Primer group and kit for detecting NF1 gene mutation and application of primer group and kit

Abstract

The invention provides a primer group and a kit for detecting NF1 gene mutation by using a long-read-long sequencing platform and application of the primer group and the kit. The primer group provided by the invention comprises primers for amplifying all exons of the NF1 gene and intron regions of flanks at two ends of the exons, and primers for amplifying the NF1 gene and deletion mutation of 50kb regions of the flanks at two ends of the NF1 gene. In combination with the characteristics of a long-read-long sequencing platform, various mutations of the NF1 gene can be comprehensively, accurately, quickly and simultaneously detected at high throughput.

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and more particularly to a primer set, a kit and applications thereof for detecting NF1 gene mutations using a long-read sequencing platform. Background Art

[0002] Neurofibromatosis type I (NF1) is an autosomal dominant genetic disease of the nervous system caused by mutations in the NF1 gene. The global birth incidence is estimated to be between 1 / 3500 and 1 / 2000. 1,2,3 The disease has a variety of clinical phenotypes involving multiple systems, including café au lait spots, iris nodules, gliomas, autism spectrum disorders, learning difficulties, neurofibromas, and skeletal dysplasia. Its clinical diagnosis is mainly based on the clinical criteria established by the National Institutes of Health at a consensus conference in 1987. 4 and the revised opinions proposed by the International Neurofibromatosis Diagnostic Criteria Consensus Group in 2021 5 Because NF1 involves a wide range of systems and has diverse manifestations, it is clinically similar to some syndrome phenotypes. 6 NF1 patients are often misdiagnosed in general outpatient clinics. In addition, for children, physical signs gradually appear with age, and there is a risk of tumor malignancy. 7 However, current clinical diagnostic criteria have low sensitivity in children. 8 Therefore, genetic testing can be performed to confirm the NF1 diagnosis in response to the above problems.

[0003] The NF1 gene is located in the 17q11.2 region of the long arm of human chromosome 17. It is one of the largest genes known to humans. It is 370kb in length, including 58 exons and 57 introns. It transcribes 12kb of mRNA and encodes a neurofibromin protein composed of 2818 amino acids. This protein is a recognized tumor suppressor. Biochemical studies have found that it has Ras-GAP activity. 9,10 . Ras-GTP and Ras-GDP are mutually converted in vivo through Ras-GAP and an activating protein called Ras-GEF: Ras-GEF causes GDP bound to Ras protein to be exchanged for GTP, thereby converting Ras to an activated state; Ras-GAP promotes the hydrolysis of GTP bound to Ras protein into GDP, thereby inactivating Ras protein. Ras-GTP and Ras-GDP are thus mutually converted in vivo to achieve a balance. Because Ras protein functions as a molecular switch, when the dysfunction of the NF1 gene causes an increase in Ras activity, it will further lead to dysfunction in regulating cell growth, thereby significantly enhancing cell proliferation and tissue growth.

[0004] The NF1 gene is one of the genes with the highest frequency of spontaneous mutation in the human genome, and half of NF1 patients have no family history of the disease. 11 The mutation types of NF1 gene mainly include missense and nonsense mutations, splice site mutations, small fragment insertions, small fragment deletions and large fragment deletions, and the gene mutations are distributed throughout the gene without mutation hot spots. 12 To date, more than 8,000 variants have been recorded in the Human Gene Mutation Database (HGMD), Leiden OpenVariation Database (LOVD), and ClinVar databases.

[0005] The NF1 gene is large, highly variable, and has no mutation hotspots. Moreover, to complicate matters, there are many highly homologous pseudogenes of the NF1 gene throughout the human genome. The UCSC database (https: / / genome-euro.ucsc.edu / ) records 12 NF1 pseudogenes, distributed on chromosomes 2, 12, 14, 15, 18, 21, and 22. 10,13 These pseudogenes will interfere with the authenticity of NF1 gene testing. Therefore, the genetic diagnosis of NF1 is a challenging task with high difficulty and complexity. It is reported that the detection rate of NF1 gene mutation in NF1 patients who meet the clinical diagnostic criteria is only 50%-95%. 13 Therefore, traditional methods often need to combine multiple technologies to achieve a higher detection rate. For example, because the NF1 gene is very large, transcripts are usually used for cDNA-PCR + Sanger sequencing to detect mutations in the coding sequence. When abnormalities are found at the cDNA level, they are further confirmed at the genomic DNA level; the microsatellite sequence (STR) within the NF1 gene is used to analyze haploidy, and combined with quantitative PCR to detect large NF1 deletions; or multiple ligation-dependent probe amplification (MLPA) is used to detect large deletions and duplications. 14,15,16 However, even if the traditional method is combined with multiple detection methods, it is time-consuming and labor-intensive, and still cannot achieve full coverage and accurate detection of NF1 gene mutations, such as mutations in non-coding sequences, large fragment deletions, and repeated recombination sites. Next-generation sequencing (NGS) can screen the entire sequence of the target large gene, including the intron region. 17 However, due to the short read length of NGS, it cannot distinguish NF1 pseudogenes well, and cannot provide accurate breakpoints for the judgment of large fragment deletions.

[0006] Currently, screening based on PCR+Sanger sequencing, MLPA, next-generation sequencing and other methods has the following limitations:

[0007] 1. Incomplete detection: It is not possible to detect point mutations, small fragment insertions / deletions, and structural variations of the NF1 gene in the same system;

[0008] 2. Inaccurate detection: It is impossible to determine the exact breakpoints of large fragment deletions and distinguish between true and false genes using only one method;

[0009] 3. High cost: Traditional methods require a combination of multiple technologies, which leads to high requirements for sample quality, long genetic diagnosis time, and high testing costs.

[0010] 4. Unable to determine whether different mutations are linked: When two or more mutations are detected at the same gene locus, existing methods cannot clearly distinguish whether these mutations are linked.

[0011] Therefore, there is an urgent need for a method that can comprehensively, accurately and quickly detect multiple mutations of the NF1 gene at the same time. Summary of the invention

[0012] The purpose of the present invention is to solve the problems of incomplete coverage of pathogenic genes of type I neurofibromatosis, cumbersome genetic diagnosis and detection methods, and single detection of variant types by different methods, which lead to missed detection and misdetection in clinical practice. The present invention provides a method based on multiple long-fragment PCR amplification and long-read sequencing to detect multiple mutations of the NF1 gene related to type I neurofibromatosis. Multiple fragments of the pathogenic gene NF1 related to type I neurofibromatosis are amplified simultaneously by long-fragment PCR and long-read sequencing, so as to achieve the goal of comprehensive, accurate and rapid detection of multiple mutations of the NF1 gene in multiple samples.

[0013] According to a first aspect of the present invention, a primer set for detecting NF1 gene mutation is provided, wherein the primer set comprises the following primers:

[0014] 28 primers for amplifying all exons of the NF1 gene and the flanking intronic regions at both ends thereof: E1F, E1R, E2F, E2R, E3F, E5R, E6F, E8R, E9F, E12R, E13F, E15R, E16F, E29R, E30F, E31R, E32F, E36R, E37F, E39R, E40F, E48R, E49F, E51R, E52F, E57R, E58F and E58R, whose sequences are shown in SEQ ID NOs: 1-28, respectively; and

[0015] 27 primers used to amplify deletion mutations of the NF1 gene and 50kb regions on both ends of the gene: int1R1, int1R2, int1F1, int1F2, int1F3, int1F4, int5R, int8F, int12F, int29F, int36R1, int36R2, int36F1, int36F2, int36F3, int36F4, int57R, GF1, GF2, GF3, GF4, GF5, GR1, GR2, GR3, GR4 and GR5, whose sequences are shown in SEQ ID NOs: 29-55, respectively.

[0016] In one embodiment, the 5' end of the primer is further connected with a DNA barcode for distinguishing different samples; preferably, the DNA barcode is 5-50 nt in length; more preferably, the DNA barcodes at the 5' ends of the forward primer and the reverse primer in the primer set are asymmetric.

[0017] In one embodiment, the NF1 gene mutation includes one or more of the following mutations: point mutations in all exons of the NF1 gene and part of the intron region within the primer range, small fragment insertion / deletion, structural variation, and large fragment deletions of 50kb regions on both ends of the NF1 gene.

[0018] In one embodiment, the primer set of the present invention can be used to detect one or more of the following NF1 gene mutations: point mutations, small insertion / deletions, structural variations in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions on both ends of the NF1 gene.

[0019] In one embodiment, the primer set of the present invention can also be used to detect whether different NF1 gene mutations are linked.

[0020] According to a second aspect of the present invention, a kit for detecting NF1 gene mutation is provided, wherein the kit comprises the primer set according to the first aspect above.

[0021] In one embodiment, the kit further comprises reagents for multiplex long-fragment PCR amplification, reagents for DNA purification and / or reagents for constructing a long-read sequencing library.

[0022] In one embodiment, the reagents for multiple long-fragment PCR amplification include at least one of a DNA polymerase, dNTPs and a reaction buffer.

[0023] In one embodiment, the reagents used to construct a long-read sequencing library include at least one of a damage repair reagent, an end repair reagent, a label ligation reagent, a DNA purification reagent, a linker ligation reagent, and an exonuclease.

[0024] In one embodiment, the reagent for DNA purification is a DNA purification reagent based on magnetic beads or a DNA purification reagent based on a silica membrane adsorption column.

[0025] In one embodiment, the long-read sequencing library is suitable for a single-molecule real-time sequencing platform or a nanopore sequencing platform.

[0026] In one embodiment, the primer sets are provided mixed in a single reaction tube.

[0027] In one embodiment, the NF1 gene mutation includes one or more of the following mutations: point mutations in all exons of the NF1 gene and part of the intron region within the primer range, small fragment insertion / deletion, structural variation, and large fragment deletions of 50kb regions on both ends of the NF1 gene.

[0028] In one embodiment, the kit of the present invention can be used to detect one or more of the following NF1 gene mutations: point mutations, small insertion / deletions, structural variations in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions on both ends of the NF1 gene.

[0029] In one embodiment, the kit of the present invention can also be used to detect whether different NF1 gene mutations are linked.

[0030] According to a third aspect of the present invention, there is provided a method for detecting NF1 gene mutations, comprising the following steps:

[0031] (1) Obtaining samples from subjects;

[0032] (2) using the primer set according to the first aspect or the kit according to the second aspect to amplify the NF1 gene fragment in the sample by multiple long-fragment PCR to obtain a target fragment amplicon;

[0033] (3) constructing a long-read sequencing library based on the amplicon;

[0034] (4) performing long-read sequencing based on the long-read sequencing library to obtain a long-read sequencing result;

[0035] (5) Analyze and determine the NF1 gene mutation type based on the long-read sequencing results.

[0036] In one embodiment, the sample is selected from a biological sample or genomic DNA extracted from a sample.

[0037] In one embodiment, the multiplex long-range PCR is performed in a single reaction tube.

[0038] In one embodiment, the long read sequencing is selected from single molecule real-time sequencing and nanopore sequencing.

[0039] In one embodiment, the NF1 gene mutation includes one or more of the following mutations: point mutations in all exons of the NF1 gene and part of the intron region within the primer range, small fragment insertion / deletion, structural variation, and large fragment deletions of 50kb regions on both ends of the NF1 gene.

[0040] In one embodiment, the method further comprises: analyzing and determining whether different NF1 gene mutations are linked based on the long-read sequencing results.

[0041] According to a fourth aspect of the present invention, a system for detecting NF1 gene mutation is provided, comprising the following modules:

[0042] (1) an amplification module: used to amplify the NF1 gene fragment in the sample from the subject by multiple long-fragment PCR using the primer set according to the first aspect or the kit according to the second aspect to obtain the target fragment amplicon;

[0043] (2) Library construction module: used to construct a long-read sequencing library based on the amplicon;

[0044] (3) Sequencing module: used to perform long-read sequencing based on the long-read sequencing library to obtain long-read sequencing results;

[0045] (4) Mutation analysis module: used to analyze and determine the NF1 gene mutation type based on long-read sequencing results.

[0046] In one embodiment, the sample is selected from a biological sample or genomic DNA extracted from a sample.

[0047] In one embodiment, the multiplex long-range PCR is performed in a single reaction tube.

[0048] In one embodiment, the long read sequencing is selected from single molecule real-time sequencing or nanopore sequencing.

[0049] In one embodiment, the mutation analysis module can be used to determine one or more of the following NF1 gene mutations: point mutations, small insertion / deletions, structural variations in all exons of the NF1 gene and some intronic regions within the primer range, and large deletions of 50 kb regions on both ends of the NF1 gene.

[0050] In one embodiment, the mutation analysis module can also be used to determine whether different NF1 gene mutations are linked.

[0051] According to a fifth aspect of the present invention, there is provided an application of the primer set according to the first aspect of the present invention or the kit according to the second aspect of the present invention in any of the following aspects:

[0052] 1) Detection of NF1 gene mutation;

[0053] 2) Linkage analysis of different NF1 gene mutations;

[0054] 3) Genetic diagnosis of neurofibromatosis type I. According to the sixth aspect of the present invention, there is provided the use of the primer set according to the first aspect of the present invention or the kit according to the second aspect of the present invention in the preparation of any of the following products:

[0055] 1) Products for detecting NF1 gene mutations;

[0056] 2) Products for linkage analysis of different NF1 gene mutations;

[0057] 3) Products used for genetic diagnosis of neurofibromatosis type I.

[0058] In one embodiment, the NF1 gene mutation includes one or more of the following mutations: point mutations in all exons of the NF1 gene and part of the intron region within the primer range, small fragment insertion / deletion, structural variation, and large fragment deletions of 50kb regions on both ends of the NF1 gene.

[0059] The method provided by the present invention is based on a specific combination of long-fragment PCR amplification and long-read sequencing, and can simultaneously detect multiple mutations of the neurofibromatosis type I-related pathogenic gene NF1 in multiple samples with high specificity, accuracy and rapidity.

[0060] The excellent technical effects of the method and kit of the present invention are mainly in the following aspects:

[0061] (1) Wide detection range. The present invention can simultaneously detect point mutations, small insertion / deletion, structural variation in all exons of the NF1 gene and some introns within the primer range that have been discovered, as well as large deletions of 50 kb in the flanks of both ends of the NF1 gene. It can also detect unknown mutations of the NF1 gene in the above regions and accurately determine the breakpoints of large deletions.

[0062] (2) Detection of multiple mutation types with a single kit. Traditional methods require a detection system for each mutation type. For example, detection of point mutations and small insertion / deletions requires detection using PCR+Sanger sequencing or NGS; detection of large deletions associated with the NF1 gene requires MLPA detection. The present invention achieves simultaneous detection of multiple mutations, including point mutations, small insertion / deletions, and structural variations, in one reaction system.

[0063] (3) Low false positive and missed detection rates. Due to the large size of the NF1 gene, rich mutations and numerous pseudogenes, the detection range of traditional detection methods is limited and the detection experiments are cumbersome, which can easily lead to missed diagnosis of pathogenic mutations and false negative judgments. The method used in the present invention directly amplifies all exons and part of the intron region of the NF1 gene, as well as the GAP fragments with large fragment deletions in the 50kb region of the NF1 gene and its two ends, avoiding the interference of pseudogenes, greatly reducing the risk of false positive and missed detection, greatly improving the simplicity of NF1 gene diagnosis, and greatly reducing the time cost and labor cost of NF1 gene diagnosis.

[0064] (4) Sample diversification: The template used for PCR can be peripheral blood, dried blood spots, or extracted genomic DNA, or it can be a human cell line or other specific tissues.

[0065] (5) The linkage relationship between different mutations can be detected. The amplification product obtained by using the primers of the present invention for long-fragment PCR is about 4kb-14kb, which can give full play to the advantages of long-read sequencing read length measurement. The linkage relationship between different NF1 gene mutations on the same DNA chain can be directly obtained without subsequent splicing operations. This is the most real and objective sequence analysis, reducing the errors caused by the splicing process.

[0066] (6) High-throughput detection. Long-read sequencing can use 384 types of DNA barcode adapters. In fact, more types of DNA barcode adapters can be designed according to needs, or a dual DNA barcode system with primers and adapters carrying DNA barcodes can be used to achieve more DNA barcode combinations. The high-throughput characteristics of the long-read sequencing platform determine that high-throughput sample detection can be achieved.

[0067] (7) High accuracy. PacBio's SMRT dumbbell library can be read multiple times during sequencing, and the base accuracy of the sequencing results after correction is greater than 99%. In addition, SMRT sequencing errors are random, and the base accuracy is greater than 99.9% after sequencing depth correction. Therefore, gene mutations within the primer detection range can be accurately read.

[0068] (8) Flexible detection time. The Nanopore platform can generate data within minutes, and data analysis can be started within minutes or hours depending on the actual data volume required. When the detection timeliness requirements are relatively high, the Nanopore platform has a time advantage. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 : Schematic diagram of the design of primer set for NF1 gene detection.

[0070] Figure 2 : Agarose gel electrophoresis of NF1 gene fragments of multiple long-fragment PCR amplification samples.

[0071] Figure 3 : PacBio sequencing results of representative NF1 gene mutation samples. Figure 3 A is the sequencing result of normal samples; Figure 3 B is the sequencing result of the sample with a large internal deletion of the NF1 gene; Figure 3 C is the sequencing result of the deep intron point mutation sample of NF1 gene.

[0072] Figure 4 : Sanger sequencing verification results of deep intronic point mutation samples detected by this method. DETAILED DESCRIPTION

[0073] As described above, traditional methods for detecting NF1 gene mutations, such as PCR+Sanger sequencing, STR analysis combined with quantitative PCR or MLPA testing, still have problems such as incomplete coverage of pathogenic genes, cumbersome genetic diagnostic testing methods, and single mutation type detection by different methods, which leads to missed detections and misdiagnosis in clinical practice.

[0074] In order to at least partially solve the above problems and one or more of other potential problems, the present invention provides a method based on multiple long-fragment PCR amplification and long-read sequencing to detect multiple mutations of the NF1 gene associated with type I neurofibroma. Multiple long-fragment PCR amplification is implemented in a single reaction tube to amplify 14 fragments (NF1 Exon1, NF1 Exon2, NF1 Exon3-5, NF1 Exon6-8, NF1 Exon9-12, NF1 Exon13-15, NF1Exon16-29, NF1 Exon30-31, NF1 Exon32-36, NF1Exon37-39, NF1Exon40-48, NF1 Exon49-51, NF1 Exon52-57, NF1 Exon58) for detecting mutations in all exons of the NF1 gene and introns at both ends, as well as gap fragments for detecting large fragment deletions of 50kb regions of the NF1 gene and its two flanking regions. Combined with the characteristics of the long-read sequencing platform, the present invention can achieve comprehensive, accurate, rapid and high-throughput detection of NF1 gene mutations. The method of the present invention is simple to operate, and the quality of long-fragment PCR and long-read sequencing libraries is reliable and highly reproducible, which is conducive to the application of long-read sequencing technology in clinical detection.

[0075] Embodiments of the present invention will be described in more detail below. However, it should be understood that the present invention can be implemented in various forms and should not be construed as being limited to the embodiments set forth herein, which are instead provided to provide a more thorough and complete understanding of the present invention. It should also be understood that the drawings and embodiments of the present invention are only for exemplary purposes and are not intended to limit the scope of protection of the present invention.

[0076] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. When there is a contradiction, the definition in this specification shall prevail. In addition, unless the context otherwise requires, the term in the singular form shall include the plural form, and the term in the plural form shall include the singular form. More specifically, as used in this specification and the appended claims, unless the context otherwise clearly indicates, the singular forms "a kind of", "one" and "the" include plural indicators. In the present invention, unless otherwise specified, "or" is used to mean "and / or". In addition, the use of the term "comprising" and other forms (such as "including" and "containing") is not restrictive. In addition, the range provided in the specification and the appended claims includes all values ​​between the endpoints and the endpoints.

[0077] Generally, terms relating to cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein and their techniques are those well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. See, e.g., Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2000); Abbas et al., Cellular and Molecular Immunology, 6th ed., WB Saunders Company (2010); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). In addition, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0078] definition

[0079] Further, in the following specification, reference will be made to a number of expressions, which are defined as having the following meanings.

[0080] As used herein, the term "genome" or "genomic DNA" refers to the complete genetic information of an organism or virus expressed as a nucleic acid sequence. Preferably, the genome or genomic DNA refers to the chromosomal DNA of the cell nucleus.

[0081] As used herein, the term "reference genome" refers to any specific known genome sequence, whether partial or complete, of any organism or virus that can be used to reference an identified sequence from a subject. For example, exemplary reference genomes for human subjects, as well as many other organisms, can be found at the National Center for Biotechnology Information ("National Center for Biotechnology Information, NCBI"). For example, a reference genome can be a human reference genome, such as GRCh37 or GRCh38.

[0082] As used herein, the term "NF1 gene" has the general meaning in the art and refers to a gene encoding neurofibromin (NP_000258.1). In humans, the gene ID of the NF1 gene is 4763, and with GRCh38 as the reference genome, it is located at positions 31094927 to 31377677 of chromosome 17 NC_000017.11.

[0083] As used herein, the term "flanking" refers to a DNA sequence extending on either side of a specific DNA sequence, locus or gene. The flanking region can be "upstream" (i.e., 5' end) or downstream (i.e., 3' end) of a specific DNA sequence, locus or gene. Unless otherwise specified, the length of the flanking region is not specifically limited. For example, the flanking region can contain several base pairs, tens of base pairs, hundreds of base pairs, thousands of base pairs or tens of thousands of base pairs.

[0084] As used herein, the term "primer" can be a natural or synthetic oligonucleotide that can serve as a starting point for nucleic acid synthesis after forming a duplex with a polynucleotide template and extending from its 3' end along the template to form an extended duplex. The nucleotides added to the 3' end of the extension product during the extension process are determined by the sequence of the template polynucleotide. Primers can usually be extended by a polymerase such as a nucleic acid polymerase. In the present invention, the term "primer pair" refers to a group of upstream primers and downstream primers that can hybridize with the double strands of a target DNA molecule or the flanking regions at both ends of a nucleotide sequence to be amplified in a target DNA molecule and can trigger amplification of a target DNA molecule or a nucleotide sequence to be amplified. The term "primer set" refers to a combination containing at least two primer pairs. The term "primer range" refers to a nucleic acid sequence region between the 3' end hybridization site of the upstream primer and the 3' end hybridization site of the downstream primer in the template polynucleotide, including all base sequences located in the region. As used herein, the term "mutation" or "variation" refers to a change in a nucleotide sequence compared to a reference genome. Mutations may involve entire chromosomes (e.g., aneuploidy). Mutations may involve large fragments of DNA (e.g., copy number variation). Mutations may involve small fragments of DNA. Examples of mutations involving small fragments of DNA include, for example, point mutations or single nucleotide polymorphisms, polynucleotide polymorphisms, insertions (e.g., adding one or more nucleotides at a locus), polynucleotide changes, deletions (e.g., losing one or more nucleotides at a locus), and inversions (e.g., reversal of one or more nucleotide sequences).

[0085] As used herein, the term "point mutation" refers to a substitution, insertion or deletion of a single nucleotide at a specific position in the genome.

[0086] As used herein, the term "small insertion / deletion" or "InDel" refers to the insertion or deletion of a nucleotide fragment less than 50 base pairs in length in a nucleotide sequence.

[0087] As used herein, the term "structural variation" refers to the structural differences of chromosomes with a length of more than 50 base pairs in a chromosome. Structural variation can be a deletion, duplication, copy number variation, insertion, inversion, translocation, or a combination thereof. Structural variation is a change in the arrangement or order of genomic fragments compared to a reference genome. According to certain embodiments, structural variation affects a sequence length of at least about 50 bases, preferably at least about 100 bases, more preferably at least about 1Kb (=1000 bases). According to certain embodiments, structural variation affects a sequence length of at most 300Mb (megabase=1000000 bases), for example at most 30Mb, for example at most 3Mb.

[0088] As used herein, the term "large deletion" refers to a deletion of a nucleotide fragment of more than 100 base pairs in a nucleotide sequence. For example, the large deletion found in the NF1 gene can be hundreds of base pairs, thousands of base pairs, or tens of thousands of base pairs in length.

[0089] As used herein, the term "deep intron" refers to intronic regions that are more than 100 base pairs away from exon-intron boundaries.

[0090] As used herein, the term "linkage" refers to the phenomenon that different mutations or genes located on the same chromosome are often linked together and do not separate when inherited and enter the same gamete.

[0091] As used herein, the term "long read sequencing" (also referred to as "third generation sequencing") generally refers to any sequencing method that can generate a sequencing read length (e.g., >1,000bp) that is significantly longer than second generation sequencing. In one embodiment, the method provided herein relates to sequencing using long reads. Non-limiting examples of long read sequencing systems include systems developed by Pacific Biosciences, Oxford Nanopore Technology, Quantapore, Stratos, and Helicos. In some cases, the long read sequencing method is single molecule real-time (Single Molecule Real-Time, SMRT) sequencing developed by Pacific Biosciences. In other cases, the long read sequencing method is nanopore (Nanopore) sequencing developed by Oxford Nanopore Technology. In some cases, long read sequencing covers any long read sequencing method or system (e.g., third generation sequencing method or system) currently being developed or developed in the future.

[0092] As used herein, the term "DNA barcode", "barcode", "DNA tag", "tag" or "Barcode" can be a known sequence used to associate a polynucleotide fragment with an input polynucleotide or a target polynucleotide from which it is produced. The barcode sequence can be a sequence of synthetic nucleotides or natural nucleotides. The barcode sequence can be contained within a linker sequence so that the barcode sequence is included in the sequencing read. The length of each barcode sequence may include at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more nucleotides. In some cases, the barcode sequences can have sufficient length and can be sufficiently different from each other to allow samples associated with them to be identified based on the barcode sequence. In some cases, the barcode sequence is used to label and subsequently identify "original" nucleic acid molecules (nucleic acid molecules present in a sample from a subject). In some cases, a barcode sequence or a combination of barcode sequences is used in conjunction with endogenous sequence information to identify the original nucleic acid molecules.

[0093] As used herein, the term "biological sample" or "sample" encompasses any sample obtained from a biological source. As a non-limiting example, a biological sample may include blood, amniotic fluid, serum, plasma, liquid or tissue biopsy samples, joint fluid, sweat, saliva, urine, feces, cerebrospinal fluid, ascites, pleural effusion, bile, pancreatic fluid, epidermal samples, skin samples, cheek swabs, sperm, gametes, blastocyst cells, cultured cells, bone marrow samples and / or chorionic villi. Convenient biological samples can be obtained by, for example, scraping cells from the buccal cavity surface. The term "biological sample" encompasses samples that have been processed to release nucleic acids or proteins or otherwise make them available for detection as described herein. The term "biological sample" also includes cell-free nucleic acids that may be present in a sample (e.g., plasma or amniotic fluid). For example, a biological sample may include cDNA obtained by reverse transcription of RNA from cells in a biological sample. Biological samples may be obtained from life stages, such as fetuses, youth, adults, etc. Fixed or frozen tissues may also be used.

[0094] Primer set

[0095] In order to at least partially solve the above problems and one or more of other potential problems, the first exemplary embodiment of the present invention proposes a primer set for detecting NF1 gene mutation, wherein the primer set comprises the following primers:

[0096] 28 primers used to amplify all exons of the NF1 gene and its flanking intronic regions:

[0097] E1F, E1R, E2F, E2R, E3F, E5R, E6F, E8R, E9F, E12R, E13F, E15R, E16F, E29R, E30F, E31R, E32F, E36R, E37F, E39R, E40F, E48R, E49F, E51R, E52F, E57R, E58F and E58R, whose sequences are shown in SEQ ID NOs: 1-28, respectively; and

[0098] 27 primers used to amplify the NF1 gene and the 50kb deletion region at both ends:

[0099] int1R1, int1R2, int1F1, int1F2, int1F3, int1F4, int5R, int8F, int12F, int29F, int36R1, int36R2, int36F1, int36F2, int36F3, int36F4, int57R, GF1, GF2, GF3, GF4, GF5, GR1, GR2, GR3, GR4 and GR5, whose sequences are shown in SEQ ID NOs: 29-55, respectively.

[0100] In one embodiment, the primer set provided by the present invention can cover all exons of the NF1 gene and the introns at both ends thereof, as well as 50 kb regions at both ends of the NF1 gene.

[0101] The primer set provided by the present invention can amplify the complete sequence within the primer range on the genome, and the length of the amplified fragment is about 4kb-14kb. The amplified product according to the above primer set can be used to stably detect any type of mutation within the primer range, as well as large fragment deletions related to the NF1 gene. The overall primer design idea of ​​the primer set can be referred to Figure 1 , the specific sequence information can be found in Table 1 below.

[0102] Table 1

[0103]

[0104]

[0105] In a preferred embodiment, if there is a SNP at the hybridization site between any primer in the primer set and the genomic DNA, a degenerate base primer is used. Those skilled in the art should be familiar with the design and synthesis of degenerate base primers.

[0106] In a preferred embodiment, in order to detect multiple samples simultaneously, the primers in the primer set can also be added with a DNA barcode at its 5' end for distinguishing different samples. The length of the DNA barcode can be 5-50nt DNA of different sequences, so that it can be used to distinguish different samples and realize simultaneous detection of multiple samples. The 5' end DNA barcodes of the forward primer and the reverse primer in the primer set can be symmetrical or asymmetrical, and those skilled in the art can select as needed. In a specific embodiment, when a symmetrical DNA barcode is used, the DNA barcode at the 5' end of the reverse primer should be reverse complementary to the DNA barcode at the 5' end of the forward primer.

[0107] The primer set of the present invention can be used to amplify multiple target fragments of the NF1 gene by multiple long-fragment PCR in a single reaction system.

[0108] The primer set of the present invention can be used to amplify NF1-related pathogenic gene fragments including all mutation types within the primer range through multiple long-fragment PCR in a single reaction system, and further combined with a subsequent long-read sequencing platform to simultaneously detect the mutation types of all gene fragments within the primer range.

[0109] The primer set of the present invention can be used to amplify NF1-related pathogenic gene fragments including mutation types within the primer range through multiple long-fragment PCR in a single reaction system, and further combined with a subsequent long-read sequencing platform to detect whether different NF1 gene mutations are linked.

[0110] In one embodiment, the NF1 gene mutation includes at least point mutations, small fragment insertions / deletions, structural variations in all exons of the NF1 gene and part of the intron region within the primer range, and large fragment deletions in the 50kb region flanking both ends of the NF1 gene. It should be noted that the point mutations, small fragment insertions / deletions, structural variations in all exons of the NF1 gene and part of the intron region within the primer range, and large fragment deletions in the 50kb region flanking both ends of the NF1 gene described in the present invention include not only NF1 gene mutations that can be queried in common human gene mutation databases and existing literature, but also unknown mutations in the above regions, which are not specifically limited here. The common human gene mutation databases include, for example, HGMD (https: / / www.hgmd.cf.ac.uk / ac / index.php), LOVD (https: / / www.lovd.nl / 3.0 / home) and ClinVar (https: / / www.ncbi.nlm.nih.gov / clinvar / ).

[0111] Reagent test kit

[0112] To at least partially solve one or more of the above problems and other potential problems, a second exemplary embodiment of the present invention provides a kit for detecting NF1 gene mutation, which at least comprises the primer set provided according to the first exemplary embodiment of the present invention.

[0113] In one embodiment, in order to use the primer set to achieve amplification of the target fragment, the kit may also include a reagent for multiple long-fragment PCR amplification. Specifically, the reagent for multiple long-fragment PCR amplification is used in combination with the primer set provided in the first exemplary embodiment of the present invention to achieve amplification of the target fragment.

[0114] In a specific embodiment, the reagents for multiple long-fragment PCR amplification include at least one of a DNA polymerase, dNTPs and a reaction buffer.

[0115] Multiplex PCR (mPCR) is also called composite PCR. Its basic principle is the same as conventional PCR. The difference is that two or more pairs of primers are added to the multiplex PCR reaction system. Each pair of primers binds to the corresponding position of the template, and PCR reactions of multiple nucleic acid fragments are amplified simultaneously.

[0116] In a preferred embodiment, the primer sets of the present invention are provided mixed in a single reaction tube.

[0117] In one embodiment, those skilled in the art may also choose whether to purify the amplified product obtained by multiple long-fragment PCR amplification according to actual conditions. In a specific embodiment, in order to purify the amplified product obtained by the multiple long-fragment PCR amplification, the kit may also include a reagent for DNA purification, such as a DNA purification reagent based on magnetic beads, such as DNA purification magnetic beads; or a DNA purification reagent based on a silica membrane adsorption column.

[0118] In one embodiment, in order to simultaneously detect multiple NF1 gene mutations based on the amplified products of the above primer set, the kit may further include reagents for constructing a long-read sequencing library. Specifically, the reagents for constructing a long-read sequencing library are used to construct a long-read sequencing library for the amplified products obtained by amplification of the above primer set, and the long-read sequencing library is used for long-read sequencing to obtain the sequencing results of the long-read sequencing library.

[0119] Specifically, the long-read sequencing can be single-molecule real-time (SMRT) sequencing from Pacific Biosciences, Inc. Single-molecule real-time sequencing is a long-read sequencing technology that identifies bases based on different fluorescent signals generated when different nucleotides bind to the sequence during nucleic acid molecule synthesis.

[0120] In one embodiment, in order to realize the construction of a single-molecule real-time sequencing library, the kit may further include reagents for constructing a single-molecule real-time sequencing library. Specifically, the reagents for constructing a single-molecule real-time sequencing library include at least one of a damage repair reagent, an end repair reagent, a label ligation reagent, a DNA purification reagent, a linker ligation reagent, and an exonuclease.

[0121] In a specific embodiment, the adapter ligation reagent for constructing a single molecule real-time sequencing library comprises at least a PacBio hairpin adapter. In a specific embodiment, the sequence of the PacBio blunt-end hairpin adapter is

[0122] 5'- / 5Phos / ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 56), the PacBio sticky end hairpin adapter sequence is

[0123] 5'- / 5Phos / ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 57).

[0124] In a preferred embodiment, the PacBio hairpin adapter is annealed to form a stem-loop structure adapter adapter. In order to detect multiple samples at the same time, the PacBio hairpin adapter can also add a DNA barcode to its stem to distinguish different samples. The length of the DNA barcode can be 5-50 nt of DNA with different sequences, so that it can be used to distinguish different samples and realize the simultaneous detection of multiple samples. The DNA barcode in the stem of the PacBio hairpin adapter can be symmetrical or asymmetrical, and those skilled in the art can choose according to their needs. For example, in a specific embodiment, the sequence of the PacBio blunt-end hairpin adapter with a symmetrical DNA barcode is

[0125] 5'- / 5Phos / (Barcode)ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT(Reverse Complement Barcode)-3'. For example, in another specific embodiment, the sequence of the PacBio blunt-end hairpin adapter with an asymmetric DNA barcode is

[0126] 5'- / 5Phos / (Barcode1)ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT(Barcode2)-3'.

[0127] In one embodiment, the DNA barcode is a DNA barcode designed by PacBio or a self-designed DNA barcode, which can be selected by those skilled in the art as needed.

[0128] Specifically, the long-read sequencing may also be nanopore sequencing from Oxford Nanopore Technology. Nanopore sequencing technology is a long-read sequencing technology that identifies bases based on the difference in electrical signals generated when different nucleotides pass through a nanopore.

[0129] In one embodiment, in order to realize the construction of a nanopore sequencing library, the kit may further include reagents for constructing a nanopore sequencing library. Specifically, the reagents for constructing a nanopore sequencing library include at least one of a damage repair reagent, an end repair reagent, a label ligation reagent, a DNA purification reagent, and a linker ligation reagent.

[0130] In a specific embodiment, the adapter ligation reagent for constructing a nanopore sequencing library comprises at least a nanopore universal sequencing adapter, and the nanopore universal sequencing adapter comprises a polynucleotide sequencing adapter and a motor protein loaded to the polynucleotide adapter.

[0131] In a preferred embodiment, in order to detect multiple samples simultaneously, the label connection reagent for constructing the nanopore sequencing library includes at least a DNA barcode fragment. The length of the DNA barcode can be 5-50 nt of DNA with different sequences, so that it can be used to distinguish different samples and realize simultaneous detection of multiple samples. In one embodiment, the DNA barcode is a DNA barcode designed by ONT or a self-designed DNA barcode, and those skilled in the art can select it as needed.

[0132] In a specific embodiment, the kit may also optionally include a conventional kit known in the art. Those skilled in the art may select the reagent composition in the kit according to actual needs, and the present invention does not impose any limitation on this.

[0133] The kit of the present invention can be used to amplify NF1-related pathogenic gene fragments including mutation types within all primer ranges through multiple long-fragment PCR in a single reaction system, and further combined with a subsequent long-read sequencing platform to simultaneously detect the mutation types of all gene fragments within the primer range.

[0134] The kit of the present invention can be used to amplify NF1-related pathogenic gene fragments including mutation types within all primer ranges through multiple long-fragment PCR in a single reaction system, and further combined with a subsequent long-read sequencing platform to detect whether different NF1 gene mutations are linked.

[0135] In one embodiment, the NF1 gene mutation at least includes point mutations, small insertion / deletion, structural variation in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions at both ends of the NF1 gene. It should be noted that the point mutations, small insertion / deletion, structural variation in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions at both ends of the NF1 gene described in the present invention include not only NF1 gene mutations that can be queried in common human gene mutation databases and existing literature, but also unknown mutations in the above regions, which are not specifically limited here.

[0136] Detection Methods

[0137] In order to at least partially solve the above problems and one or more of other potential problems, a third exemplary embodiment of the present invention proposes a method for detecting NF1 gene mutation, comprising the following steps:

[0138] (1) Obtaining samples from subjects;

[0139] (2) using the primer set provided according to the first exemplary embodiment or the kit provided according to the second exemplary embodiment to amplify the NF1 gene fragment in the sample by multiple long-fragment PCR to obtain a target fragment amplicon;

[0140] (3) constructing a long-read sequencing library based on the amplicon;

[0141] (4) performing long-read sequencing based on the long-read sequencing library to obtain a long-read sequencing result;

[0142] (5) Analyze and determine the NF1 gene mutation type based on the long-read sequencing results.

[0143] In one embodiment, the sample in step (1) is selected from a biological sample or genomic DNA extracted from a sample. Preferably, the biological sample can be a cultured cell line, blood, tissue, amniotic fluid, chorionic villi, gametes, blastocyst cells, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile or pancreatic fluid, etc., which are not specifically limited here.

[0144] In one embodiment, the amplification of the NF1 gene fragment in the sample in step (2) can be completed in a single reaction system.

[0145] In one embodiment, after step (2), the amplified product can be preliminarily analyzed by electrophoresis. When the NF1 gene of the sample does not have a large fragment deletion, the amplified product should contain 14 target fragments amplified by 28 primers for amplifying all exons of the NF1 gene and the flanking intron regions at both ends. The fragment length should be in the range of 4kb-14kb, and different primer pairs can amplify amplified fragments of different lengths. When the NF1 gene of the sample has a large fragment deletion, the primers upstream and downstream of the deletion site will amplify truncated fragments.

[0146] In one embodiment, after step (2), a person skilled in the art may also choose whether to purify the amplification product obtained by multiple long-fragment PCR amplification according to actual conditions.

[0147] In one embodiment, the construction of a long-read sequencing library in step (3) includes optional steps and means for constructing a long-read sequencing library known in the art, including but not limited to damage repair, end repair, label ligation, adapter ligation, purification, and exonuclease digestion.

[0148] In a specific embodiment, the long read sequencing library in step (3) is suitable for a single molecule real-time sequencing platform. Typically, constructing a single molecule real-time sequencing library comprises:

[0149] (3.1) performing DNA damage repair and end repair on the target fragment obtained in step (2), and optionally, adding base A to the 3' end of the end-repaired target fragment;

[0150] (3.2) Connecting the two ends of the repaired target fragment obtained in step (3.1) to the PacBio hairpin adapter;

[0151] (3.3) digesting the ligation product obtained in step (3.2) with an exonuclease;

[0152] (3.4) Purify the digestion product obtained in step (3.3) to obtain a single molecule real-time sequencing library.

[0153] In one embodiment, the connection of the PacBio hairpin adapter in step (3.2) can be performed by blunt-end connection or sticky-end connection.

[0154] In a specific embodiment, the PacBio blunt-ended hairpin adapter sequence is

[0155] 5'- / 5Phos / ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 56), the PacBio sticky end hairpin adapter sequence is

[0156] 5'- / 5Phos / ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 57).

[0157] In a preferred embodiment, the PacBio hairpin adapter is annealed to form a stem-loop structure adapter adapter. In order to detect multiple samples at the same time, the PacBio hairpin adapter can also add a DNA barcode to its stem to distinguish different samples. The length of the DNA barcode can be 5-50 nt of DNA with different sequences, so that it can be used to distinguish different samples and realize the simultaneous detection of multiple samples. The DNA barcode in the stem of the PacBio hairpin adapter can be symmetrical or asymmetrical, and those skilled in the art can choose according to their needs. For example, in a specific embodiment, the sequence of the PacBio blunt-end hairpin adapter with a symmetrical DNA barcode is

[0158] 5'- / 5Phos / (Barcode)ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT(Reverse Complement Barcode)-3'. For example, in another specific embodiment, the sequence of the PacBio blunt-end hairpin adapter with an asymmetric DNA barcode is

[0159] 5'- / 5Phos / (Barcode1)ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT(Barcode2)-3'.

[0160] In one embodiment, the DNA barcode is a DNA barcode designed by PacBio or a self-designed DNA barcode, which can be selected by those skilled in the art as needed.

[0161] In a specific embodiment, the long-read sequencing library in step (3) is suitable for a nanopore sequencing platform. Typically, constructing a nanopore sequencing library comprises:

[0162] (3.1) performing DNA damage repair and end repair on the target fragment obtained in step (2), and optionally, adding base A to the 3' end of the end-repaired target fragment;

[0163] (3.2) connecting both ends of the repaired target fragment obtained in step (3.1) to the nanopore universal sequencing adapter;

[0164] (3.3) Purify the ligation product obtained in step (3.2) to obtain a nanopore sequencing library.

[0165] In one embodiment, the ligation of the nanopore universal sequencing adapter in step (3.2) can be performed by blunt-end ligation or sticky-end ligation.

[0166] In a specific embodiment, the nanopore universal sequencing adapter comprises a polynucleotide sequencing adapter and a motor protein loaded to the polynucleotide adapter.

[0167] In a preferred embodiment, in order to detect multiple samples simultaneously, before step (3.2), DNA barcodes are connected to both ends of the repaired target fragment obtained in step (3.1). The length of the DNA barcode can be 5-50 nt of DNA with different sequences, so that it can be used to distinguish different samples and realize simultaneous detection of multiple samples. In one embodiment, the DNA barcode is a DNA barcode designed by ONT or a self-designed DNA barcode, and those skilled in the art can choose as needed.

[0168] In one embodiment, the long-read sequencing described in step (4) is selected from single-molecule real-time sequencing of PacBio or nanopore sequencing of ONT.

[0169] In one embodiment, the step (5) of analyzing and determining the NF1 gene mutation type according to the long read sequencing results comprises:

[0170] (5.1) Perform basic quality control and filtering on long-read sequencing results to obtain valid sequencing results;

[0171] (5.2) Compare the effective sequencing results with the reference genome to obtain a comparison result;

[0172] (5.3) Analyze the comparison results and identify the NF1 gene mutation.

[0173] In one embodiment, the basic quality control and filtering of the long-read sequencing results described in step (5.1) can use the optional steps and means for basic quality control and filtering of long-read sequencing results known in the art, including but not limited to removing sequencing adapters, low-quality bases, contaminating sequences, and sample splitting.

[0174] In one embodiment, the NF1 gene mutation in step (5.3) includes at least point mutations, small insertion / deletion, structural variation, and large deletions of 50 kb regions at both ends of the NF1 gene in all exons and part of the intron region within the primer range. It should be noted that the point mutations, small insertion / deletion, structural variation, and large deletions of 50 kb regions at both ends of the NF1 gene in all exons and part of the intron region within the primer range of the NF1 gene described in the present invention include not only NF1 gene mutations that can be queried in common human gene mutation databases and existing literature, but also unknown mutations in the above regions, which are not specifically limited here.

[0175] In one embodiment, the method further comprises: analyzing and determining whether different NF1 gene mutations are linked based on the long read sequencing results. Specifically, the long read sequencing of the present application can detect the complete amplicon length of the amplified product, so that multiple mutations on the amplified fragment can be detected at the same time, thereby determining whether different NF1 gene mutations are linked.

[0176] The method described in the present invention is based on a specific combination of multiple long-fragment PCR and long-read sequencing, and can simultaneously detect multiple mutations of the NF1 gene in multiple samples with high specificity, accuracy and speed.

[0177] Detection system

[0178] In order to at least partially solve the above problems and one or more of other potential problems, a fourth exemplary embodiment of the present invention proposes a system for detecting NF1 gene mutations, comprising the following modules:

[0179] (1) an amplification module: used to amplify the NF1 gene fragment in the sample from the subject by multiple long-fragment PCR using the primer set provided according to the first exemplary embodiment or the kit provided according to the second exemplary embodiment to obtain the target fragment amplicon;

[0180] (2) Library construction module: used to construct a long-read sequencing library based on the amplicon;

[0181] (3) Sequencing module: used to perform long-read sequencing based on the long-read sequencing library to obtain long-read sequencing results;

[0182] (4) Mutation analysis module: used to analyze and determine the NF1 gene mutation type based on the long-read sequencing results.

[0183] In one embodiment, the sample is selected from a biological sample or genomic DNA extracted from a sample. Preferably, the biological sample can be a cultured cell line, blood, tissue, amniotic fluid, chorionic villi, gametes, blastocyst cells, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile or pancreatic fluid, etc., which are not specifically limited here.

[0184] In one embodiment, the multiplex long-range PCR is performed in a single reaction tube.

[0185] In one embodiment, the long read sequencing is selected from single molecule real-time sequencing or nanopore sequencing.

[0186] In one embodiment, the mutation analysis module can be used to determine one or more of the following NF1 gene mutations: point mutations, small insertion / deletions, structural variations in all exons of the NF1 gene and some intronic regions within the primer range, and large deletions of 50 kb regions on both ends of the NF1 gene.

[0187] In one embodiment, the mutation analysis module can also analyze and determine whether different NF1 gene mutations are linked based on the long-read sequencing results.

[0188] It should be noted that the system of the present invention is specifically used to detect NF1 gene mutations, wherein each module can refer to existing equipment, for example, the amplification module can refer to the existing PCR amplification instrument, the library construction module can refer to the existing library construction kit and automated loading equipment, the sequencing module can refer to the existing long-read sequencing device, and the mutation analysis module can refer to the existing computing equipment with bioinformatics processing and analysis software, which are not specifically limited here. The connection between the modules in the system for detecting NF1 gene mutations of the present invention can refer to the existing laboratory automation equipment, which are not specifically limited here. It can be understood that the key to this application is to organically integrate the existing scattered devices or components together to achieve the purpose of detecting NF1 gene mutations.

[0189] It can be understood that the system for detecting NF1 gene mutation of the present application actually uses various modules to implement various steps in the method for detecting NF1 gene mutation of the present application. Therefore, the preferred technical solutions of various modules in the system of the present invention, such as primers used for multiple long-fragment PCR amplification, methods for constructing long-read sequencing libraries, methods for determining mutation types, etc., can all refer to the method for detecting NF1 gene mutation provided in the third exemplary embodiment of the present invention, and will not be repeated here.

[0190] application

[0191] In order to at least partially solve the above problems and one or more of other potential problems, the fifth exemplary embodiment of the present invention proposes the use of the primer set provided according to the first exemplary embodiment of the present invention or the kit provided according to the second exemplary embodiment of the present invention in any of the following aspects:

[0192] 1) Detection of NF1 gene mutation;

[0193] 2) Linkage analysis of different NF1 gene mutations;

[0194] 3) Genetic diagnosis of neurofibromatosis type I.

[0195] In order to at least partially solve the above problems and one or more of other potential problems, the sixth exemplary embodiment of the present invention proposes the use of the primer set provided according to the first exemplary embodiment of the present invention or the kit provided according to the second exemplary embodiment of the present invention in preparing any of the following products:

[0196] 1) Products for detecting NF1 gene mutations;

[0197] 2) Products for linkage analysis of different NF1 gene mutations;

[0198] 3) Products used for genetic diagnosis of neurofibromatosis type I.

[0199] In one embodiment, the NF1 gene mutation at least includes point mutations, small insertion / deletion, structural variation in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions at both ends of the NF1 gene. It should be noted that the point mutations, small insertion / deletion, structural variation in all exons of the NF1 gene and part of the intron region within the primer range, and large deletions of 50 kb regions at both ends of the NF1 gene described in the present invention include not only NF1 gene mutations that can be queried in common human gene mutation databases and existing literature, but also unknown mutations in the above regions, which are not specifically limited here.

[0200] Preferred Embodiments

[0201] The following is a detailed description of the preferred embodiments of the present invention in conjunction with the accompanying drawings. The following description is exemplary and not intended to limit the present invention, and any other similar situations also fall within the protection scope of the present invention.

[0202] Example 1: Amplification of NF1 gene fragments using the multiple long-fragment PCR method of the present invention

[0203] Prepare the reaction system according to Table 2 below to amplify peripheral blood, dried blood spots or genomic DNA samples:

[0204] Table 2:

[0205]

[0206] On the PCR instrument, pre-amplification was performed according to the conditions shown in Table 3 below:

[0207] Table 3:

[0208]

[0209] After amplification, 5 μL of each sample was taken and tested on a 1% agarose gel. The results were as follows: Figure 2 As shown, using different samples as templates, multiple target fragments of the NF1 gene can be effectively amplified.

[0210] Example 2: Construction of PacBio sequencing library using the long-fragment PCR method of the present invention

[0211] Step 1: Long-range PCR amplification

[0212] Prepare the reaction system according to Table 4 below to amplify peripheral blood samples with different types of NF1 gene mutations:

[0213] Table 4:

[0214]

[0215] On the PCR instrument, pre-amplification was performed according to the conditions shown in Table 5 below:

[0216] Table 5:

[0217]

[0218] After amplification, the amplified product was placed in a centrifuge at 10,000 rpm for 20 minutes. After centrifugation, the product was placed horizontally and 4 μL of the supernatant was added to a new tube.

[0219] Step 2: Construction of PacBio sequencing library

[0220] Prepare the reaction system according to Table 6 below:

[0221] Table 6:

[0222]

[0223] On a PCR instrument, the reaction was carried out under the following conditions: 37°C for 20 min; 25°C for 15 min; 65°C for 10 min. After the reaction was completed, 0.5 μL Exonuclease III (NEB, Cat#M0206L) and 0.5 μL Exonuclease VII (NEB, Cat#M0379L) were added and the reaction was continued at 37°C for 1 hour. After the reaction was completed, 0.6x Ampure PB magnetic beads (PacBio, Cat#100-265-900) were used for purification twice according to the manufacturer's instructions, and finally the DNA was eluted with 10 μL Eliution Buffer. The obtained DNA eluate is the PacBio sequencing library of the target DNA. The DNA concentration was determined on a Qubit 3 Fluoromter (ThermoFisher, Cat#Q33216) using Qubit dsDNA HS reagent (ThermoFisher, Cat#Q32851). When there are multiple sample PacBio sequencing libraries, equal amounts of the libraries can be mixed together to prepare a mixed library.

[0224] Step 3: PacBio sequencing and analysis

[0225] According to the total concentration and molar concentration of the library, an appropriate volume of the library was reacted with the binding reagent (PacBio, Cat#101-820-200) and sequencing primer (PacBio, Cat#100-970-100) to prepare the final library that can be used in the machine. Representative sequencing results are shown in Figure 3 As shown, Figure 3 A is the IGV schematic diagram of the sequencing results of the WT sample. Figure 3 B is the IGV schematic diagram of the sequencing results of the sample with a large internal deletion of the NF1 gene. Figure 3 C is the IGV schematic diagram of the sequencing results of the NF1 deep intronic point mutation sample.

[0226] Example 3: Detection and verification of NF1 gene mutation

[0227] The genomic DNA of peripheral blood or tissues of 30 subjects were collected as validation samples, and with reference to Example 2, the method of the present invention (and the kit) was used to simultaneously detect multiple mutations of the NF1 gene. As a control, the NF1 gene mutations were detected by NGS and Sanger sequencing at the same time. The results obtained by the method of the present invention were compared with the results obtained by the control method. As shown in Table 7, the results of 27 samples of NF1 point mutations or small fragment insertion / deletion mutations were completely consistent. In addition, through the present invention, the specific breakpoint of 1 sample with large fragment deletion mutation was clarified, and 1 sample detected a deep intronic point mutation of NF1, which was verified by Sanger sequencing ( Figure 4 ), and a large deletion within the NF1 gene was detected in one sample.

[0228] Table 7

[0229]

[0230]

[0231] Therefore, the results detected by the method of the present invention, after comparison with NGS and Sanger sequencing methods, both showed that the specificity and sensitivity reached 100%.

[0232] It should be noted that the aforementioned examples are merely illustrative and are used to explain some of the features of the present invention. The attached claims are intended to require the widest possible range that can be imagined, and the embodiments presented herein are only descriptions of the selected implementation methods according to the combination of all possible embodiments. Therefore, the applicant's intention is that the attached claims are not limited by the selection of examples that illustrate the features of the present invention. As used in the claims, the term "including" and its semantic variants logically also include different and changing terms, such as but not limited to "essentially composed of" or "consisting of". When necessary, some numerical ranges are provided, and these ranges also include sub-ranges between them. The changes in these ranges are also self-evident to those skilled in the art, and should not be considered to be donated to the public, and these changes should also be interpreted as being covered by the attached claims where possible. For example, the reaction reagents, reaction conditions, etc. involved in the long-fragment PCR reaction and the construction of the third-generation sequencing library can be adjusted and changed accordingly according to specific needs. Furthermore, advances in technology will result in possible equivalents or sub-alternatives that are not presently contemplated due to inaccuracies in the language, and such variations should also be construed to be covered by the appended claims, where possible.

[0233] References

[0234] [1]D.G.Evans,E.Howard,C.Giblin,et al.Birth Incidence and Prevalenceof Tumor-Prone Syndromes:Estimates From a UK Family Genetic RegisterService.American Journal of Medical Genetics Part A.2010.152A(2):327-332.

[0235] [2]E.Uusitalo,J. A.Koffert,et al.Incidence and Mortalityof Neurofibromatosis:A Total Population Study in Finland.Journal ofInvestigative Dermatology.2015.135(3):904–906.

[0236] [3]R.A. E.Uusitalo,J. et al.Prevalence ofneurofibromatosis type 1in the Finnish population.Genetics inMedicine.2017.20:1082-1086.

[0237] [4]No authors listed.Neurofibromatosis.National Institutes ofHealthConsensus Development Conference Statement.1987.6(12):1-7.

[0238] [5]E.Legius,L.Messiaen,P.Wolkenstein,et al.Revised diagnosticcriteria for neurofibromatosis type 1and Legius syndrome:an internationalconsensus recommendation.Genetics in Medicine.2021.23(8):1506-1513.

[0239] [6] Wang Zhichao, Li Qingfeng. Expert consensus on clinical diagnosis and treatment of neurofibromatosis type Ⅰ. Chinese Journal of Reparative and Reconstructive Surgery. 2021, 35(11): 1384-1395.

[0240] [7] China Rare Disease Alliance Neurofibromatosis Type 1 Multidisciplinary Diagnosis and Treatment Collaboration Group. Multidisciplinary Diagnosis and Treatment Guidelines for Neurofibromatosis Type 1. Rare Disease Research. 2023.2(2):210-230.

[0241] [8] K. DeBella, J. Szudek and JMFriedman. Use of the national institutes of health criteria for diagnosis of neurofibromatosis in children. Pediatrics. 2000.105(3):608-614.

[0242] [9] M.Upadhyaya, DJShaw and PSHarper. Molecular basis of neurofibromatosis type 1(NF1): mutation analysis and polymorphisms in the NF1gene. Human Mutation. 1994.4(2):83-101.

[0243]

[10] M.Upadhyaya.Gene Structure and NF1 Genotype / PhenotypeCorrelations.Oncology.2008.16:46-62.

[0244]

[11] M.Clementi, G.Barbujani, L.Turolla, et al. Neurofibromatosis-1: amaximum likelihood estimation of mutation rate. Human Genetics. 1990.84(2):116-118.

[0245]

[12] D.N.Cooper and M.Upadhyaya.The Germline Mutational Spectrum inNeurofibromatosis Type 1 and Genotype–Phenotype Correlations.Springer BerlinHeidelberg.2012:115-134.

[0246]

[13] M.Upadhyaya.The Molecular Biology of Neurofibromatosis Type1.Morgan&Claypool Life Sciences.2014.

[0247]

[14] K.Wimmer,S.Yao,K.Claes,et al.Spectrum of single-and multiexon NF1copy number changes in a cohort of 1,100 unselected NF1 patients.GenesChromosomes Cancer.2006.45(3):265-276.

[0248]

[15] M.C.Valero,Y.Martín,E.Hernández-Imaz,et al.A highly sensitivegenetic protocol to detect NF1 mutations.The Journal of MolecularDiagnostics.2011.13(2):113-122.

[0249]

[16] A.Sabbagh,E.Pasmant,A.Imbard,et al.NF1 molecular characterizationand neurofibromatosis type I genotype-phenotype correlation:the Frenchexperience.Human Mutation.2013.34:1510-1518.

[0250]

[17] K.S.Cunha,N.S.Oliveira,A.K.Fausto,et al.Hybridization Capture-Based Next-Generation Sequencing to Evaluate Coding Sequence and DeepIntronic Mutations in the NF1 Gene.Genes.2016.7(12):133.

Claims

1. A primer set for detecting NF1 gene mutation, wherein the primer set comprises the following primers: Primers for amplifying all exons of the NF1 gene and the flanking intron regions at both ends thereof, the sequences of which are shown in SEQ ID NOs: 1-28; and The primers used to amplify the deletion mutation of the NF1 gene and the 50 kb regions flanking both ends thereof have sequences shown in SEQ ID NOs: 29-55. 2 . The primer set according to claim 1 , wherein the 5′ end of the primer is further connected to a DNA barcode for distinguishing different samples.

3. The primer set according to claim 1 or 2, wherein the NF1 gene mutation comprises one or more of the following mutations: point mutations, small insertion / deletions, structural variations within the NF1 gene, and large deletions of 50 kb regions flanking both ends of the NF1 gene.

4. A kit for detecting NF1 gene mutation, comprising the primer set according to any one of claims 1 to 3.

5. The kit according to claim 4, wherein the kit further comprises reagents for multiple long-fragment PCR amplification, reagents for DNA purification and / or reagents for constructing a long-read sequencing library. 6 . The kit according to claim 5 , wherein the reagents for multiple long-fragment PCR amplification include at least one of a DNA polymerase, dNTPs and a reaction buffer.

7. The kit according to claim 5, wherein the reagents for constructing a long-read sequencing library include at least one of a damage repair reagent, an end repair reagent, a label ligation reagent, a DNA purification reagent, a linker ligation reagent and an exonuclease.

8. The kit according to claim 5, wherein the long-read sequencing library is suitable for a single-molecule real-time sequencing platform or a nanopore sequencing platform.

9. The kit according to claim 4, wherein the primer sets are provided mixed in a single reaction tube.

10. The kit according to any one of claims 4 to 9, wherein the NF1 gene mutation comprises one or more of the following mutations: point mutations, small insertion / deletions, structural variations within the NF1 gene, and large deletions of 50 kb regions flanking both ends of the NF1 gene.

11. A system for detecting NF1 gene mutations, comprising the following modules: (1) an amplification module: used to amplify the NF1 gene fragment in a sample derived from a subject by multiple long-fragment PCR using the primer set described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 10 to obtain a target fragment amplicon; (2) Library construction module: used to construct a long-read sequencing library based on the amplicon; (3) Sequencing module: used to perform long-read sequencing based on the long-read sequencing library to obtain long-read sequencing results; (4) Mutation analysis module: used to analyze and determine the NF1 gene mutation type based on the long-read sequencing results.

12. The system of claim 11, wherein the multiplex long-range PCR is performed in a single reaction tube.

13. The system of claim 11, wherein the long-read sequencing is selected from single-molecule real-time sequencing or nanopore sequencing.

14. The system according to any one of claims 11-13, wherein the mutation analysis module can be used to determine one or more of the following NF1 gene mutations: point mutations, small insertion / deletions, structural variations within the NF1 gene, and large deletions of 50 kb regions flanking both ends of the NF1 gene.

15. The system according to any one of claims 11-13, wherein the mutation analysis module can also be used to determine whether different NF1 gene mutations are linked.

16. Use of the primer set according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 10 in the preparation of any of the following products: 1) Products for detecting NF1 gene mutations; 2) Products for linkage analysis of different NF1 gene mutations; 3) Products used for genetic diagnosis of neurofibromatosis type I.

17. The use according to claim 16, wherein the NF1 gene mutation comprises one or more of the following mutations: point mutations within the NF1 gene, small insertion / deletion, structural variation, and large deletions of 50 kb regions flanking both ends of the NF1 gene.

Images