Substance for inhibiting KCNK3 gene and application of substance in regulation and control of fat metabolism or ferroptosis

Abstract

The invention discloses a substance for inhibiting a KCNK3 gene and application of the substance in regulation and control of fat metabolism or ferroptosis. A gene knockout and overexpression cell line is constructed by utilizing a CRISPR / Cas9 technology, and KCNK3 knockout inhibits lipid synthesis and accumulation of porcine preadipocytes and promotes fat hydrolysis and heat production. A transcriptome and lipidome combined analysis technology is further utilized to analyze KCNK3 gene knockout cells, and the KCNK3 is found to regulate and control the biological process of fat metabolism and ferroptosis. By detecting the iron content, ROS level, glutathione level, mitochondrial morphological characteristics and the like in KCNK3 knockout PK15 cells, it is proved that KCNK3 knockout promotes ferroptosis. According to the invention, the effects of the KCNK3 gene in promoting pig fat formation and inhibiting ferroptosis are discovered for the first time, and the discovery is of great significance in regulating fat deposition of pigs and treating human obesity and ferroptosis related diseases by using the KCNK3 gene.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a substance for inhibiting the KCNK3 gene and an application thereof in regulating fat metabolism or ferroptosis. Background Art

[0002] Improving fat deposition in livestock meat and cultivating new low-fat, high-quality varieties have always been the goal of breeders. Over the years, some genes related to fat deposition have been screened using omics technology, but only MSTN, UCP1 and MC3R have been verified as molecular breeding targets in animals. The research on the regulatory mechanism of fat deposition in livestock is not in-depth enough, and there is still a lack of genes with breeding value. The lack of major effect genes for fat deposition traits is the main "bottleneck" of biological breeding.

[0003] Ferroptosis is a programmed cell death that is dependent on iron ions. Excessive iron in cells will produce ROS through the Fenton reaction. ROS can react with polyunsaturated fatty acids (PUFAs) on lipid membranes to induce lipid peroxidation, causing ferroptosis. Moreover, ferroptosis is also closely related to the occurrence and development of many diseases such as neurological diseases (Huntington's disease, Alzheimer's disease, etc.), tissue ischemia-reperfusion injury (brain, liver, kidney, etc.), hepatopulmonary fibrosis, heart disease, osteoarthritis, obesity and diabetic complications. Therefore, discovering new targets for inhibiting ferroptosis-related pathways can not only reduce fat deposition, but is also considered a potential hope and direction for treating related diseases.

[0004] In addition, pig organ transplantation is of great significance for the treatment of human diseases, and the discovery of pig fat metabolism and ferroptosis regulatory genes will have important reference value for studying human obesity and ferroptosis complications.

[0005] KCNK3, potassium channel, subfamily K, member3, is a 21kDa to 24kDa transmembrane protein that participates in the formation of cell membrane structure vesicles (caveolae). Its 82-101 amino acid residue region is called the scaffolding domain (SCD), which is the structural basis for interaction with other molecules. KCNK3 is widely distributed in terminally differentiated cells or quiescent cells in the body. KCNK3 can participate in the regulation of signal transduction, inhibit cell growth and transformation, and vesicle transport (including endocytosis, pinocytosis and transcytosis). However, the role of KCNK3 in fat metabolism and ferroptosis in livestock (such as pigs) has not been reported. Summary of the invention

[0006] In order to solve at least one of the above problems, the present disclosure provides RNA that inhibits the KCNK3 gene and its use in regulating fat metabolism or regulating ferroptosis.

[0007] According to one aspect of the present disclosure, there is provided a use of a substance that inhibits the KCNK3 gene in regulating fat metabolism or regulating ferroptosis.

[0008] In some embodiments, the application of regulating fat metabolism or regulating ferroptosis includes: (1) Inhibit KCNK3 protein expression; (2) inhibiting adipogenic differentiation and / or fatty acid synthesis, and / or promoting lipolysis; (3) Promote cell ferroptosis; (4) increase the abundance of polyunsaturated fatty acids; (5) upregulation of total triglycerides, fatty acyl, sterol lipids, glycerides, and / or glycerophospholipids; and / or downregulation of hexosylceramide, monogalactosyl diacylglycerol, and / or sphingolipids; (6) Reduce fat deposition; and / or promote lipid peroxidation; (7) inhibiting glutathione metabolism and / or reducing total intracellular glutathione production, including reduced glutathione and oxidized glutathione; (8) Increase cellular ROS levels; (9) preparing KCNK3 inhibitors; (10) preparing drugs for regulating lipid metabolism or regulating ferroptosis, and / or preparing drugs for preventing, alleviating and / or treating obesity and its complications; (11) preparing drugs for regulating ferroptosis, and / or preparing drugs for preventing, alleviating and / or treating diseases related to ferroptosis; (12) Preparation of model cells for lipid metabolism diseases or ferroptosis-related diseases; (13) preparing a kit for constructing model cells for lipid metabolism diseases or ferroptosis-related diseases; (14) Preparation of animal models of lipid metabolism diseases or ferroptosis-related diseases; (15) Preparing a kit for constructing an animal model of a lipid metabolism disease or a ferroptosis-related disease; (16) For the breeding or cultivation of livestock animals.

[0009] In some embodiments, the ferroptosis-related diseases include, but are not limited to, neurological diseases, tissue ischemia-reperfusion injury, hepatopulmonary fibrosis, heart disease, osteoarthritis, and diabetes.

[0010] In some embodiments, the neurodegenerative disease comprises one or more of Huntington's disease, Parkinson's disease, and Alzheimer's disease.

[0011] In some embodiments, the livestock animals include one or more of deer, goats, sheep, cattle, and / or pigs.

[0012] In some embodiments, the substance that inhibits the KCNK3 gene includes at least one of a substance that inhibits the activity of KCNK3, a substance that degrades KCNK3, and a substance that reduces the expression level of KCNK3.

[0013] In some embodiments, the substance that reduces the expression level of KCNK3 comprises at least one of (a1)-(a3): (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting KCNK3; (a2) a nucleic acid molecule expressing (a1); (a3) An expression cassette, vector, transgenic cell line, or microorganism comprising (a2).

[0014] In some embodiments, the substance that inhibits KCNK3 activity comprises at least one of (b1)-(b3): (b1) Antibodies that specifically bind to KCNK3; (b2) a ligand protein or polypeptide that specifically binds to KCNK3; (b3) Non-protein compounds that specifically bind to KCNK3.

[0015] In some embodiments, the siRNA has a nucleotide sequence as shown in SEQ ID NO: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0016] In some embodiments, the 3' end of the siRNA is further modified with 2-6 overhanging nucleotides consisting of dT, dA, dC, dG or U.

[0017] In some embodiments, the sgRNA performs gene knockout / knockdown based on CRISPR / Cas9, and the sgRNA targeting sequence has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0018] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 15-18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0019] In some embodiments, the substance that inhibits the KCNK3 gene includes a vector containing the sgRNA.

[0020] In some embodiments, the substance that inhibits the KCNK3 gene includes a CRISPR / Cas system for knocking out the KCNK3 gene, and the CRISPR / Cas system includes the sgRNA and the Cas protein.

[0021] In some embodiments, the cas protein includes one or more of Cas9, Cas12, Cas13, and Cas14.

[0022] The applications do not include diagnosis and treatment of diseases.

[0023] According to yet another aspect of the present disclosure, a method for preparing a cell in which KCNK3 gene expression is inhibited is provided.

[0024] In some embodiments, the method comprises the step of transfecting cells with the siRNA.

[0025] In some embodiments, the method comprises the step of transfecting a cell with a vector comprising a nucleic acid molecule encoding the sgRNA.

[0026] In some embodiments, the method comprises the step of transfecting a cell with a vector comprising a nucleic acid molecule encoding the sgRNA.

[0027] In some embodiments, cells in which KCNK3 gene expression is inhibited are prepared using gene editing technology, wherein the gene editing technology includes gene targeting technology, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology or homing endonuclease.

[0028] In some embodiments, the sgRNA targeting sequence in the CRISPR / Cas9 technology has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0029] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 15-18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0030] According to another aspect of the present disclosure, a cell in which the KCNK3 gene is inhibited is provided by the method provided by the present application.

[0031] In some embodiments, the cell is selected from a eukaryotic cell.

[0032] In some embodiments, the eukaryotic cell comprises a mammalian cell.

[0033] In some embodiments, the mammal is selected from the order Primates, Lagomorpha, Rodentia, Artiodactyla, etc.

[0034] In some embodiments, the mammal is selected from humans, monkeys, gorillas, rabbits, mice, rats, hamsters, deer, goats, sheep, cows, pigs, etc.

[0035] In some embodiments, the cells are selected from SVF cells, SK15 cells, CHO cells, CHOK1 cells, 293 cells, 3T6 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, etc.

[0036] According to another aspect of the present disclosure, a substance for inhibiting KCNK3 gene expression is provided, wherein the substance for inhibiting KCNK3 gene comprises siRNA and / or sgRNA targeting KCNK3 gene.

[0037] In some embodiments, the siRNA has a nucleotide sequence as shown in SEQ ID NO: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0038] In some embodiments, the 3' end of the siRNA is further modified with 2-6 overhanging nucleotides consisting of dT, dA, dC, dG or U.

[0039] In some embodiments, the sgRNA performs gene knockout / knockdown based on CRISPR / Cas9, and the sgRNA targeting sequence has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0040] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 15-18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

[0041] In some embodiments, the substance that inhibits the KCNK3 gene includes a CRISPR / Cas system for knocking out the KCNK3 gene, and the system includes the sgRNA and the Cas protein.

[0042] In some embodiments, the cas protein includes one or more of Cas9, Cas12, Cas13, and Cas14.

[0043] According to yet another aspect of the present disclosure, a nucleic acid molecule is provided, which encodes the siRNA.

[0044] According to yet another aspect of the present disclosure, a nucleic acid molecule is provided, which encodes the sgRNA, or encodes the CRISPR / Cas system.

[0045] According to yet another aspect of the present disclosure, a vector is provided, which contains the nucleic acid molecule.

[0046] According to another aspect of the present disclosure, a cell is provided, comprising the substance that inhibits the KCNK3 gene, the nucleic acid molecule and / or the vector.

[0047] According to another aspect of the present disclosure, a pharmaceutical composition is provided, comprising a therapeutically effective amount of the substance that inhibits the KCNK3 gene, and a pharmaceutically acceptable carrier.

[0048] In some embodiments, the pharmaceutical composition is used as a drug for regulating lipid metabolism or regulating ferroptosis, and / or preventing, alleviating and / or treating obesity and its complications or ferroptosis-related diseases.

[0049] According to another aspect of the present disclosure, a kit is provided, which includes the substance for inhibiting the KCNK3 gene.

[0050] In some embodiments, the kit is used to detect the KCNK3 gene.

[0051] In some embodiments, the kit is used to construct a model cell or animal model for lipid metabolism diseases or ferroptosis-related diseases.

[0052] According to another aspect of the present disclosure, provided is a method for preventing, alleviating and / or treating obesity and its complications or ferroptosis-related diseases, comprising administering a pharmaceutically effective amount of the substance that inhibits the KCNK3 gene or the pharmaceutical composition to a subject.

[0053] According to another aspect of the present disclosure, a method for breeding livestock animals is provided, characterized in that the method comprises administering an effective dose of the substance that inhibits the KCNK3 gene, the feed or the feed additive to the livestock animals.

[0054] Beneficial effects:

[0055] The present invention first discovered that the KCNK3 gene can inhibit cell ferroptosis, and also has the effect of promoting pig fat synthesis and inhibiting fat hydrolysis. siRNA or sgRNA designed for the KCNK3 gene and other substances that inhibit the expression of the KCNK3 gene can interfere with the expression of the KCNK3 gene, and have important application value in the regulation of pig fat deposition traits, breeding of low-fat and high-lean meat livestock, improving feed utilization, regulating lipid metabolism drugs or regulating ferroptosis, treating human obesity and its complications, and ferroptosis-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The expression level of KCNK3 in the back fat tissue of Duchangda pig and Wuzhishan pig at 1 month old is shown (n=3). DLY: Duchangda pig, WZS: Wuzhishan pig.

[0057] Figure 2 The expression levels of KCNK3 in different tissues of 1-month-old Wuzhishan pigs are shown (n=3). IAT: inguinal subcutaneous adipose tissue; BF: back adipose tissue; PAT: perirenal adipose tissue.

[0058] Figure 3 A bar graph showing the results of fluorescent quantitative PCR for si-KCNK3 knockdown.

[0059] Figure 4 A diagram showing the KCNK3 gene knockout pattern is shown.

[0060] Figure 5 White light images of wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pig SVF cells induced to differentiate into adipogenic cells on day 8 are shown (scale bar: 100 μm).

[0061] Figure 6 Detection of KCNK3 gene expression levels in wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pig SVF cells is shown.

[0062] Figure 7 The expression levels of adipose thermogenesis marker genes in SVF cells of wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pigs are shown.

[0063] Figure 8 The expression of de novo fatty acid synthesis genes in SVF cells with siRNA knockdown of KCNK3 expression is shown.

[0064] Fig. 9 Detection of KCNK3 gene levels in WT and overexpressing cells (OE) is shown.

[0065] Fig.10 White light images of WT and OE cells induced to differentiate into adipocytes for 8 days are shown (scale bar: 50 μm).

[0066] Fig.11 Shown are bar graphs detecting the expression levels of genes related to lipogenesis and thermogenesis in WT and OE cells.

[0067] Fig.12 Shown are electrophoretic images of the expression levels of genes related to fat synthesis and thermogenesis in WT and OE cells.

[0068] Fig.13 The results of PCA analysis of SVF cells of WT and KO are shown.

[0069] Fig.14 A volcano plot of differentially expressed genes in SVF cells of WT and KO is shown.

[0070] Fig.15 Bubble plots showing differential gene enrichment in SVF cells of WT and KO.

[0071] Fig.16 Heat maps of major gene expression in glutathione and fatty acid metabolism pathways are shown.

[0072] Fig.17 Shown are the expression levels of fatty acid synthesis-related genes in WT and KO cells.

[0073] Fig.18 Shown are the expression levels of genes related to ferroptosis promotion in WT and KO cells.

[0074] Fig.19 Shown are the expression levels of genes related to ferroptosis inhibition in WT and KO cells.

[0075] Fig. 20 The results of PCA analysis of WT and KO PK15 cells are shown.

[0076] Fig.21 Differential lipid volcano plots of WT and KO PK15 cells are shown.

[0077] Fig. 22 Heatmap showing differential lipid VIP enrichment in WT and KO PK15 cells.

[0078] Fig.23 The abundance results of different lipid subclasses in WT and KO PK15 cells are shown.

[0079] Fig.24 The results of the abundance of major lipid classes in WT and KO PK15 cells are shown.

[0080] Fig.25 The results of PUFA abundance in WT and KO PK15 cells are shown, PUFA: polyunsaturated fatty acids.

[0081] Fig.26 The fluorescence results of ROS detection in WT and KCNK3 knockout (KO) PK15 cells are shown (scale bar: 100 μm), where the left picture is the WT group cells and the right picture is the KO group cells.

[0082] Fig. 27 The flow cytometry results of ROS detection in WT and KCNK3 knockout (KO) PK15 cells are shown. The left figure shows the number of particles, where red indicates WT group cells and blue indicates KO group cells; the right figure is a bar graph of the average fluorescence density.

[0083] Fig.28 The expression levels of key ferroptosis genes in WT and KCNK3 knockout (KO) PK15 cells are shown.

[0084] Fig.29 The expression levels of genes related to lipid accumulation in WT and KCNK3 knockout (KO) PK15 cells are shown.

[0085] Fig.30 Shown are the expression levels of glutathione synthesis-related genes (GCLC, GCLM, and GSS) in WT and KCNK3 knockout (KO) PK15 cells.

[0086] Fig.31 Detection of glutathione levels in WT and KCNK3 knockout (KO) PK15 cells is shown; tGSH: total glutathione; GSH: reduced glutathione; GSSG: oxidized glutathione.

[0087] Fig.32 The effect of KCNK3 knockout on the mitochondrial morphology of PK15 cells is shown, and the scale bars from left to right are: 5 μm, 2 μm and 500 nm. DETAILED DESCRIPTION

[0088] The present disclosure uses a combined transcriptome and lipidome analysis and unexpectedly finds that KCNK3 can inhibit fat metabolism and promote ferroptosis through lipid peroxidation. The present disclosure combines siRNA interference technology and uses CRISPR / Cas9 technology to construct gene knockout and overexpression cell lines, and further proves that KCNK3 deficiency inhibits fatty acid synthesis and accumulation and promotes fat thermogenesis through cell-induced differentiation. Therefore, the results of the present disclosure support that the KCNK3 gene has important application value for the molecular regulation of pig fat traits, fat metabolism, and ferroptosis-related diseases.

[0089] definition Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0090] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0091] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0092] As used herein, the term "nucleic acid" refers to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked by phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.

[0093] As used herein, the term "fat metabolism" includes fat synthesis and / or hydrolysis metabolism. Specific metabolic processes illustratively include lipid digestion, lipid absorption, lipid transport, lipid storage, lipid catabolism and lipid biosynthesis.

[0094] As used herein, the term "inhibiting gene expression" refers to reducing or completely eliminating the expression of a gene or protein. "Inhibiting" expression refers to reducing by at least 10% compared to normal expression levels, such as reducing by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or more and including reducing by 100%. Inhibiting or reducing the expression of a gene or protein can result in partial or complete loss (inactivation) of its biological activity.

[0095] As used herein, the term "knockout" or "gene knockout" refers to a technical means or operation process for the purpose of gene deletion, including but not limited to introducing DNA fragments that can undergo homologous recombination with the gene sequence to be knocked out into cells through infection, transfection, or transformation, introducing transposon systems, or introducing gene editing tools to change the genome sequence; or changing the genome sequence through irradiation or chemical drugs, etc. For example, the CRISPR / Cas9 nuclease system.

[0096] As used herein, the term "knockdown" or "gene knockdown" refers to a technical means or operation process for the purpose of inhibiting gene expression, including but not limited to introducing nucleic acids or functional proteins into cells by infection, transfection, or transformation, etc., to downregulate the transcription or translation level of the target gene without changing the genome sequence; or downregulating the transcription or translation level of the target gene by chemical drugs, such as RNA interference.

[0097] In the present application, the term "CRISPR / Cas system" generally refers to a group of molecules comprising RNA-guided nucleases or other effector molecules and gRNA molecules, which can guide and achieve the modification of nucleic acids at target sequences by RNA-guided nucleases or other effector molecules, such as causing target sequence degradation. In certain embodiments, the CRISPR system comprises gRNA and Cas proteins, for example, Cas9 proteins. Systems comprising Cas9 or its functional mutants are referred to as "Cas9 systems" or "CRISPR / Cas9 systems" in the present application. In certain embodiments, gRNA molecules and Cas molecules can be compounded to form a ribonucleoprotein (RNP) complex. In the present application, the term "Cas protein" generally refers to the enzyme responsible for shearing DNA in the CRISPR / Cas system. Enzymes from type I, II, and III CRISPR / Cas systems may be included. For example, Cas9, Cas12, Cas13, and Cas14.

[0098] As used herein, the term "single guide RNA (sgRNA)" or "guide RNA (gRNA)" refers to a sequence that contains crRNA and tracrRNA. sgRNA is designed based on a specific target site on the target gene sequence, and its sequence is sufficient to cooperate with Cas9 or Cpf1 endonucleases to guide the occurrence of double-stranded DNA breaks at the target site mediated by the endonuclease. There are generally two forms of sgRNA: double-stranded form and single-stranded form. The double-stranded form is composed of crRNA and tracrRNA, which need to be annealed to form a complex, which can be achieved by chemically synthesizing crRNA and tracrRNA. Single-stranded form: crRNA and tracrRNA are transformed into a single RNA, which does not require annealing and still has the function of cutting double-stranded DNA. sgRNA can be achieved by plasmid, in vitro transcription, or chemical synthesis. Conventional sgRNA is delivered to cells in the form of plasmids or viruses.

[0099] As used herein, the term "CRISPR / Cas9 system" refers to a genetic engineering tool that includes a guide RNA (gRNA) sequence with a Cas9 binding site and a targeting sequence specific to the region to be modified. Cas9 binds to gRNA to form a ribonucleoprotein that binds to and cuts the target region. CRISPR / Cas9 is a gene knockout achieved at the genomic DNA level that can cause permanent loss of the gene, resulting in complete loss or reduction of the function of the target protein. Cas9 protein generally refers to an enzyme from a bacterial type II CRISPR / Cas system that is responsible for shearing DNA. Cas9 can include wild-type proteins and functional mutants thereof.

[0100] In addition to the CRISPR / Cas 9 platform, which is a type II CRISPR / Cas system, there are additional systems including type I CRISPR / Cas systems, type III CRISPR / Cas systems, and type V CRISPR / Cas systems. A variety of CRISPR / Cas9 systems have been disclosed, including, for example, Streptococcus pyogenes Cas9 (SpCas9), Streptococcus thermophilus Cas9 (StCas9), Campylobacter jejuni Cas9 (CjCas9), and Neisseria cinerea Cas9 (NcCas9). Other optional systems of the Cas system include Francisella novicida Cpfl (FnCpfl), Acidaminococcus sp. Cpfl (AsCpfl) and Lachnospiraceae bacterium ND2006Cpfl (LbCpfl) systems. Any of the above-mentioned CRISPR systems can be used in the method for producing the cell line of the present invention.

[0101] As used herein, the term "RNA interference" or "RNAi" refers to a sequence-specific process by which a target molecule (e.g., a target gene, protein, or RNA) is downregulated via downregulation of expression. Without being bound to a specific mechanism, as currently understood by those skilled in the art, RNAi involves the degradation of RNA molecules, such as mRNA molecules within a cell, by the catalysis of an enzymatic RNA-induced silencing complex (RISC). RNAi (RNA interference) is a reduction in gene expression levels at the post-transcriptional level, does not change the sequence of the genome, does not affect the long-term stability of the genome, and the resulting reduction in gene expression levels is reversible.

[0102] As used herein, the term "small interfering RNA (siRNA)" refers to a nucleic acid molecule that is a double-stranded RNA that is complementary to a portion of an mRNA and capable of base pairing. siRNA works by specifically directing enzymes in host cells to cut the target RNA. By virtue of the specificity of the siRNA sequence and its homology to the RNA target, siRNA can cause cutting of the target RNA chain, thereby inactivating the target RNA molecule. siRNA is about 19-25 nucleotides in length. Such siRNA can have an overhang (e.g., a 3'-overhang of 1, 2 or 3 nucleotides (or nucleotide analogs)). Such siRNA can mediate RNA interference.

[0103] As used in this article, the term "O2PLS analysis" is the full name of Two-Way Orthogonal PLS, which is a two-way orthogonal partial least squares method. It is suitable for data mining in complex scenarios and is a type of unsupervised modeling. The O2PLS method can be used to mine the correlation features between different dimensions of multi-omics data.

[0104] As used herein, the term "overhang" refers to a terminal non-base paired nucleotide at either end of either strand of a double-stranded nucleic acid molecule. That is, the single-stranded region extending beyond the 3' end and / or the 5' end of the duplex is called an overhang. In some embodiments, the overhang nucleotides composed of modified deoxyribonucleotides at the ends of the siRNA are used to protect the siRNA from enzymatic hydrolysis.

[0105] As used herein, the term "sequence identity" refers to the "percentage of sequence identity" or "percentage of sequence identity" between two polynucleotides, i.e., the number of identical matching positions shared by the sequences within the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide, the gap present in the target sequence is not counted. Similarly, since the target sequence nucleotides are counted, but the nucleotides from the reference sequence are not counted, the gap present in the reference sequence is not counted. At least 85% sequence identity includes a continuous segment having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity over the entire length of the sequence.

[0106] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The comparison of sequences and the determination of the sequence identity percentage between the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite available from the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, a part of the EMBOSS suite of Needle, Stretcher, Water or Matcher, bioinformatics programs, and can also be obtained from www.ebi.ac.uk / Tools / psa.

[0107] The term "pharmaceutically acceptable carrier" used in the present disclosure refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), that is, a substance with a reasonable benefit / risk ratio. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween), wetting agents (such as sodium lauryl sulfate), buffers, chelating agents, thickeners, pH regulators, transdermal enhancers, colorants, flavoring agents, stabilizers, antioxidants, preservatives, antibacterial agents, delivery agents (such as liposomes, nanoparticles, etc.), pyrogen-free water, etc.

[0108] As used herein, the term "pharmaceutical composition" can be in any dosage form, including, for example, but not limited to tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, injections, sprays, aerosols, powder sprays, lotions, liniments, ointments, plasters, pastes, patches, eye drops, nasal drops, suppositories, etc.

[0109] The pharmaceutical composition of the present disclosure can be administered in a pharmaceutically effective amount. "Pharmaceutically effective amount" means that the amount used is sufficient to treat the disease, with a reasonable benefit / risk ratio applicable to any medical treatment. The effective dosage level of the composition can be determined based on the type of subject, the severity of the disease, the age and gender of the subject, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration, the excretion rate, the treatment time, the drug used in combination with the composition, and other known factors in the medical field. The composition of the present disclosure can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms.

[0110] As used herein, the term "effective dose" refers to a dose sufficient to improve the performance of breeding animals without causing any significant adverse side effects.

[0111] As used herein, the term "treating" a disease in a subject or "treating" a subject having or suspected of having a disease refers to administering a drug therapy, such as administering one or more pharmaceutical agents, to a subject, thereby reducing or preventing worsening of at least one symptom of the disease. Thus, in some embodiments, "treating" refers, inter alia, to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies, or reducing resistance to alternative therapies, or a combination thereof.

[0112] As used herein, the terms "preventing" and "preventing" are art-recognized and well-known in the art when used in connection with a condition such as a local recurrence, and include administration of a composition that reduces the occurrence or delays the onset of symptoms of a medical condition in a subject relative to a subject not receiving the composition.

[0113] As used herein, the term "subject" refers to any animal, mammal or human. The subject suffers from, may suffer from or is suspected of suffering from one or more diseases. In some embodiments, the subject is a human, monkey, gorilla, rabbit, mouse, rat, hamster, deer, goat, sheep, cattle, pig, etc.

[0114] The drugs described in the present invention may exist in a variety of forms. Such forms include, but are not limited to, liquid, semi-solid and solid dosage forms, wherein liquids include, but are not limited to dispersions or suspensions; semi-solids and solids include, but are not limited to tablets, pills, powders, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic application. In order to make the objects, technical solutions and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. The actual scope of protection of the present invention is set forth in the claims. In the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are not mentioned in terms of their sources, and are all commercially available on the market or obtained by conventional methods known to those skilled in the art. Example Example 1. Tissue expression profile of KCNK3 gene

[0115] (1) Three healthy male Duroc-Changda hybrid pigs (DLY) and Wuzhishan pigs (WZS) aged 28 days were selected and their back subcutaneous adipose tissue was collected after slaughter. In addition, inguinal subcutaneous adipose tissue (IAT), back fat (BF), perirenal adipose tissue (PAT), heart, liver, spleen, lung, kidney, longissimus dorsi, leg muscle, jejunum and ileum tissues were collected from Wuzhishan pigs, quickly frozen in liquid nitrogen and stored at -80 ℃.

[0116] (2) Total RNA was extracted from tissues according to the instructions of RNAiso Plus (9109) produced by Takara Company. Reverse transcription was performed to obtain cDNA according to the operating instructions of Takara Company's reverse transcription kit (RR092S) and qPCR quantification reagent (RR42LR). qPCR was then performed to detect the expression level of KCNK3 gene in different pig breeds and different tissues of Wuzhishan pigs. The primer sequences used for qPCR are shown in Table 1. 18S RNA was used as a control.

[0117] like Figure 1 and 2 As shown, KCNK3 is highly expressed in fatty pigs (Wuzhishan pigs, WZS) ( Figure 1 ), the expression level in Wuzhishan pig adipose tissue is much higher than that in other tissues ( Figure 2 ).

[0118] Example 2. siRNA screening for knockdown of KCNK3 gene (KD)

[0119] (1) Design and screen the mRNA sequence of KCNK3 gene (Genebank ID: 100737895), and obtain 5 pairs of siRNA sequences Si-KCNK3-1, Si-KCNK3-2, Si-KCNK3-3, Si-KCNK3-4, Si-KCNK3-5. The 3' end of each siRNA carries two deoxythymidine nucleotides (dT), and the negative control sequence Si-NC (synthesized by Beijing Tianyi Huiyuan Company), as shown in Table 2; (2) The fresh inguinal subcutaneous white adipose tissue of Wuzhishan pigs was cut, washed with DPBS containing 5% penicillin / streptomycin, and minced. It was digested in Dulbecco Hanks balanced salt solution containing 2 mg / ml type I collagenase at 37°C for 60 min. The tissue suspension was filtered with a 70μm cell filter and centrifuged at 1500r / min for 10 min. The cell pellet was resuspended in DMEM high-glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S). The cells were kept in a 37°C incubator containing 5% CO2. The obtained cells are porcine vascular stromal (SVF) cells.

[0120] (3) The stromal vascular fraction (SVF) cells obtained in step (2) were plated into a 12-well cell culture plate, with 1×10 cells per well. 5 When the cells grow to 70-80% confluence, aspirate the medium, add 875 μL DMEM complete medium to each well, and place in a cell culture incubator; (4) Prepare interference reagents according to the number of cells to be treated in the cell culture plate: Solution A: add 62.5 μL Opti-MEM™ medium and 2.5 μL siRNA or negative control to each well; Solution B: add 62.5 μL OPTI and 2.5 μL Lipofectamine™ 3000 transfection reagent (ThermoFisher Scientific) to each well. Mix Solution A and Solution B separately and let stand at room temperature for 5 min. (5) Add solution B to solution A, mix thoroughly, and incubate at room temperature for 15 min. (6) Slowly add the above mixed solution to the cell culture plate at a rate of 125 μL per well, gently mix the culture medium and interfering reagent in the cell culture plate, and place it in a cell culture incubator; (7) 72 hours after transfection, the cell RNA was collected and reverse transcription and fluorescence quantitative PCR were performed according to the method of Example 1.

[0121] The results are as follows Figure 3As shown, the relative expression level of KCNK3 after Si-KCNK3-1 treatment was the lowest, and Si-KCNK3-1 was selected for RNAi experiments in subsequent experiments.

[0122] Example 3. Using Cas9 / gRNA technology to obtain KNCK3 knockout (KO) Wuzhishan pig SVF cells to detect the effects of KCNK3 deficiency on fat synthesis and thermogenesis

[0123] (1) The Cas9 / gRNA vector was designed using the online tool CRISPR Design Tool (https: / / crispor.gi.ucsc.edu). Two gRNA sequences with the highest scores were selected near ATG. The sgRNA1 targeting sequence was GGCGAAGCGCCACTGCACGC (5'-3', SEQ ID NO: 13) and the sgRNA2 targeting sequence was CGGAGATGATCGAGCGGCAG (5'-3', SEQ ID NO: 14). SEQ ID NOs: 15 to 18 were designed based on these two sequences as shown in Table 3. After annealing into double strands, they were ligated to the pCRISPR-sg6 vector backbone (Xu C et al., piggyBac mediates efficient invivo CRISPR library screening for tumorigenesis in mice. Proc Natl Acad Sci USA. 2017 Jan 24;114(4):722-727). The gene knockout vector was obtained and cloned with Lonza The 2b cell nuclear transfection instrument (program: A-024) co-transfected two gRNA plasmids (2 μg each) and 1 μg Cas9 expression vector (pM3-Cas9, reference: Lu H et al. A HIT-trapping strategy for rapid generation of reversible and conditional allelesusing a universal donor. Genome Res. 2021 May;31(5):900-909.) into the porcine vascular stromal cells (SVF) obtained in step (1). 24-48 hours after transfection, positive cells were selected with 2 μg / mL puromycin to obtain porcine SVF cells with KCNK3 gene knockout.

[0124] Figure 4 The knockout pattern of the KCNK3 gene is exemplified.

[0125]

[0126] (2) According to step (2) of Example 2, vascular stromal cells (SVF) of Wuzhishan pigs were cultured. After the cells were fully grown, contact inhibition was performed for 2 days to start inducing differentiation: 20 mM HEPES (pH 7.4), 5 μg / mL insulin, 17 μM pantothenate, 33 μM biotin, 1 μM dexamethasone, 0.25 mM isobutylmethylxanthine (IBMX) and 50 mM rosiglitazone were added to the basal culture medium (DMEM high glucose medium + 1% PS, 10% FBS). After 5 days, half of the medium was replaced with maturation medium. Maturation medium is a differentiation medium without IBMX and rosiglitazone. On the 8th day of induction of differentiation, the results were observed as follows: Figure 5 As shown, the fat droplets of KCNK3 knockout SVF cells were significantly reduced, proving that KCNK3 knockout would inhibit the adipogenic differentiation of SVF cells. Example 4. Effect of KCNK3 gene knockdown or knockout on the expression of genes related to adipogenic differentiation of SVF cells

[0127] qPCR detection of relevant genes was performed according to the method in step (2) of Example 1. The primers used are shown in Table 4. The results are as follows Figures 6-8 As shown, knockout of the KCNK3 gene (KO) using Cas9 / gRNA technology can inhibit KCNK3 expression ( Figure 6 ), promoting thermogenesis genes PGC1A and CD137 Express( Figure 7 ), knocking down the KCNK3 gene (KD) using Si-KCNK3-1 can reduce the expression of de novo fatty acid synthesis genes FABP 4. CEBPA , SREBP1C , ACC , FASN , ACLY and SCD The expression ( Figure 8 ).

[0128] Example 5. Effect of overexpression of KCNK3 on fat synthesis and thermogenesis in Wuzhishan pig SVF cells

[0129] (1) The cDNA of Wuzhishan pig SVF cells prepared in step (2) of Example 2 was used as a template to amplify the CDS region of the KCNK3 gene. The primer sequences used are shown in Table 5. The CDS region and polyA tail of the KCNK3 gene were connected to the pPB-EF1α-Flag vector backbone (Addgene, #212646) that had been digested using a seamless cloning kit to obtain a KCNK3 overexpression vector (pPB-EF1α-KCNK3-Flag) with a Flag tag. The KCNK3 overexpression vector was transfected into the Wuzhishan pig SVF cells using a Lonza 2b cell nuclear transfection instrument. After 24-48 hours of transfection, positive cell clones were screened with 2 μg / mL of puromycin to obtain pig preadipocytes overexpressing the KCNK3 gene.

[0130]

[0131] (2) Referring to step (2) of Example 1, the expression of KCNK3 gene was detected.

[0132] The expression level of KCNK3 protein was detected by Western blot, including the following steps: (2.1) Total cell protein extraction was performed according to the instructions of the Bioengineering Cell Protein Extraction Kit.

[0133] (2.1.1) Aspirate the supernatant from the cells in the 12-well plate, wash twice with pre-cooled DPBS, add 200 μL of pre-cooled DPBS to each well, scrape the cells with a cell scraper, place them in a 1.5 mL centrifuge tube, centrifuge at 500 g, 4°C, for 5 min, collect the cell pellet and place it on ice; (2.1.2) Add 5 μl of phosphatase inhibitor, 1 μl of protease inhibitor and 10 μl of PMSF to each 1 mL of pre-cooled Lysis Buffer and mix well. Pre-cool on ice until use; (2.1.3) Add 100 μl of Lysis Buffer to each centrifuge tube containing cells, place on a 4°C shaker, and shake at medium speed (100-150 rpm) for 30 min-1 h. (2.1.4) Centrifuge at 14,000 rpm, 4°C for 15 min, and take the supernatant as the whole protein extract. Store the whole protein extract at -70°C for protein quantification and other protein-related experiments, avoiding repeated freezing and thawing; (2.2) Protein concentration determination: Determine the cell protein concentration according to the instructions of the Bio-Tech BCA protein concentration detection kit; (2.3) Incubate the membrane with the primary antibody, wash off the excess primary antibody with PBST, wash three times for 10 min each time, and then hybridize with the secondary antibody: dilute the secondary antibody with PBST working solution according to the instructions, add it to the incubation box containing the membrane, incubate at room temperature on a horizontal shaker for 40-60 min, and after development, use the Tanon-5200 fully automatic chemiluminescence imaging system to expose the protein bands and save the results.

[0134] The results verified that KCNK3 gene overexpression was successful at both mRNA and protein levels ( Fig. 9 ).

[0135] (3) After the cells were fully grown, the cells were contact inhibited for 2 days and then induced to differentiate, referring to step (2) in Example 3. After 8 days of induction of differentiation, RNA and protein samples were collected, and the expression levels of fat synthesis and hydrolysis genes were detected at the mRNA and protein levels. The results showed that KCNK3 overexpression promoted the adipogenic differentiation of SVF cells ( Fig.10 ), promoting the expression of adipogenic differentiation gene PPARG and fatty acid de novo synthesis gene ACC1, and inhibiting the expression of fat hydrolysis and heat production genes CPT1A, PRDM16 and PGC-1α genes ( Figure 11-12 ).

[0136] Antibody information used: anti-ACC1 antibody (dilution ratio 1:5000, Proteintech), anti-PGC-1α antibody (dilution ratio 1:2000, Abcam), anti-α-TUBULIN antibody (dilution ratio 1:2000, Proteintech), FLAG (dilution ratio 1:2000, Abmart); goat anti-rabbit secondary antibody (dilution ratio 1:5000, Proteintech), rabbit anti-goat secondary antibody (dilution ratio 1:5000, Proteintech), goat anti-mouse secondary antibody (dilution ratio 1:5000, Proteintech). Example 6. Transcriptome differential analysis of Wuzhishan pig SVF cells

[0137] In this example, the WT and KO SVF cells obtained in Example 3 were sequenced with 3 replicates in each group. 932 up-regulated genes and 1036 down-regulated genes were screened in the KO group ( Figure 13-14 ), enrichment analysis of differentially expressed genes revealed that they were mainly enriched in biological processes such as fat hydrolysis regulation, Wnt signaling pathway, cAMP signaling pathway, MAPK signaling pathway, and P13K-Akt signaling pathway. In addition, they were also enriched in metabolic pathways related to ferroptosis, such as p53 signaling pathway, HIF-1 signaling pathway, glutathione metabolism, and ferroptosis ( Fig.15 ). The gene heat map results showed that key genes in glutathione metabolism and fatty acid metabolism were significantly downregulated ( Fig.16). RNA-seq analysis showed that the de novo fatty acid synthesis genes in the KO group, such as CEBPA , FABP 4. ACC , FASN and SCD Significantly downregulated ( Fig.17 ); genes that promote ferroptosis, such as PRNP, FTL, HMOX1, TP 53 and CP Significantly upregulated ( Fig.18 ); genes that inhibit ferroptosis, such as GPX 4 、ATF 4 、SLC 39 A 14 、STEP 3 、SLC7A 11 and SLC 40 A 1 was significantly downregulated ( Fig.19 ).

[0138] The results showed that KCNK3 knockout inhibited SVF cell adipogenesis and promoted lipolysis and ferroptosis. Example 7. Results of lipidome analysis of PK15 cells

[0139] The PK15 cell line preserved in the laboratory was revived and cultured in a 37°C incubator containing 5% CO2 using DMEM high-glucose medium (containing 1% P / S and 10% FBS). Referring to the method in Example 3, KO PK15 cells were obtained. In this example, PK15 cells of WT and KO groups were selected, with 6 replicates in each group. The samples were analyzed by LC-MS / MS using the Thermo Fisher Scientific ultra-high performance liquid chromatography tandem Fourier transform mass spectrometry UHPLC-Q Exactive HF-X system. A total of 642 differential lipids were screened, of which 412 were up-regulated lipids in the KO group and 230 were down-regulated lipids ( Figure 20-21 ). The results of VIP heat map and lipid abundance map showed that the downregulated lipids in the KO group were mainly dihexosyl-ceramides (Hex2Cer) and monogalactosyl diglyceride (MGDG), and total TG (triglycerides) increased significantly. In addition to the decrease in the abundance of sphingolipids (SP), fatty acids (FA), sterol lipids (ST), glycerides (GL), and glycerophospholipids (GP) all increased significantly ( Figure 22-24 In addition, the abundance of polyunsaturated fatty acids (PUFA) increased significantly ( Fig.25 ).

[0140] The above results showed that after KCNK3 knockout, the abundance of lipids TG and PUFA that promote ferroptosis increased significantly, indicating that the sensitivity of cells to ferroptosis increased after KCNK3 knockout.

[0141] The results of transcriptome and lipidome analysis showed that the KCNK3 gene mainly affects lipid metabolism and ferroptosis-related biological processes. Example 8. Validation of KCNK3 knockout promoting ferroptosis in PK15 cells

[0142] (1) Cellular ROS detection was performed according to the instructions of the Bio-Tech Reactive Oxygen Species Detection Kit (S0033S). One day in advance, PK15 cells in the WT and KO groups were cultured at 5×10 5 Cells / well were plated in a 12-well plate. Before detection, the cell culture medium was discarded, and the cells were washed three times with DPBS preheated at 37°C. DCFH-DA was diluted with serum-free culture medium at a ratio of 1:1000 to a final concentration of 10 μm / L. 500 μL of the diluted ROS indicator DCFH-DA was added to each well. Incubated in a cell culture incubator at 37°C for 20 minutes. The cells were washed three times with serum-free cell culture medium for fluorescence photography and flow cytometry analysis ( Figure 26-27 The results showed that the level of cellular ROS increased significantly after KCNK3 knockout.

[0143] (2) Referring to the method of step (2) of Example 1, cells were collected to extract RNA, and the expression levels of genes related to ferroptosis and de novo fatty acid synthesis were detected by qPCR. The primer sequences used are shown in Table 4 (part) and Table 6. The results showed that KCNK3 knockout cells had an inhibitory effect on ferroptosis ( GPX4, NRF2 and TF ), fatty acid de novo synthesis genes ( SREBP1C, ACC, FASN and SCD ) and glutathione synthesis-related genes ( GCLC , GCLM and GSS ) expression levels were decreased, ferroptosis-promoting factor COX7A 1 was significantly upregulated ( Figure 28-30 ).

[0144]

[0145] (3) According to the instructions of the Bio-Tech GSH and GSSG Detection Kit (S0053), the level of glutathione in cells was detected and corrected by the protein concentration of the cells. The results showed that the levels of total glutathione (tGSH), reduced glutathione (GSH) and oxidized glutathione (GSSG) in cells were significantly decreased after KCNK3 knockout ( Fig.31 ).

[0146] (4) Transmission electron microscopy analysis was performed on WT and KO cells. The WT and KO cells grown in a 10 cm dish were washed three times with DPBS preheated at 37 °C, and 1 mL of 2.5% glutaraldehyde was added. The cells were incubated at room temperature in the dark for 30 min, and then gently scraped with a cell scraper and placed in a 1.5 ml centrifuge tube. The cells were centrifuged at 3000 rpm for 5 min, and resuspended with 1 mL of new 2.5% glutaraldehyde. The cells were placed at room temperature for 30 min, stored at 4 °C in the dark, and sent to the company for testing within 1 week. The results showed that the cell membrane of KCNK3 knockout cells was broken, and the mitochondria were deformed, swollen, and broken ( Fig.32 ).

[0147] Figure 26-32 The results showed that KCNK3 knockout reduced the production of glutathione through lipid peroxidation, thereby promoting cell ferroptosis.

[0148] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principle of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. The technical solution of the present invention is not limited to the above specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of substances that inhibit KCNK3 gene expression in the preparation of reagents for regulating fat metabolism or regulating ferroptosis, The Genebank ID of the KCNK3 gene is 100737895; The substance inhibiting the KCNK3 gene includes siRNA and sgRNA targeting KCNK3; The siRNA has the nucleotide sequence shown in SEQ ID NO: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto; or The sgRNA performs gene knockout / knockdown based on CRISPR / Cas9, and the sgRNA targeting sequence has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto.

2. The use according to claim 1, characterized in that: The reagent is used for one or more of the following purposes: (1) Inhibit KCNK3 protein expression; (2) inhibiting adipogenic differentiation and / or fatty acid synthesis, and / or promoting lipolysis; (3) increase the abundance of polyunsaturated fatty acids; (4) upregulation of total triglycerides, fatty acyl, sterol lipids, glycerides, and / or glycerophospholipids; and / or downregulation of hexosylceramide, monogalactosyl diacylglycerol, and / or sphingolipids; (5) Reduce fat deposition; and / or promote lipid peroxidation; (6) inhibiting glutathione metabolism and / or reducing total intracellular glutathione production, including reduced glutathione and oxidized glutathione; (7) Increase cellular ROS levels; (8) preparing drugs for regulating lipid metabolism or regulating ferroptosis, and / or preparing drugs for preventing, alleviating and / or treating obesity and its complications; (9) preparing drugs for regulating ferroptosis, and / or preparing drugs for preventing, alleviating and / or treating diseases related to ferroptosis; (10) Preparation of model cells for lipid metabolism diseases or ferroptosis-related diseases; (11) Preparation of animal models of lipid metabolism diseases or ferroptosis-related diseases; (12) For the breeding or cultivation of livestock animals.

3. The use according to claim 2, characterized in that: The ferroptosis-related diseases include one or more of neurodegenerative diseases, tissue ischemia-reperfusion injury, pulmonary fibrosis, heart disease, osteoarthritis and diabetes.

4. The use according to claim 3, characterized in that: The neurodegenerative disease includes one or more of Huntington's disease, Parkinson's disease and Alzheimer's disease.

5. The use according to claim 1, characterized in that: The substance that inhibits the KCNK3 gene also includes at least one of the following: a nucleic acid molecule expressing the siRNA or sgRNA targeting KCNK3; an expression cassette, a vector, a transgenic cell line, or a microorganism containing the siRNA or sgRNA targeting KCNK3.

6. The use according to claim 1, characterized in that: The substance that inhibits the KCNK3 gene is a CRISPR / Cas system, and the system includes the sgRNA and Cas9 protein.

7. A method for preparing cells in which KCNK3 gene expression is suppressed.

8. The method according to claim 7, characterized in that The method comprises the step of transfecting cells with siRNA, wherein the siRNA has the nucleotide sequence shown in SEQ ID NO: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity thereto; or Cells in which KCNK3 gene expression is inhibited are prepared using gene editing technology, wherein the gene editing technology includes gene targeting technology, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology or homing endonuclease; in the CRISPR / Cas9 technology, the sgRNA targeting sequence has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary to it or has 85% sequence identity thereto.

9. A cell in which the KCNK3 gene is suppressed, obtained by the method according to claim 7 or 8.

Images