Application of reagent for inhibiting or interfering PHGDH gene expression in preparation of medicine for treating leukemia

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a reagent for inhibiting or interfering PHGDH gene expression in preparation of drugs for treating leukemia. The medicine for treating leukemia comprises a reagent for inhibiting or interfering PHGDH gene expression, and leukemia means that t is less than 8; and 21) AML. According to the invention, PHGDH is taken as a target spot; the application angle of the PHGDH in the t (8; 21) AML is researched and analyzed, and the application angle of the PHGDH in the t (8; 21) AML, for deep exploration of t (8; according to the present invention, the new prognosis related molecule or treatment target is searched, such that the important significance is provided for the improvement of the treatment effect and the prognosis of the patients.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of a reagent for inhibiting or interfering with PHGDH gene expression in the preparation of a drug for treating leukemia. Background Art

[0002] Leukemia is a common hematological malignancy, and acute myeloid leukemia (AML) is the most common type of leukemia. AML has the characteristics of complex pathogenesis, rapid disease progression, high drug resistance and relapse rate, and high mortality rate. Genetic abnormality is one of the most important molecular mechanisms of AML. t(8;21)AML is a leukemia caused by the translocation of chromosomes 8 and 21, and is one of the most common lethal hematological malignancies. Currently, the commonly used clinical treatments for t(8;21)AML include standard chemotherapy, bone marrow transplantation, and targeted drug combined with chemotherapy. These treatments can achieve a complete remission rate of 80% for t(8;21)AML, but the treatment process still faces challenges such as high chemotherapy toxicity, death of some patients due to intolerance, drug resistance, low success rate of bone marrow transplantation matching, and high cost. In addition, 30%-40% of patients face the risk of relapse after chemotherapy or bone marrow transplantation remission, and eventually die due to factors such as refractory drug resistance. Part of the reason for this problem is that the pathogenesis of t(8;21) leukemia has not been fully elucidated, and there is a lack of effective targets and targeted drugs.

[0003] PHGDH is a key enzyme in the serine metabolism process, acting on the first step of the serine de novo synthesis pathway. In recent years, many studies have reported that PHGDH plays an important role in the occurrence and development of some tumors (breast cancer, melanoma, cervical cancer, nasopharyngeal carcinoma, small intestine cancer, pancreatic cancer, etc.), and inhibiting PHGDH will reduce serine synthesis, leading to inhibition of cell proliferation, increased cell apoptosis, and weakened cell invasion ability. In the prior art, there are no relevant reports on the role of PHGDH in t(8;21)AML, and there is no relevant research on whether inhibiting the expression of PHGDH can inhibit the occurrence and development of t(8;21)AML. Therefore, in-depth research on the mechanism of action of PHGDH in t(8;21)AML is conducive to further understanding the pathogenesis of t(8;21)AML, and it is expected to become a new target for tumor treatment. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide an agent for inhibiting or interfering with the expression of PHGDH gene for use in the preparation of a drug for treating leukemia.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] Provided is a use of a reagent for inhibiting or interfering with PHGDH gene expression in preparing a drug for treating leukemia. The drug for treating leukemia comprises the reagent for inhibiting or interfering with PHGDH gene expression. The leukemia refers to t(8;21)AML.

[0007] Furthermore, an agent that inhibits or interferes with the expression of the PHGDH gene means that the agent inhibits the activity of the PHGDH gene and / or reduces the expression level of the PHGDH gene.

[0008] Furthermore, the agent for inhibiting or interfering with the expression of the PHGDH gene is to knock down the PHGDH gene by constructing a shRNA lentiviral vector for PHGDH;

[0009] The PCR primers for constructing the PHGDH shRNA lentiviral vector are:

[0010] Sense primer: CAGGACTGTGAAGGCCTTATT;

[0011] Antisense primer: AATAAGCCTTCACAGTCCTG.

[0012] The beneficial effects of the present invention are:

[0013] The present invention studies and analyzes the application of PHGDH as a target in t(8;21)AML, clarifies the role of PHGDH in t(8;21)AML, and is of great significance for in-depth exploration of the pathogenesis of t(8;21)AML, finding new prognosis-related molecules or therapeutic targets, and improving the efficacy and prognosis of such patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a schematic diagram of the WB detection of PHGDH knockdown effect in the embodiment;

[0015] Figure 2 Schematic diagram of the effect of knocking down PHGDH on cell proliferation in the examples;

[0016] Figure 3 Schematic diagram of the effect of knocking down PHGDH on cell clone proliferation in the examples;

[0017] Figure 4 This is a schematic diagram of the effect of knocking down PHGDH on cell apoptosis in the examples. DETAILED DESCRIPTION

[0018] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0019] Example

[0020] In this embodiment, the reagent for inhibiting or interfering with the expression of the PHGDH gene is to knock down the PHGDH gene by constructing a PHGDH shRNA lentiviral vector. The PCR primers of the PHGDH shRNA lentiviral vector are composed of a sense primer (CAGGACTGTGAAGGCCTTATT) and an antisense primer (AATAAGGCCTTCACAGTCCTG).

[0021] In this example, a lentiviral vector knocking down PHGDH (shPHGDH) and a control vector (Scramble) were constructed to infect the t(8;21) AML cell line Kasumi-1, and then selected by puromycin to construct a stable cell line with stable knockdown of PHGDH. WB experiments were performed to confirm that PHGDH expression was reduced. Proliferation detection, apoptosis detection and clone formation detection were then performed. This determined the role of PHGDH in t(8;21) AML.

[0022] Specifically, in order to explore the role of PHGDH in t(8;21)AML cells, a shRNA lentiviral expression vector for knocking down PHGDH was constructed, and the virus was used to infect t(8;21)AML cells Kasumi-1. The knockdown effect of PHGDH was detected by WB. Figure 1 The results showed that after knocking down PHGDH, the expression of PHGDH was decreased.

[0023] The dynamic counting method was used to detect the effect of knocking down PHGDH on cell proliferation. Figure 2 The results showed that after knocking down PHGDH, cell proliferation was significantly inhibited and the cell proliferation ability was reduced.

[0024] By counting clone formation, we can quantitatively analyze the proliferation potential of individual cells and understand the cell's proliferation ability and independent survival ability. Figure 3 The results showed that after knocking down PHGDH, the clonal proliferation ability of cells was significantly reduced.

[0025] Apoptosis is an important form of programmed cell death. Annexin V / PI double staining was used to detect cell apoptosis using flow cytometry. Figure 4The results showed that the proportion of cell apoptosis increased significantly after knocking down PHGDH.

[0026] In summary, the present invention knocks down PHGDH in t(8;21)AML cell lines by constructing a lentiviral vector for knocking down PHGDH, and studies the role of PHGDH in t(8;21)AML by detecting cell proliferation, clone formation, and apoptosis. Studies have shown that PHGDH can promote the occurrence and development of t(8;21)AML, and after knocking down PHGDH, the growth of t(8;21)AML is inhibited. Therefore, PHGDH may be used as a potential target for the treatment of t(8;21)AML.

[0027] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0028] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Use of an agent for inhibiting or interfering with PHGDH gene expression in the preparation of a drug for treating leukemia, characterized in that: The drug for treating leukemia includes an agent for inhibiting or interfering with the expression of PHGDH gene, and the leukemia refers to t(8;21)AML.

2. Use of the reagent for inhibiting or interfering with PHGDH gene expression according to claim 1 in preparing a drug for treating leukemia, characterized in that: The reagent for inhibiting or interfering with the expression of the PHGDH gene refers to the reagent inhibiting the activity of the PHGDH gene and / or reducing the expression level of the PHGDH gene.

3. Use of the reagent for inhibiting or interfering with PHGDH gene expression according to claim 1 in preparing a drug for treating leukemia, characterized in that: The reagent for inhibiting or interfering with PHGDH gene expression is to knock down the PHGDH gene by constructing a PHGDH shRNA lentiviral vector; The PCR primers for constructing the PHGDH shRNA lentiviral vector are: Sense primer: CAGGACTGTGAAGGCCTTATT; Antisense primer: AATAAGCCTTCACAGTCCTG.

Images