed by the invention is high in sensitivity and good in accuracy, and is particularly suitable for detecting the HPV ctDNA in a peripheral blood sample.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to an HPV nucleic acid detection kit based on a digital PCR (dPCR) method. Background Art

[0002] HPV, or human papillomavirus, belongs to the genus Papillomavirus A of the family Papovaviridae. It is a spherical DNA virus that can cause squamous epithelial proliferation in the skin and mucous membranes of the human body. HPV is a double-stranded small molecule DNA virus, about 8kb long, and its genome is divided into three parts: the early gene region (E), the late gene region (L) and the long regulatory region (LCR). The early gene region (E1-E7) is expressed in the early stage of viral infection and plays an important role in transcription, plasmid replication and translation.

[0003] HPV is clinically divided into high-risk and low-risk types according to the pathogenicity of HPV subtypes or the risk of promoting host cell malignancy. HPV6 and HPV11 are the most common low-risk types in clinical practice, while HPV16 and HPV18 are the most common high-risk types.

[0004] HPV is a virus that can cause cancer in humans, especially in women, where it is closely associated with the development of cervical cancer. In addition, HPV is also associated with other types of cancer, including anal cancer, penile cancer, and vulvar cancer.

[0005] In patients with HPV-induced tumors, HPV ctDNA can be present in the blood, which is mainly attributed to the DNA fragments released by tumor cells during growth and division caused by HPV infection. These DNA fragments may exist in the form of exosomes or be integrated into tumor DNA and then enter the blood circulation. Therefore, HPV ctDNA can be used as a tumor marker to monitor the progression of the disease and evaluate the efficacy of treatment.

[0006] By detecting HPV ctDNA in the blood, the status of tumor cells can be discovered in time, providing an important basis for early detection and intervention of the disease. At the same time, changes in the content of HPV ctDNA can also be used as a reference indicator for evaluating the effectiveness of treatment, helping doctors adjust treatment plans and improve patients' survival rate and quality of life.

[0007] However, it should be noted that due to the low content of HPV ctDNA in peripheral blood samples, how to accurately detect these low-content nucleic acids is a technical difficulty in this field. Summary of the invention

[0008] In order to improve the sensitivity of HPV nucleic acid detection, the present invention adopts the method of digital PCR. Digital PCR technology is called the "third generation" PCR technology in the industry. Unlike qPCR, digital PCR technology disperses the diluted reaction system into multiple separated tiny independent reaction units (droplets), each of which contains or does not contain target molecules. After the PCR amplification is completed, the fluorescent signals of all droplets are identified and counted to obtain the number of negative and positive droplets. The concentration of the target molecule is calculated by the Poisson distribution principle, thereby achieving absolute quantification of the target molecule. The result judgment of digital PCR does not depend on the standard curve and is not affected by the PCR amplification efficiency. In addition, the digital PCR detection system uses droplet processing to separate rare detection fragments from a large amount of complex background, further improving the detection sensitivity and accuracy.

[0009] However, when actually developing an HPV nucleic acid detection kit, the primer-probe combination obtained according to the conventional design method is used on a digital PCR instrument for peripheral blood sample detection, but there is still a problem of insufficient sensitivity. After many explorations, it was found that the conventional design method uses Taqman probes, which require the upstream primer, probe, and downstream primer to match the target (that is, the HPV nucleic acid to be detected), and the target length requirements are higher: targets above a certain length can be detected, while targets below this length cannot be detected. HPV nucleic acids free in peripheral blood samples may be fragmented, and primer probes designed according to conventional methods cannot accurately detect shorter HPV nucleic acids. Therefore, the detection sensitivity of HPV nucleic acids needs to be further improved.

[0010] To this end, the present invention innovatively designs the primer-probe combination in the kit: the probe does not match the target, only the upstream primer and the downstream primer match the target. This design has lower requirements on the length of the target and is more conducive to accurately detecting shorter HPV nucleic acids.

[0011] At the same time, some new problems that need to be further solved were found: since the digital PCR analysis system of the present invention needs to take a picture of the reaction well as a whole, if the threshold division of the intensity of the fluorescence signal in the droplet is not clear, it will lead to the misreading of positive and negative droplets, affecting the accuracy of the detection results. Therefore, it is necessary to distinguish the fluorescence signal of the target (positive droplet) in the reaction unit from other background signals or non-specific signals (negative droplets).

[0012] In addition, in order to achieve accurate detection of HPV16, HPV18 and internal standards in a single tube and improve the signal concentration of each target, it is necessary to further optimize the uniformity of primer amplification efficiency and primer probe specificity in the detection kit.

[0013] Based on this, one of the purposes of the present invention is to provide an HPV nucleic acid detection kit based on the digital PCR method to achieve simultaneous detection of HPV16 and HPV18 viruses. The kit includes a dPCR primer premix, which includes primers and probes for HPV16, HPV18 and internal standards; wherein, The upstream primer F for HPV type 16 is: ACCTCCGACGAATCTCAACCGGAGGCTGTGAGCTGGCTGTAGGAGGATGAAATAGATGG; The downstream primer R for HPV16 type is: CTGTCCGGTTCTGCTTGT; The probe for HPV16 type is: CCGGAGGCTGTGAGCTGGCTGT; The upstream primer F0 for HPV16 type is: ACCTCCGACGAATCTCAA; The upstream primer F of HPV18 type is: ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGAGAGGCCAGTGCCATTCGT; The downstream primer R for HPV18 type is: TCCTGTCGTGCTCGGTTGC; The probe for HPV18 type is: CCAGACGAATTCGTGGTGGTGACGG; The upstream primer F0 of HPV18 type is: ACCTTGCTCGTATCTCTT; The upstream primer of the internal standard was: CTCAGCCTCAGAGGATGT; The downstream primers for the internal standard were: CCTGGATGGTCTTTAAGAAGGAAAGATC; The internal standard probe was: TCCAAATTCCCAAGGACCACC; The modification groups of the HPV16 probe, HPV18 probe and internal standard probe are different from each other, so that HPV16, HPV18 and internal standard appear as positive droplets when photographed under different fluorescence channels.

[0014] The above-mentioned digital PCR method refers to the use of a kit in combination with a digital PCR instrument. In certain embodiments, the digital PCR method refers to the use of a kit in combination with a camera-type digital PCR instrument. In certain embodiments, the digital PCR instrument refers to an instrument that uses vibration-type droplet generation technology to generate droplets and spreads them into reaction wells, and performs overall fluorescence photography detection on the reaction wells after amplification. In certain embodiments, the digital PCR instrument is the D 600 series digital PCR analysis system produced by Mike Biotech.

[0015] In certain embodiments, in the above-mentioned HPV nucleic acid detection kit, the fluorescent reporter group modified at the 5' end of the HPV16 probe is Cy5, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the HPV18 probe is ROX, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the internal standard probe is HEX, and the quencher group modified at the 3' end is BHQ1.

[0016] In certain embodiments, the concentrations of the HPV16 primers and probes in the above-mentioned dPCR primer premix are respectively the same as the concentrations of the HPV18 primers and probes; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​the same as the concentration of their downstream primer R; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​4 to 10 times the concentration of their upstream primer F; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​2 to 5 times the concentration of their probes.

[0017] In certain embodiments, the concentrations of the internal standard upstream primer and downstream primer in the dPCR primer premix are the same; the concentrations of the internal standard upstream primer and probe in the dPCR primer premix are the same as the concentrations of the HPV16 upstream primer F0 and probe, respectively.

[0018] In certain embodiments, the working concentrations of the primers and probes for HPV16, HPV18 and the internal standard in the above-mentioned dPCR primer premix are 50~1000nM respectively (that is, the working concentrations of the primers and probes for HPV16, HPV18 and the internal standard in the dPCR primer premix are all in the range of 50~1000nM).

[0019] In certain embodiments, in the above HPV nucleic acid detection kit, the working concentrations of the primers and probes for HPV16, HPV18 and the internal standard in the dPCR primer premix are: Upstream primer F for HPV16: 80 nM; Downstream primer R for HPV16: 400 nM; HPV16 probe: 200 nM; Upstream primer F0 for HPV16: 400 nM; Upstream primer F for HPV18: 80 nM; Downstream primer R for HPV18: 400 nM; HPV18 probe: 200 nM; Upstream primer F0 for HPV18: 400 nM; Upstream primer of internal standard: 400 nM; Downstream primer of internal standard: 400 nM; Internal standard probe: 200 nM.

[0020] In certain embodiments, the above-mentioned HPV nucleic acid detection kit also includes a blank control, a negative control and a positive control; the blank control is nuclease-free water; the negative control is 100 copies / μL of human genomic DNA; the positive control contains 100 copies / μL of HPV16 standard plasmid, 100 copies / μL of HPV18 standard plasmid and 100 copies / μL of human genomic DNA.

[0021] Another object of the present invention is to provide a method for using an HPV nucleic acid detection kit, comprising the following contents: (1) Mixing the dPCR primer premix in the above detection kit with the amplification reagent and the sample to be tested to obtain a reaction system; (2) randomly distributing the reaction system into more than 5,000 droplets, some of which contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested, and the droplets are spread evenly in the reaction wells; (3) Performing PCR amplification on the droplets in the reaction well; (4) Perform fluorescence photography on the reaction wells and obtain the number of targets in the sample to be tested based on the number of droplets with signals in the reaction wells.

[0022] In step (2), “some droplets contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested” means that each droplet contains the target of the sample to be tested or does not contain the target of the sample to be tested. Theoretically, each droplet contains at most 1 target of the sample to be tested. However, in actual operation, a very small number of droplets may contain 2 or a few targets of the sample to be tested. The situation where a droplet contains multiple targets is very rare and has little effect on the calculation of the target quantitative value. Therefore, each droplet containing 0 target, 1 target, 2 targets or a few targets is within the scope of protection of the present invention.

[0023] In some embodiments, the amplification reagent in step (1) includes DNA polymerase and dNTPs. In some embodiments, the amplification reagent may also include some reagents that promote PCR reaction, such as KCl, MgCl 2 , Tris-HCl, trehalose, (NH 4 ) 2 SO 4 wait.

[0024] In some embodiments, the PCR amplification procedure in step (3) is: 95°C for 2 min; 95°C for 20 sec, 56°C for 30 sec, 30 to 50 cycles. In some embodiments, the PCR amplification procedure is: 95°C for 2 min; 95°C for 20 sec, 56°C for 30 sec, 45 cycles.

[0025] In certain embodiments, the PCR amplification in step (3) includes the following: the upstream primer F and the downstream primer R specifically bind to the target and extend to generate a first amplicon; the first amplicon specifically binds to the upstream primer F0 and the probe respectively, and during the extension of the upstream primer F0 with the first amplicon as the target, the probe is hydrolyzed, causing the fluorescent reporter group modified on the probe to emit light.

[0026] In certain embodiments, in step (4), the reaction wells are photographed for fluorescence detection, and the quantitative value of the target in the sample to be tested is calculated according to the number of droplets with signals and the number of droplets without signals in the reaction wells according to the Poisson distribution.

[0027] Beneficial Effects The HPV nucleic acid detection kit of the present invention has the following advantages: (1) Low requirement for target length: The length of the amplicon formed after the primers in the detection kit of the present invention bind to the target is 40-50 bp. When the length of the target is above 40-50 bp, it can be accurately detected, and is particularly suitable for the detection of HPV ctDNA in peripheral blood samples; (2) High accuracy: Based on the digital PCR method, the present invention optimizes the design of the primer probes in the detection kit, and the detection result has a low negative background, a high signal-to-noise ratio and a high signal concentration, and a high detection accuracy; (3) Multiple detection and high specificity: The present invention can accurately detect HPV16 and HPV18 at the same time; and the probes of the two types do not bind to the target, the sequence differences between the probes are large, and there is no cross-talk between the two, so the detection specificity is high; (4) Avoiding missed detection: The detection target gene of most HPV fluorescent PCR kits is the L1 gene. The L1 gene is easily lost during the gene integration process, which poses a risk of missed detection. The detection target genes of the kit of the present invention are the E6 and E7 genes of HPV. The E6 / E7 genes continue to exist during the integration process of the HPV genome, which can avoid the possibility of missed detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The result of the blank detection limit detection in Example 2 (HEX channel); Figure 2 The result of the blank detection limit detection in Example 2 (Cy5 channel); Figure 3 The result of the blank detection limit detection in Example 2 (ROX channel); Figure 4 The result of the minimum detection limit detection in Example 2 (Cy5 channel); Figure 5 The result of the minimum detection limit detection in Example 2 (ROX channel); Figure 6 The result of the precision test in Example 2 (HEX channel); Figure 7 The result of the precision test in Example 2 (Cy5 channel); Figure 8 The result of the precision test in Example 2 (ROX channel); Fig. 9 The results of clinical testing in Example 3 (HEX channel); Fig.10 The result of clinical testing in Example 3 (ROX channel); Fig.11 The result of clinical detection in Example 3 (Cy5 channel); Fig.12 The detection result of the first set of primer probe groups in Example 4 (ROX channel); Fig.13 The detection result of the first set of primer probe groups in Example 4 (Cy5 channel); Fig.14 The detection result of the second set of primer probe groups in Example 4 (ROX channel); Fig.15 The detection result of the second set of primer probe groups in Example 4 (Cy5 channel); Fig.16 The detection result of the third set of primer probe groups in Example 4 (ROX channel); Fig.17The detection result of the third set of primer probe groups in Example 4 (Cy5 channel); Fig.18 The detection result of the fourth set of primer probe group in Example 4 (ROX channel); Fig.19 This is the detection result of the fourth set of primer probe groups in Example 4 (Cy5 channel). DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Example 1 The present invention provides a HPV nucleic acid detection kit based on a digital PCR method.

[0031] 1. Kit composition The kit consists of: dPCR primer premix, blank control, negative control and positive control. The dPCR primer premix contains primers and probes for HPV16, HPV18 and internal standards; the main component of the blank control is nuclease-free water; the negative control is 100 copies / μL human genomic DNA; the positive control contains 100 copies / μL of HPV16 standard plasmid, 100 copies / μL of HPV18 standard plasmid and 100 copies / μL of human genomic DNA.

[0032] The specific sequences of the primer probes included in the dPCR primer premix are shown in Table 1: Table 1 Primer / probe name Serial Number Sequence (5'-3') Modification HPV16-F SEQ ID NO.1 ACCTCCGACGAATCTCAACCGGAGGCTGTGAGCTGGCTGTAGGAGGATGAAATAGATGG / HPV16-R SEQ ID NO.2 CTGTCCGGTTCTGCTTGT / HPV16-P SEQ ID NO.3 CCGGAGGCTGTGAGCTGGCTGT 5'Cy5, 3'BHQ2 HPV16-F0 SEQ ID NO.4 ACCTCCGACGAATCTCAA / HPV18-F SEQ ID NO.5 ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGAGAGGCCAGTGCCATTCGT / HPV18-R SEQ ID NO.6 TCCTGTCGTGCTCGGTTGC / HPV18-P SEQ ID NO.7 CCAGACGAATTCGTGGTGGTGACGG 5'ROX, 3'BHQ2 HPV18-F0 SEQ ID NO.8 ACCTTGCTCGTATCTCTT Human-F SEQ ID NO.9 CTCAGCCTCCAGAGGATGT / Human-R SEQ ID NO.10 CCTGGATGGTCTTTAAGAAGGAAAGATC / Human-P SEQ ID NO.11 TCCAAATTCCCAAGGACCACC 5'HEX, 3'BHQ1 2. How to use the kit The method of using the HPV nucleic acid detection kit of the present invention is as follows; 2.1 Reagent preparation (performed in the reagent preparation area) 2.1.1 Take out each component from the kit, place it at room temperature, wait for the temperature to equilibrate to room temperature, mix well, and centrifuge for standby use.

[0033] 2.2 Sample processing (carried out in the sample processing area) 2.2.1 Extraction of cell-free nucleic acid (cfDNA) from plasma samples Plasma samples were extracted using the magnetic bead-based large-volume free nucleic acid extraction kit (Tiangen, DP710-01) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific operation steps were carried out according to its product instructions.

[0034] 2.2.2 Sample addition Add 10 μL of blank control, positive control and nucleic acid of the sample to be tested to the PCR reaction tube with dPCR primer premix and amplification reagent to form a reaction system with a final volume of 25 μL. Cover the tube tightly, mix well, centrifuge at low speed to remove bubbles and set aside.

[0035] Each reaction system includes the following working concentrations of dPCR primer premix and amplification reagent, as shown in Table 2: Table 2

[0036] 2.3 Droplet preparation, PCR amplification and photo detection based on digital PCR instrument Place the PCR reaction tube with the sample added on the sample rack of the digital PCR instrument for droplet preparation and PCR amplification; droplet preparation is to randomly distribute the reaction system into more than 5,000 droplets, each droplet contains the target of the sample to be tested or does not contain the target of the sample to be tested, and the above droplets are spread in the reaction well. Perform PCR amplification on each droplet in the reaction well, and the reaction conditions are: denaturation at 95℃ for 2min; denaturation at 95℃ for 20sec, extension at 56℃ for 30sec, and a total of 30 to 50 cycles.

[0037] After PCR amplification is completed, the reaction wells are photographed for fluorescence detection, and the number of targets in the sample to be tested is obtained based on the number of droplets with signals in the reaction wells.

[0038] For example, the D 600 series digital PCR analysis system of MicroBio can be used for droplet preparation, PCR amplification and photo detection. The specific contents are as follows: 2.3.1 Page Settings Open the application software, select Design-Task in sequence, select the sample tube and the corresponding position; in the property item, select the probe method for the experimental method, select 20k for the number of single sample droplets, and select 1nL for the droplet volume; in the program item, check Oiling-Printing-PCR temperature control, check Constant temperature photography, and set the temperature to 58°C; check Customization in the print item, check Synchronous printing of the photography position in the photography position item; select the corresponding wells in the print position and photography position; set the photography option item as shown in Table 3, and click Apply.

[0039] Table 3

[0040] 2.3.2 Set the PCR program and cycle parameters in the method interface. The settings are shown in Table 4: Table 4

[0041] 2.3.3 After the settings are completed, save the file, click Run-Confirm Consumables, open the caps of the PCR 8-tube strips in turn, and put the PCR 8-tube strips into the instrument sample slot; confirm the injection needle and position; put the waste liquid box, liquid removal cotton and 32-well plate in place. Click Start Experiment, and then confirm the Run Experiment again to start running.

[0042] 2.4. Results The results are automatically saved after the test is completed. The thresholds of different targets are adjusted according to the corresponding blanks (the principle of setting the threshold line is to just exceed the fluorescence background value of the blank control, and the highest point of the fluorescence background value of the sample is taken as the basis). The results are viewed in the analysis data interface.

[0043] Results of blank control: there were no positive droplets in ROX channel, Cy5 channel and HEX channel, that is, the internal standard channel, HPV16 and HPV18 type tests were all negative; results of negative control: there were no positive droplets in ROX channel and Cy5 channel, and the positive droplets in HEX channel were obviously aggregated, that is, the internal standard channel tests were all positive, and the HPV16 and HPV18 type tests were negative; results of positive control: the positive droplets in ROX channel, Cy5 channel and HEX channel were obviously aggregated, that is, the internal standard channel, HPV16 and HPV18 type tests were all positive; results of clinical samples: the internal standard channel test was positive, and the positive and negative HPV16 and HPV18 types were consistent with the known positive and negative clinical samples.

[0044] Example 2 Performance test of HPV nucleic acid detection kit For the HPV nucleic acid detection kit of Example 1, the blank limit, minimum detection limit and precision performance tests were performed according to the usage method of Example 1.

[0045] 1. Blank limit detection 1.1 Solution (1) Detecting 20 negative samples using the detection reagent in the kit of Example 1; (2) Standard: Sort the obtained data results from small to large, and take the 95% detection value as the LOB value; (3) Instruments and equipment: MicroBio D600 digital PCR analysis system.

[0046] 1.2 Results are shown in Tables 5 and Figures 1 to 3 As shown: Table 5

[0047] 1.3 Conclusion In Table 5, sample numbers 1 to 20 are negative samples; sample numbers 21 to 22 are blank controls; and sample numbers 23 to 24 are positive controls. Figures 1 to 3It can be seen that: (1) There were no false positive droplets in all wells of the 20 negative sample test results; (2) The LOB performance of HPV16 and HPV18 was good, with 0 copies / μL.

[0048] 2. Minimum detection limit detection 2.1 Solution (1) HPV16 positive samples: 3.44E4 copies / μL (3.44×10 4 The gDNA sample was diluted to a concentration of 0.344 copies / μL, 10 μL of sample was added to each reaction, and the sample with 3.44 copies / reaction was tested 20 times with the amplification reagent; (2) HPV18 positive samples: 4.67E4 copies / μL (4.67×10 4 The gDNA samples with a concentration of 0.467 copies / reaction were diluted to prepare samples with a concentration of 0.467 copies / reaction. 10 μL of the samples were added to each reaction, and the samples with a concentration of 4.67 copies / reaction were tested 20 times with the amplification reagent. (3) A positive detection rate of ≥95% (19 / 22) was used as the standard for determining LOD; (4) Instruments and equipment: MicroBio D600 digital PCR analysis system.

[0049] 2.2 Results are shown in Tables 6 and Figures 4 and 5 As shown: Table 6

[0050] 2.3 Conclusion In Table 6, sample numbers 1 to 20 are positive samples (HPV16 positive samples or HPV18 positive samples); sample numbers 21 to 22 are HPV18 positive controls; and sample numbers 23 to 24 are HPV16 positive controls.

[0051] From Table 6 and Figures 4 to 6 It can be seen that the amplification reagent was used to perform 20 repeated tests on HPV16 samples with a concentration of 3.44 copies / reaction, and its positive detection rate was 100%; the HPV18 samples with a concentration of 4.67 copies / reaction were tested 20 times, and its positive detection rate was 100%.

[0052] 3. Precision testing 3.1 Solution (1) Mix 3.44E4copies / μL of HPV16 gDNA sample and 4.67E4copies / μL of HPV18 gDNA sample, and manually dilute to make a sample with a theoretical concentration of 15copies / μL for HPV16 and HPV18. Add 10μL of sample to each reaction, and use amplification reagent to test the sample with a theoretical concentration of 150copies / reaction 20 times; (2) The coefficient of variation (CV, %) of the test results ≤ 10.0% is used as the standard for evaluating the precision of the reagent; (3) Instruments and equipment: MicroBio D600 digital PCR analysis system.

[0053] 3.2 Results are shown in Tables 7 and Figures 6-8 As shown: Table 7

[0054] 3.3 Conclusion In Table 7, sample codes 1 to 20 are 20 tests on samples with a concentration of 150 copies / reaction; sample codes 21 to 22 are negative controls; and sample codes 23 to 24 are positive controls.

[0055] From Table 7 and Figures 6-8 It can be seen that: (1) the CV value of the reagent for HPV16 samples with a concentration of 150 copies / reaction is 7.12%; the CV value for HPV18 samples with a concentration of 150 copies / reaction is 7.81%; (2) the intra-batch precision performance of this reagent is good.

[0056] Example 3 Clinical testing of HPV nucleic acid detection kit The HPV nucleic acid detection kit of Example 1 was used to perform clinical sample detection according to the method of use of Example 1.

[0057] (1) Test objects: clinical plasma samples of known positive and negative nature (including 5 positive plasma samples and 8 negative plasma samples); positive control, negative control and blank control were tested simultaneously; (2) Instruments and equipment: MicroBio D600 digital PCR analysis system.

[0058] The test results are shown in Table 8 and Figures 9-11 As shown: Table 8 Sample No. HPV18 type concentration (copies / μL) HPV16 type concentration (copies / μL) Internal standard quantitative value (copies / μL) Theoretical yin and yang Actual yin and yang Negative and positive coincidence rate 1 0 1.25 45.86 + + √ 2 0 0 12.38 - - √ 3 0 0 14.34 - - √ 4 0 0 8.93 - - √ 5 0 0 9.66 - - √ 6 0 11.92 9.45 + + √ 7 0 16.07 9.63 + + √ 8 0 0 10.6 - - √ 9 0 0 15.18 - - √ 10 0 0 20.81 - - √ 11 0 0.77 17.39 + + √ 12 0 0 13.54 - - √ 13 0 2.6 76.91 + + √ 14 18.13 18.87 44.68 + + √ 15 0 0 83.83 - - √ 16 0 0 0 - - √ In Table 8, samples 1 to 13 are clinical plasma samples; sample 14 is a positive control; sample 15 is a negative control; and sample 16 is a blank control.

[0059] From Table 8 and Figures 9-11 It can be seen that the internal standard channel detections were all positive, and the positive and negative HPV16 and HPV18 types were consistent with the positive and negative known clinical samples.

[0060] Example 4 Primer and probe screening for HPV nucleic acid detection kit Four sets of specific primer probe groups were designed for the E6 and E7 gene sequences of HPV, and they were mixed with the internal standard primer probes (SEQ ID NO.9-11) in one tube to perform digital PCR detection on positive samples (including HPV16 positive and HPV18 positive mixed samples) and blank controls (NTC). Except that the primer probe sequences of HPV16 and HPV18 are different from those in Example 1, the dosage of primer probes, the components and contents of amplification reagents, and the specific detection method are the same as those in Example 1.

[0061] The sequences of the initial screening primer probe set are shown in Table 9: Table 9

[0062] The above four sets of primer probes were mixed with the internal standard primer probes respectively, and then digital PCR was performed. The test results were as follows: Figures 13 to 19 shown.

[0063] from Figures 12 to 19 It can be seen that: the Cy5 channel in the first set of primer-probe combinations is normal (the droplet threshold of the positive sample is clearly divided, and there is no positive droplet in NTC), but the ROX channel has an extremely low signal-to-noise ratio due to the high background signal, and the threshold line cannot be divided; the signal-to-noise ratio of the two channels in the second set of primer-probe combinations is normal, but there is non-specific amplification in the ROX channel, resulting in a small number of false positive droplets in NTC; the signal-to-noise ratio of the two fluorescence channels in the third set of primer-probe combinations is normal, but there is non-specific amplification in the Cy5 channel, resulting in a small number of false positive droplets in NTC; the ROX channel in the fourth set of primer-probe combinations is normal, but the Cy5 channel has an extremely low signal-to-noise ratio due to the high background signal, and the threshold line cannot be divided. Since the above four sets of primer-probe combinations have problems, resulting in inaccurate quantitative values, further improvements are needed.

Claims

1. A HPV nucleic acid detection kit based on a digital PCR method, comprising a dPCR primer premix, wherein the dPCR primer premix comprises primers and probes for HPV16, HPV18 and an internal standard; characterized in that: The upstream primer F of HPV16 type is: ACCTCCGACGAATCTCAACCGGAGGCTGTGAGCTGGCTGTAGGAGGATGAAATAGATGG; The downstream primer R of HPV16 type is: CTGTCCGGTTCTGCTTGT; The HPV16 probe is: CCGGAGGCTGTGAGCTGGCTGT; The upstream primer F0 of the HPV16 type is: ACCTCCGACGAATCTCAA; The upstream primer F of HPV18 type is: ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGAGAGGCCAGTGCCATTCGT; The downstream primer R of HPV18 type is: TCCTGTCGTGCTCGGTTGC; The HPV18 probe is: CCAGACGAATTCGTGGTGGTGACGG; The upstream primer F0 of the HPV18 type is: ACCTTGCTCGTATCTCTT; The upstream primer of the internal standard is: CTCAGCTCCAGAGGATGT; The downstream primer of the internal standard is: CCTGGATGGTCTTTAAGAAGGAAAGATC; The internal standard probe is: TCCAAATTCCCAAGGACCACC; The modification groups of the HPV16 probe, the HPV18 probe and the internal standard probe are different from each other.

2. The HPV nucleic acid detection kit according to claim 1, characterized in that: The fluorescent reporter group modified at the 5' end of the HPV16 probe is Cy5, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the HPV18 probe is ROX, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the internal standard probe is HEX, and the quencher group modified at the 3' end is BHQ1.

3. The HPV nucleic acid detection kit according to claim 1, characterized in that: The concentrations of the HPV16 primer and probe in the dPCR primer premix are respectively the same as the concentrations of the HPV18 primer and probe; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​the same as the concentration of their downstream primer R; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​4 to 10 times the concentration of their upstream primer F; the concentration of the upstream primer F0 of HPV16 and HPV18 in the dPCR primer premix is ​​2 to 5 times the concentration of their probe.

4. The HPV nucleic acid detection kit according to claim 2, characterized in that: The concentrations of the internal standard upstream primer and downstream primer in the dPCR primer premix are the same; the concentrations of the internal standard upstream primer and probe in the dPCR primer premix are the same as the concentrations of the HPV16 upstream primer F0 and probe, respectively.

5. The HPV nucleic acid detection kit according to claim 3 or 4, characterized in that: The working concentrations of the primers and probes for HPV16, HPV18 and internal standards in the dPCR primer premix are 50-1000 nM, respectively.

6. The HPV nucleic acid detection kit according to claim 4, characterized in that: The working concentrations of the primers and probes for HPV16, HPV18 and internal standards in the dPCR primer premix are: Upstream primer F for HPV16: 80 nM; Downstream primer R for HPV16: 400 nM; HPV16 probe: 200 nM; Upstream primer F0 for HPV16: 400 nM; Upstream primer F for HPV18: 80 nM; Downstream primer R for HPV18: 400 nM; HPV18 probe: 200 nM; Upstream primer F0 for HPV18: 400 nM; Upstream primer of internal standard: 400 nM; Downstream primer of internal standard: 400 nM; Internal standard probe: 200 nM.

7. The HPV nucleic acid detection kit according to claim 1, characterized in that: The detection kit also includes a blank control, a negative control and a positive control; the blank control is nuclease-free water; the negative control is 100 copies / μL of human genomic DNA; the positive control contains 100 copies / μL of HPV16 standard plasmid, 100 copies / μL of HPV18 standard plasmid and 100 copies / μL of human genomic DNA.

8. The method for using the HPV nucleic acid detection kit according to any one of claims 1 to 7, characterized in that: It includes the following: (1) Mixing the dPCR primer premix according to any one of claims 1 to 6 with an amplification reagent and a sample to be tested to obtain a reaction system; (2) randomly distributing the reaction system into more than 5,000 droplets, some of which contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested; the droplets are spread evenly in the reaction well; (3) Performing PCR amplification on the droplets in the reaction well; (4) Perform fluorescence photography on the reaction wells and obtain the number of targets in the sample to be tested based on the number of droplets with signals in the reaction wells.

9. The method of use according to claim 8, characterized in that: The amplification reagent in step (1) includes DNA polymerase and dNTPs.

10. The method of use according to claim 8, characterized in that: The procedure of PCR amplification in step (3) is: React at 95℃ for 2min; react at 95℃ for 20sec, react at 56℃ for 30sec, and repeat for 30~50 cycles.

Images