Application of TRPC3 inhibitor in preparation of medicine for treating cervical cancer and TRPC3 in preparation of product for diagnosing cervical cancer

Abstract

The invention belongs to the technical field of cell biology, and discloses application of a TRPC3 inhibitor in preparation of drugs for treating cervical cancer and application of TRPC3 in preparation of products for diagnosing cervical cancer. The invention proves that the expression of TRPC3 can be increased due to human papilloma virus infection, and the TRPC3 inhibitor can effectively reverse epithelial-mesenchymal transformation, so that the potential of the TRPC3 inhibitor serving as a medicine for treating cervical cancer is highlighted. Meanwhile, TRPC3 is expected to be used as a potential biomarker for diagnosing cervical cancer, and has a good prospect in the aspect of preparing products for diagnosing cervical cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell biology, and specifically relates to the application of TRPC3 inhibitors in the preparation of drugs for treating cervical cancer and TRPC3 in the preparation of products for diagnosing cervical cancer. Background Art

[0002] Cervical cancer remains a significant global burden, with human papillomavirus (HPV) infection identified as the main culprit. HPV, a DNA virus, is the most common sexually transmitted pathogen responsible for nearly all cases of cervical cancer. While many human papillomavirus strains exist, HPV 16 and 18 are responsible for approximately 70% of cervical cancer cases by integrating their DNA into the genome of host cells and causing malignant transformation. Despite extensive research, the exact mechanism by which HPV transforms normal epithelial cells into malignant entities remains elusive, and this mechanistic gap has hampered the development of effective therapeutic strategies beyond current prevention approaches such as vaccination and screening. Epithelial-mesenchymal transition (EMT) is a key step in the development of cervical cancer, through which epithelial cells lose polarity and cell-cell adhesion and acquire migratory and invasive properties to become mesenchymal stem cells. Whether HPV infection triggers EMT in cervical epithelial cells is unknown. On the other hand, EMT can be induced by multiple signaling pathways, such as MAPK, Wnt / β-catenin, and transforming growth factor receptors. Many factors involved in the EMT process are regulated by Ca 2+ Signal regulation. Transient receptor potential canonical (TRPC) is a classic calcium-permeable cation channel. Previous studies have found that TRPC is involved in Ca 2+ Regulation of balance and Ca 2+ The expression / activation of related factors plays a key role in the proliferation of cancer cells. 2+ Signaling pathways are closely related to the occurrence, development and prognosis of cervical cancer, but the function of TRPC channels in cervical cancer has not been reported. Summary of the invention

[0003] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes the use of TRPC3 inhibitors in the preparation of drugs for treating cervical cancer and TRPC3 in the preparation of products for diagnosing cervical cancer. The present invention confirms that human papillomavirus infection leads to increased expression of TRPC3, and TRPC3 inhibitors can effectively reverse epithelial-mesenchymal transition (EMT), highlighting its potential as a drug for treating cervical cancer. At the same time, TRPC3 is also expected to be used as a potential biomarker for diagnosing cervical cancer, and has good prospects in the preparation of products for diagnosing cervical cancer.

[0004] The present invention provides the use of a TRPC3 inhibitor in the preparation of an anti-human papillomavirus product.

[0005] Preferably, the human papillomavirus is human papillomavirus type 16 (HPV 16) or human papillomavirus type 18 (HPV 18).

[0006] Preferably, the TRPC3 inhibitor is Pyr3 (CAS No.: 1160514-60-2).

[0007] The present invention also provides the use of the TRPC3 inhibitor in preparing a drug for treating cervical cancer.

[0008] Preferably, the TRPC3 inhibitor is Pyr3.

[0009] The experiments of the present invention show that treatment with the specific TRPC3 inhibitor Pyr3 can effectively reduce the degree of EMT in cervical tissue of the HPV16 / 18 cervical infection mouse model, and has outstanding potential for anti-human papillomavirus and treatment of cervical cancer.

[0010] The present invention also provides the use of TRPC3 in preparing a product for diagnosing cervical cancer.

[0011] The present invention also provides the use of a reagent for detecting TRPC3 in preparing a product for diagnosing cervical cancer.

[0012] Experiments have shown that after HPV 16 / 18 infection triggers cervical endothelial cells, their TRPC3 expression increases significantly, so TRPC3 can be used as a potential biomarker for diagnosing cervical cancer. Based on this, the detection of TRPC3 expression can reflect the probability of cervical cancer and the progression of the disease to a certain extent.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention creatively proposes the role of transient receptor potential canonical 3 (TRPC3) in HPV16 / 18-induced cervical epithelial cell transformation, and confirms the direct correlation between human papillomavirus infection and TRPC3 upregulation, that is, HPV16 and HPV18 infection leads to increased TRPC3 expression, which contributes to epithelial-mesenchymal transition (EMT), thereby promoting the onset and progression of cervical cancer.

[0015] Based on the above mechanism, the present invention further found that the specific TRPC3 inhibitor Pyr3 can effectively reverse epithelial-mesenchymal transition (EMT), highlighting its potential as a drug for the treatment of cervical cancer. At the same time, TRPC3 is also expected to be a potential biomarker for the diagnosis of cervical cancer, and has good prospects in the preparation of diagnostic products for cervical cancer.

[0016] The research of this invention not only advances the understanding of the potential molecular mechanism of human papillomavirus-related cervical cancer, but also proposes a new idea of ​​TRPC3 as a new target for cervical cancer treatment intervention and diagnostic biomarker, which has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figure 2 shows HPV infection and TRPC3 expression in H8 and HCEC cells;

[0018] Figure 2 is the titer-dependent infection graph of H8 and HCEC with HPV PsV;

[0019] Figure 3 Western blot analysis of TRPC3 protein expression in H8 cells after infection with HPV 16;

[0020] Figure 4 Western blot analysis of TRPC3 protein expression in H8 cells after infection with HPV 18;

[0021] Figure 5 Western blot analysis of TRPC3 protein expression in HCEC cells after infection with HPV 16;

[0022] Figure 6 Western blot analysis of TRPC3 protein expression in HCEC cells after infection with HPV 18;

[0023] Figure 7 Immunofluorescence staining of TRPC3 (yellow) and GFP (green) in H8 cells after infection with HPV 16;

[0024] Figure 8 Immunofluorescence staining of TRPC3 (yellow) and GFP (green) in H8 cells after infection with HPV 18;

[0025] Fig. 9 Immunofluorescence staining of TRPC3 (yellow) and GFP (green) in HCEC cells after infection with HPV 16;

[0026] Fig.10 Immunofluorescence staining of TRPC3 (yellow) and GFP (green) in HCEC cells after infection with HPV 18;

[0027] Fig.11 Pyr3 processing regulates ATP-induced calcium influx in H8 after HPV 16 / 18 infection;

[0028] Fig.12 Pyr3 processing regulates ATP-induced calcium influx in HCECs after HPV 16 / 18 infection;

[0029] Fig.13 Immunofluorescence images of RASA4 expression on the plasma membrane of H8 and HCEC after HPV 16 / 18 infection, pyr3 treatment, and TRPC3 knockdown;

[0030] Fig.14 is the gene transcription level of EMT markers ZEB1 and Snail after infection with HPV 16 or HPV 18 in H8 cells;

[0031] Fig.15 is the gene transcription level of EMT markers Slug and Twist1 after infection with HPV 16 or HPV 18 in H8 cells;

[0032] Fig.16 is the gene transcription level of EMT markers ZEB1 and Snail after infection with HPV 16 or HPV1 8 in HCEC cells;

[0033] Fig.17 is the gene transcription level of EMT markers Slug and Twist1 after infection with HPV 16 or HPV 18 in HCEC cells;

[0034] Fig.18 Western blot analysis of EMT markers after HPV 16 or HPV 18 infection in H8 cells;

[0035] Fig.19 is the protein level of EMT markers ZEB1 and Snail in H8 cells after HPV 16 or HPV 18 infection;

[0036] Fig. 20 is the protein level of EMT markers Slug and Twist1 in H8 cells after HPV 16 or HPV 18 infection;

[0037] Fig.21 Western blot analysis of EMT markers after HPV 16 or HPV 18 infection in H8 cells;

[0038] Fig. 22 is the protein level of EMT markers ZEB1 and Snail in HCEC cells after HPV 16 or HPV 18 infection;

[0039] Fig.23 The protein levels of EMT markers Slug and Twist1 in HCEC cells after HPV 16 or HPV 18 infection;

[0040] Fig.24The figure shows the effect of Pyr3 on apoptosis of H8 cells infected with HPV 16 / 18;

[0041] Fig.25 The figure shows the effect of Pyr3 on apoptosis of HCEC cells infected with HPV 16 / 18;

[0042] Fig.26 Effects of HPV 16 / 18 infection, TRPC3 inhibition (pyr3), and MEK-ERK inhibition (PD98059) on cell proliferation in H8 cells;

[0043] Fig. 27 Effects of HPV 16 / 18 infection, TRPC3 inhibition (pyr3), and MEK-ERK inhibition (PD98059) on cell proliferation in HCECs;

[0044] Fig.28 Quantitative real-time PCR analysis of transcriptional regulation of TRPC3 in H8 cells;

[0045] Fig.29 The volcano plot of differentially expressed genes after TRPC3 knockout in H8 cells;

[0046] Fig.30 KEGG pathway analysis after TRPC3 knockdown in H8 cells;

[0047] Fig.31 GO enrichment analysis in H8 cells;

[0048] Fig.32 Quantitative real-time PCR analysis of transcriptional regulation of TRPC3 in HCEC cells;

[0049] Fig.33 The volcano plot of differentially expressed genes after TRPC3 knockout in HCEC cells;

[0050] Fig.34 KEGG pathway analysis after TRPC3 knockdown in HCEC cells;

[0051] Fig.35 GO enrichment analysis in HCEC cells;

[0052] Fig.36 To inhibit HPV-induced EMT;

[0053] Fig.37 Immunofluorescence staining of TRPC3 protein in cervical sections of mice infected with HPV 16 or HPV 18 pseudovirus intravaginally for 3 days;

[0054] Fig.38 Immunofluorescence staining of EMT markers in cervical tissue;

[0055] Fig.39 is the expression level diagram of EMT markers in cervical tissue;

[0056] Fig.40 The immunohistochemical staining of EMT markers ZEB1 and Snail in cervical tissue;

[0057] Fig.41 The statistical diagram of immunohistochemical staining of EMT markers ZEB1 and Snail in cervical tissue;

[0058] Fig.42 This is a Tunel staining image of a mouse cervical section;

[0059] Fig.43 This is a statistical diagram of Tunel-stained mouse cervical sections. DETAILED DESCRIPTION

[0060] In order to make the technical scheme of the present invention more clearly understood by those skilled in the art, the following embodiments are listed for illustration. It should be noted that the following embodiments do not limit the protection scope of the present invention.

[0061] Unless otherwise specified, the raw materials, reagents or devices used in the following examples can be obtained from conventional commercial sources or by existing known methods.

[0062] Cell culture

[0063] Human cervical epithelial cell lines H8 and HCEC (human primary cervical epithelial cells) were purchased from the American Type Culture Collection (ATCC, USA). H8 cells were cultured at 37°C in phenol red-free RPMI 1640 medium (Invitrogen, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen) and 1% penicillin / streptomycin. HCEC cells were cultured under the same conditions, except that the concentration of FBS was 15%.

[0064] 1.2. HPV PsV production and infection

[0065] HPV16 and HPV18 pseudovirions (PsV) were produced by co-transfection of 293FT cells with a mixture of plasmids expressing HPV-16 / 18 (p16SheLL, p18SheLL) and pClneo-EGFP plasmid (Addgene; #66862) using Lipofectamine 2000 reagent (Solarbio; YZ-11668). p16SheLL and p18SheLL were purchased from Addgene as #37320 and #37321, respectively. 48 hours after transfection, cells were harvested and lysed after multiple suspension and centrifugation steps. The combined supernatants were then purified through a 25%-39% continuous iodixanol gradient (Optiprep: PROGEN Biotechnik #1114542) in quickseal polyallomer tubes (Beckman #355870). After ultracentrifugation, approximately 12 fractions of 200 μL each were collected by puncturing the bottom of the tube. Viral titers expressed as viral genome equivalents (VGE) were determined as previously reported, and the extracted vDNA was purified using a DNAClean & Concentrator kit (Zymo Research). H8 and HCEC cells (5 × 10 4 Cells / well) were seeded into 12-well plates (Cellvis) and infected with HPV16 EGFP-PsV at a multiplicity of infection (MOI) of 2.5 50 VGE for 2 h on a shaker at 37°C.

[0066] TRPC3 knockdown and validation

[0067] In order to knock down TRPC3 expression, H8 and HCEC cell lines were transduced with a lentiviral vector expressing TRPC3 targeting shRNA. The shRNA sequence was cloned into the pLKO.1 lentiviral vector (Addgene, Cambridge, MA, USA). Lentivirus was produced in HEK293TT cells by co-transfection with pLKO.1-shTRPC3 plasmid, psPAX2 packaging plasmid (Addgene) and pMD2.G envelope plasmid (Addgene). Subsequently, H8 and HCEC cells were infected with lentivirus and selected for 7 days with puromycin (2 μg / mL). The successful knockout of TRPC3 was verified at the mRNA level by quantitative real-time PCR (qPCR). QPCR was performed using SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), with TRPC3 specific primers (as shown in Table 1) and GAPDH as internal controls.

[0068] Table 1

[0069] Primers Sequence (5' to 3') serial number Forward Primer GCGTCTTCCTTGGTGTGTCT SEQ ID NO: 1 Reverse primer AGCCAGGAAGACCACGATGA SEQ ID NO: 2

[0070] Fluorescence imaging

[0071] GFP-labeled adenovirus-infected cells were examined using a Nikon TE300 Eclipse microscope equipped with a 10x objective. To observe apoptosis, live cells were incubated at 37°C, 5% CO O2 / 95% air atmosphere with 100nM Mitotracker Red CMXROS (Invitrogen) staining for 30 minutes. The cells were then fixed in 2% paraformaldehyde (Sigma-Aldrich) at 37°C for 10 minutes, then washed twice in PBS for 5 minutes each, and permeabilized in 0.1% Triton X-100 (Sigma-Aldrich) for 15 minutes. Nuclear staining was performed at ambient temperature for 10 minutes using a 1:5000 dilution of DAPI (Roche) in PBS. Coverslips were incubated in a blocking solution containing 2% bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO, USA) and 5% normal goat serum (NGS; Invitrogen, Carlsbad, CA, USA) for 1 hour. They were then incubated overnight at 4°C with the following primary antibodies: rabbit anti-TRPC3 (1:100, Abcam, Cambridge, UK) and rabbit anti-RASA4 (1:100, Abcam). After incubation, coverslips were washed three times with PBS containing 0.1% Tween 20 (Sigma-Aldrich). Secondary detection was performed at room temperature for 1 hour using Alexa Fluor488 / 594 goat anti-mouse / rabbit antibodies (1:100, Invitrogen) in 1% NGS / PBS. Nuclei were counterstained with DAPI (1:5000, Roche, Basel, Switzerland) for 10 minutes at room temperature. Slides were mounted using fluorescent mounting medium (Dako, Carpinteria, CA, USA) and imaged with a 60X objective on an Olympus FluoView FV1000 confocal laser scanning microscope. Image analysis was performed using FV1000 software (Olympus, Tokyo, Japan).

[0072] Western blotting

[0073] Total protein lysates from H8 and HCEC cells were extracted using M-PER protein extraction reagent (Thermo Fisher Scientific, Waltham, MA, USA). The lysates were then analyzed by Western blot. To detect TRPC3 and epithelial-mesenchymal transition marker protein expression, rabbit anti-TRPC3 antibody (Santa Cruz Biotechnology, Dallas, TX, USA; dilution 1:1000), rabbit anti-E-cadherin (abcam, ab231303, 1 μg / ml), rabbit anti-N-cadherin (abcam, ab76011, 1:1000), rabbit anti-snail (abcam, ab216347, 1:1000) and rabbit anti-vimentin (abcam, ab20346, 1:1000) were used. To ensure the specificity of the antibodies, the membrane was pre-incubated with its blocking peptide at 37°C for 2 hours according to the manufacturer's instructions before incubation. After primary antibody detection, the membrane was washed with TBST and then incubated with horseradish peroxidase-conjugated secondary antibody (Dako, Glostrup, Denmark) at a dilution of 1:3000 for 1 hour at room temperature. Protein expression was detected using enhanced chemiluminescent substrate (Pierce, Thermo Fisher Scientific, Waltham, MA, USA). The density of protein bands was quantified using Image J software (version 1.48V, National Institutes of Health, Bethesda, MD, USA).

[0074] 1.6. Confocal Ca 2+ Imaging

[0075] Confocal Ca imaging was performed using the Rhod-3 calcium imaging kit (Thermo Fisher Scientific, Waltham, MA, USA). 2+ Imaging was performed as described previously. Various reagents, including adenosine triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, St. Louis, MO, USA) were added at appropriate concentrations at the indicated time points. CaCl2 (Sigma-Aldrich, St. Louis, MO, USA) and Pyr3 were added at appropriate concentrations at the indicated time points. An equal volume of dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St. Louis, MO, USA) was used as a solvent control. Cytosolic Ca 2+ The raw traces of level changes are expressed as F / F0, defined as the fluorescence intensity at a given time normalized to its baseline. Data analysis was performed using FV1000 software (Olympus Corporation, Tokyo, Japan).

[0076] 1.7. Proliferation assay

[0077] Annexin V-FITC and propyl iodide (P1) are used to distinguish apoptotic and necrotic cells. Annexin V binds to the membrane surface as an indicator of apoptosis, and PI has poor membrane permeability, so it can only mark necrotic cells. On the scatter plot of bivariate flow cytometry, the lower left quadrant shows live cells as (FITC- / PI-); in the upper right quadrant, non-live cells, i.e. dead cells, are (FITC+ / PI+); in the lower right quadrant, apoptotic cells appear (FITC+ / PI-).

[0078] Cells were treated with the TRPC3 blocker Pyr3 or DMSO for 3-5 days. Recombinant adenoviruses that transfer green fluorescent protein (GFP) and dominant negative (DN) TRPC3 were previously constructed and used to infect cells. Cell viability and proliferation were assessed using the MTT assay as previously described, and the number of live cells was quantified by the trypan blue exclusion assay.

[0079] The cell culture was started at 3.33 × 10 4 cells cm -2 In addition, for each experimental condition, 1×10 6 Cells were then fixed in 70% ethanol (Sigma) at 4°C for 30 minutes. Subsequently, centrifugation at 200 × g centrifugation promoted the cell precipitation to be reconstructed in a staining medium, which contained 2 μg / mL iodide propidium (Sigma) and 10 mg / mL RNase A (Thermo Fisher Scientific) in phosphate buffered saline for 30 minutes at 37°C in a dark environment. BD FACSVerse flow cytometer (BD Biosciences, San Jose, CA, USA) was used for cell analysis. ModFit LT software (Verity Software House, Topsham, ME, USA) was used to realize data quantification, particularly the distribution of live cells in G0 / G1, S and G2 / M phases and apoptotic cells in sub-G1 phase.

[0080] High-throughput RNA sequencing

[0081] RNA libraries were prepared from 0.1 to 4 μg of total RNA using the TruSeq RNA Sample Preparation Kit (Illumina, USA) following the manufacturer's instructions. Libraries were sequenced on an Illumina HiSeq 2500 platform using a paired-end sequencing strategy. Raw FASTQ files were demultiplexed using Casava 1.8, allowing for single barcode mismatches. Reads were quality filtered using PRINSEQ, removing reads with an average Phred score below 20 or a length shorter than 30 nucleotides. Filtered reads were aligned to HPV reference sequences (HPV16-GenBank K02718.1 and HPV18-AY262282.1) using Bowtie 2. Nucleotide coverage at each position was calculated using GATKDepthOfCoverage, and coverage plots were generated using R. Samples with fewer than 500 reads mapped to the HPV reference were excluded from subsequent analysis.

[0082] 1.9. Generation of HPV-Luc pseudovirus

[0083] Since the HPV pseudovirus containing the GFP tag is not expressed with high-intensity fluorescence in mice, the HPV16 / 18 pseudovirus containing the luciferase tag is used for in vivo experiments. Using the E6E7 plasmid containing HPV-16 (Addgene; #13712) or HPV-18 (Addgene; #10850), the E6E7 PCR product is digested with Eco RI-Xho I and connected to the MSCV IRES luciferase plasmid (Addgene; #18760), and the E6E7 IRES is separated. The Eco RI-Sal I fragment of the luciferase construct is separated and connected to the Eco RI-Xho I fragment of pCAGEN (Addgene#11160) to produce HPV16-Luc and HPV18-Luc. HEK293T cells are selected to amplify the recombinant vector. The vector is introduced into the host cell by transfection. The cells were harvested and subjected to multiple steps of suspension and centrifugation to obtain a mixed supernatant, which was subsequently purified in Quick Seal peptide tubes (Beckman #355870) using a 25-39% sequential iodine gradient (Optiprep: PROGEN Biotechnik #1114542). After ultracentrifugation, approximately 12 fractions of 200 μL each were collected by puncturing the bottom of the tube.

[0084] 1.10. Establishment of HPV cervical infection model

[0085] Six-week-old BALB / c female mice purchased from Beijing Vital River Experimental Animal Technology Co., Ltd. were used. All animal experiments were performed in accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of Guangxi Medical University. Eight days before HPV pseudovirus challenge, mice were synchronized into an estrus-like state by subcutaneous injection of 3 mg Depo-Provera (Pfizer, Zurich, Switzerland). Six hours before pseudovirus challenge, deeply anesthetized mice were prepared by intravaginal injection of 20 μL of 4% nonoxynol-9 (Sigma). Each mouse was then intravaginally attacked with 5×10^6 IU of HPV16 or HPV18 pseudovirus (20 μL of a solution containing 2% carboxymethyl cellulose (Sigma)).

[0086] Bioluminescence imaging

[0087] On the third day after challenge, mice were anesthetized and injected intraperitoneally with luciferin (30 μL, 7 mg / mL) to detect luciferase expression of pLucf plasmid encapsidated in pseudovirus. Light emission was measured for 10 minutes using an IVIS200 bioluminescent imaging system. Equally sized regions of interest covering the virus inoculation site were analyzed using Living Image 2.20 software (Xenogen) to quantify infection levels.

[0088] 1.12. PyR3 processing and tissue analysis

[0089] Three days after successful modeling, HPV16 and HPV18 infected mice were divided into two groups and intraperitoneally injected with Pyr3 (0.1 mg / kg) or PBS control every 3 days for a total of 4 treatments. 15 days after modeling (after 4 treatments), the mice were euthanized. Cervical samples were collected for immunofluorescence detection of luciferase expression and immunohistochemical analysis of ZEB1 and Snail to evaluate the level of EMT in the cervical epithelium.

[0090] Immunofluorescence staining

[0091] Immunofluorescence staining was performed using mouse cervical sections to detect the expression and localization of TRPC3, E-cadherin, N-cadherin, and vimentin in cervical tissue. Rabbit anti-TRPC3 antibody (Santa Cruz Biotechnology, Dallas, TX, USA; dilution 1:500), rabbit anti-E-cadherin (abcam, ab231303, 1:500), rabbit anti-N-cadherin (abcam, ab76011, 1:300), and rabbit anti-vimentin (abcam, ab20346, 1:300) were used for the experiment. First, mouse cervical tissue sections were soaked in PBS, then fixed with paraformaldehyde, and the tissue was blocked with goat serum. At the end of the blocking, the corresponding antibody dilution was added dropwise to the tissue sections, and then incubated overnight at 4 ° C in a refrigerator. After incubation, the sections were incubated with fluorescently labeled secondary antibodies (abcam; ab6717; diluted 1:1000 in 1% BSA solution) for 1 hour, sealed, dried and observed under a microscope. Fluorescence statistics were performed using Image J software.

[0092] Immunohistochemical staining

[0093] For staining, 5 μm tissue sections were dewaxed in xylene and then rehydrated through a graded alcohol series and ultrapure water. Antigen retrieval was performed by boiling the sections in citrate buffer (pH = 6.0), and endogenous peroxidase activity was quenched by immersing the sections in 0.3% H2O2 for 10 minutes. Subsequently, the sections were incubated with Snail (1:1000 dilution; Servicebio) and ZEB1 (1:1000 dilution; Servicebio) primary antibodies at 4°C overnight. Immunoreactivity was observed using a DAB substrate kit (CST, USA). The positive area in tumor tissue sections was counted using Image J software.

[0094] 1.15. Tunel staining

[0095] Mouse cervical tissue paraffin sections were used for the experiment. First, the sections were dewaxed in xylene for 5-10 minutes, then replaced with fresh xylene and dewaxed for 5-10 minutes, anhydrous ethanol for 5 minutes, 90% ethanol for 2 minutes, 70% ethanol for 2 minutes, and distilled water for 2 minutes. The experiment was then performed according to the instructions of the Tunel kit (Beyotime, C1088). After staining, the sections were sealed, dried, and photographed under a microscope. Fluorescence statistics were performed using Image J software.

[0096] Statistical analysis

[0097] The statistical differences between two groups were determined using the Student t test, while comparisons between three or more groups were determined using analysis of variance (ANOVA). The experiments were repeated at least 3 times. The data are presented as mean ± standard error of the mean (SEM). A p value of less than 0.05 was defined as statistically significant.

[0098] 2. Results

[0099] 2.1. Human papillomavirus 16 / 18 infection induces time-dependent upregulation of TRPC3 in human cervical endothelial cells

[0100] To mitigate confounding factors associated with viral replication, growth rates were initially compared between H8 and HCEC cells. Figure 1 As shown, no significant differences in population growth were observed between the two cell lines, allowing efficient infection in subsequent experiments. The expression of green fluorescent protein (GFP) was further evaluated as a measure of infection efficiency after infection with different doses of HPV PsV VGE (low VGE: 1-10 VGE / cell; medium VGE: 10-100 VGE / cell; and high VGE:>100 VGE / cell). Figure 2 is the titer-dependent infection diagram of H8 and HCEC with HPV PsV, Figure 2 As can be seen, GFP-positive cells increased in a titer-dependent manner in both cell types, confirming robust and reproducible infection across different human cervical endothelial cell lines. Therefore, high VGE (>100 VGE / cell) was used for further studies in subsequent experiments.

[0101] We further explored the effect of HPV 16 / 18 infection on TRPC3 expression in H8 and HCEC cells. Western blot analysis revealed a time-dependent upregulation of TRPC3 protein levels in both cell lines after infection. Figure 3-Figure 6 As shown. Western blot shows the protein levels of TRPC3 and GAPDH (loading control) in control and HPV-infected cells at different time points (24, 48, 72 and 96 hours). TRPC3 protein expression was quantified relative to GAPDH and normalized to the control group at each time point. Data are expressed as mean ± SD from three independent experiments. Statistical significance was determined by one-way ANOVA and Tukey post hoc test (*p<0.05, **p<0.01). Figure 3-Figure 6 As can be seen, at 72 and 96 hours after infection, the expression level of TRPC3 protein was significantly increased compared with the control group (P<0.05). Immunofluorescence imaging further confirmed these findings and provided additional insights into the cellular distribution of TRPC3, see Figures 7 to 10 Immunofluorescence staining of Figures 7 to 10It can be seen that after the appearance of GFP (green) as a reporter of HPV infection, strong TRPC3 staining (yellow) was observed in H8 and HCEC cells, especially localized to the cytoplasm and plasma membrane of the cells. It is worth noting that the intensity of TRPC3 fluorescence closely reflects the brightness of GFP expression. These results ultimately prove that HPV 16 / 18 infection triggers a robust and time-dependent increase in TRPC3 expression in different cervical endothelial cells.

[0102] 2.2. Inhibition of TRPC3 impairs Ca2+ expression in HPV16 / 18-infected cervical endothelial cells 2+ Influx and Survival

[0103] To evaluate the function of TRPC3 and its effect on the survival of H8 and HCEC cells after HPV infection, experiments were performed using Pyr3, a specific TRPC3 inhibitor. Fig.11 and Fig.12 Figure 1 shows calcium influx after cells were infected with HPV16 or 18 for 48 hours and then treated with ATP in the presence or absence of Pyr3. Data represent mean ± SEM from three independent experiments. *p<0.05 vs. uninfected control; #p<0.05 vs. HPV16 / 18 infection. Fig.11 and Fig.12 In both cell types infected with HPV16 or 18, treatment with Pyr3 effectively abolished ATP-induced Ca 2+ These results highlight the functional presence of TRPC3 in H8 and HCEC cells.

[0104] The regulatory role of TRPC3 in calcium signaling was further investigated, focusing on RASA4, a calcium-dependent inhibitor of the Ras-MAPK cascade. Fig.13 Immunofluorescence images of RASA4 expression on the plasma membrane of H8 and HCEC after HPV16 / 18 infection, pyr3 treatment and TRPC3 knockdown (scale bar = 20 μm). Immunofluorescence assays showed that inhibition of TRPC3 using Pyr3 reduced the expression of RASA4, particularly on the plasma membrane of HPV-infected epithelial cells. This finding suggests that RASA4 may play a key role in Ras-mediated regulation of calcium signals through TRPC3, which is promoted by calcium-induced translocation to the plasma membrane, where it inactivates GDP-bound Ras.

[0105] 2.3. Inhibition of TRPC3 reverses HPV-induced epithelial-mesenchymal transition

[0106] Epithelial-mesenchymal transition (EMT) is a key mechanism by which epithelial cells progress to a tumorigenic state. We further investigated the effect of TRPC3 on EMT in HPV-infected human cervical endothelial cells by evaluating key EMT markers. Figure 14-17 Figure 3 is a graph of gene transcription levels of EMT markers ZEB1, Snail, Slug, and Twist1 after infection with HPV16 or HPV18 in H8 and HCEC cells. Quantitative PCR (qPCR) analysis showed that gene transcription levels of ZEB1, Snail, Slug, and Twist1 were significantly upregulated in H8 and HCEC cells after infection with HPV16 or HPV18. In contrast, treatment with a TRPC3 inhibitor significantly reduced gene expression of the designated EMT markers. Treatment with the TRPC3 inhibitor Pyr3 significantly reduced the expression of these markers, implying a protective effect against EMT-driven tumorigenesis after HPV infection. Consistently, inhibition of TRPC3 also significantly reduced the protein levels of ZEB1, Snail, Slug, and Twist1 in human papillomavirus-infected epithelial cells ( Figure 18-Figure 23 These results illustrate the critical involvement of TRPC3 in the HPV-promoted EMT process and provide insights into potential intervention targets for HPV-related tumorigenesis.

[0107] 2.4. Ras-MAPK and MEK-ERK pathways are involved in TRPC3 regulation of calcium signaling and cell proliferation in human papillomavirus-infected epithelial cells

[0108] To assess cell viability after HPV infection and treatment with or without the TRPC3 inhibitor Pyr3, PI and Annexin V staining were performed. Fig.24 , Fig.25 The effect of Pyr3 on apoptosis of H8 and HCEC cells infected with HPV16 / 18. Cells were infected with HPV16 or 18 for 48 hours before treatment with Pyr3. Cell apoptosis was measured using flow cytometry with annexin V / propidium iodide staining. Data represent mean ± SEM from three independent experiments. *p<0.05 relative to uninfected control; #p<0.05 relative to HPV16 / 18 infection. Flow cytometric analysis showed that HPV16 or 18 infection significantly increased the proportion of live cells (PI- / Annexin V-) on the bivariate flow cytometry scatter plot (lower left quadrant), which was downregulated in the presence of Pyr3. These key findings indicate that TRPC3 is essential for the survival of human papillomavirus-infected cervical endothelial cells, and specific inhibitors of TRPC3 may have potential therapeutic effects in alleviating cell dysregulation induced by human papillomavirus infection.

[0109] To further elucidate the signaling pathways involved in TRPC3-regulated HCEC cell survival, the MEK-ERK pathway inhibitor PD98059 (ERK-i) was introduced into the experimental protocol. Fig.26 , Fig. 27 Effects of HPV16 / 18 infection, TRPC3 inhibition (pyr3), and MEK-ERK inhibition (PD98059) on cell proliferation in H8 and HCEC. Cell counting kit-8 (CCK-8) assays showed that HPV16 and 18 infection significantly increased cell proliferation in HCEC lines. Notably, this proliferation surge was offset by the TRPC3 inhibitor Pyr3. However, subsequent treatment with ERK-i significantly restored cell proliferation in the context of HPV infection, indicating the presence of potential compensatory pathways that bypass TRPC3-mediated cellular dysregulation.

[0110] TRPC3-regulated transcriptional dynamics in H8 and HCEC cells

[0111] The efficacy of TRPC3 knockdown in H8 and HCEC cells was verified by qPCR analysis ( Fig.28 and Fig.32 ), which confirmed a significant decrease in TRPC3 mRNA levels compared with controls, laying the foundation for subsequent transcriptome analysis. Fig.29 and Fig.33 The volcano plots of differentially expressed genes after TRPC3 knockout in H8 and HCEC cells, respectively, where the x-axis represents the log2 fold change (Log2FC) of gene expression, and the y-axis shows -log10 (p-value). Genes with p-value <0.05 were considered statistically significant. The vertical dotted lines represent Log2FC thresholds of 1 and -1, respectively. Genes with Log2FC>1 and p-value <0.05 were considered significantly upregulated (red dots), while genes with Log2FC<-1 and p-value <0.05 were considered significantly downregulated (blue dots). Genes that did not meet these criteria were considered to have no significant differential expression (grey dots). Volcano plot ( Fig.29 and Fig.33 ) illustrated significant gene expression changes after TRPC3 knockout, with significant genes such as RGS7 and APH1B being the most differentially expressed genes, suggesting that they may be involved in TRPC3-mediated cellular processes. To further investigate the effects of TRPC3 knockout on EMT, the expression levels of key EMT markers in TRPC3-knockout H8 and HCEC cells were further analyzed compared with wild-type controls. The results showed that after TRPC3 knockout, the expression of EMT markers E-cadherin, N-cadherin, Slug, and Twist was reduced in both cell lines, indicating that TRPC3 regulation could reverse the EMT process induced by HPV infection.

[0112] In H8 cells, KEGG pathway analysis ( Fig.30 ) showed that several key pathways, including ribosome, cell cycle, and coronavirus disease, were highly enriched after TRPC3 knockout. This means that changes in TRPC3 expression significantly affect multiple essential signaling pathways and biological processes, especially those related to cell proliferation and viral infection. GO enrichment analysis ( Fig.31 ) elucidated the biological processes, cellular components, and molecular functions most affected by TRPC3 regulation in H8 cells. Notably, GO terms related to epithelial cell differentiation, cell-cell adhesion, and extracellular matrix organization were most significantly enriched among the upregulated genes, strongly suggesting that the EMT process was reversed after TRPC3 knockout.

[0113] In HCEC cells, KEGG pathway analysis ( Fig.34 ) illustrates the enrichment of various pathways after TRPC3 knockout, among which pathways related to neurodegenerative diseases, protein processing in the endoplasmic reticulum, and non-alcoholic fatty liver disease were affected. GO enrichment analysis ( Fig.35 ) showed that the biological processes, cellular components, and molecular functions most affected by TRPC3 regulation were also associated with EMT. The highest enrichment scores were upregulated for genes involved in epithelial differentiation, cell-cell junction organization, and extracellular structure organization, further supporting that TRPC3 knockout inhibits EMT and restores epithelial characteristics.

[0114] 2.6Pyr3 inhibits HPV-induced EMT in mouse cervical epithelium

[0115] To validate the in vitro findings in an in vivo model, HPV16 and HPV18 cervical infection mouse models were established. Bioluminescence imaging on day 3 post-infection showed that both HPV16 and HPV18 pseudovirus-infected mice were successfully infected ( Fig.36 ). The protein expression of TRPC3 was detected in mouse cervical tissue, which was upregulated after viral infection, consistent with the results of cell experiments ( Fig.37 Importantly, immunohistochemistry and immunofluorescence staining experiments demonstrated that the expression of EMT markers ZEB1, Snail, E-cadherin, N-cadherin, and vimentin was increased in HPV16- and HPV18-infected cervical tissues compared with uninfected controls ( Figure 38-Figure 41 . Fig.40 In the HPV16 and HPV18 infection models, Pyr3 treatment significantly reduced the expression of these EMT markers, which is consistent with the in vitro observations. In addition, TUNEL staining showed that the use of Pyr3 promoted apoptosis of cervical tissue in virus-infected mice ( Fig.42 , Fig.43). These results provide in vivo evidence that inhibition of TRPC3 can effectively reverse HPV-induced EMT in cervical epithelial cells and increase tumor cell apoptosis.

[0116] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of TRPC3 inhibitors in the preparation of anti-human papillomavirus products.

2. The use according to claim 1, characterized in that: The human papillomavirus is human papillomavirus type 16 or human papillomavirus type 18.

3. The use according to claim 1 or 2, characterized in that: The TRPC3 inhibitor is Pyr3.

4. Application of TRPC3 inhibitors in the preparation of drugs for the treatment of cervical cancer.

5. The use according to claim 4, characterized in that: The TRPC3 inhibitor is Pyr3.

6. Application of TRPC3 in the preparation of products for diagnosing cervical cancer.

7. Application of reagents for detecting TRPC3 in the preparation of products for diagnosing cervical cancer.

Images