DNA hydrogel and application thereof in copper ion detection

Abstract

The DNA hydrogel is prepared by adopting a hairpin structure of an H1 chain, a hairpin structure of an H2 chain and a trigger probe to perform a hybridization chain reaction, the DNA hydrogel is applied to copper ion detection, specifically, a to-be-detected sample is added into the DNA hydrogel, after standing, liquid in the mixture is sucked by a capillary tube, and when the volume of the liquid in the capillary tube is obviously higher than that of the added to-be-detected sample, it is indicated that the to-be-detected sample contains copper ions; the preparation method is simple, the detection method is visual, field operation is convenient, detection can be achieved without complex instruments, and the kit is low in cost, rapid, simple, convenient, economical, high in sensitivity and good in specificity; a powerful guarantee is provided for research and development of a heavy metal ion sensing technology.

Description

Technical Field

[0001] The invention belongs to the field of heavy metal ion detection, and particularly relates to a DNA-based hydrogel and its application in rapid visual detection of copper ions. Background Art

[0002] Heavy metal pollution is one of the major environmental problems facing the world, and it poses serious threats to the ecological environment and human health. Copper ions, as essential trace elements for the human body, play an important role in both physiological and pathological processes. When the concentration is too high, it will disrupt the balance between cells and lead to a series of neurodegenerative diseases, such as Alzheimer's disease, Wilson's disease and Parkinson's disease. Long-term intake of excessive copper ions can also cause a variety of diseases, including gastrointestinal bleeding, hematuria and hemolysis. At present, most methods for detecting harmful heavy metals rely on expensive instruments and equipment, making it difficult to achieve rapid on-site detection. Therefore, there is an urgent need to develop an accurate, portable and sensitive method for detecting heavy metals.

[0003] At present, heavy metal detection mainly relies on high-cost and complex instrumental analysis, such as atomic absorption spectroscopy (AAS), inductively coupled plasma mass spectrometry (ICP-MS), flame atomic absorption spectrophotometry (FAAS), X-ray fluorescence spectroscopy (XFS), etc. These technologies have shown extremely high sensitivity, accuracy and detection limit in heavy metal detection, and can effectively identify and quantify ultra-trace heavy metals in various samples. However, these methods have significant limitations. First, the equipment is expensive and the maintenance and operation costs are high; second, the sample pretreatment process is cumbersome and usually requires complex chemical pretreatment or separation steps, which not only increases the detection time, but also has high technical requirements for operators; in addition, these instruments are usually bulky and difficult to carry, and cannot meet the needs of rapid, on-site real-time detection. Therefore, in practical applications, especially in situations where large-scale monitoring or emergency situations are required, they are not ideal. Therefore, developing a simple, economical and efficient heavy metal detection method has become the focus of current research to make up for the shortcomings of existing technologies and meet the needs of fast and convenient on-site detection.

[0004] In recent years, functional nucleic acids have become ideal recognition elements in the field of sensing. Biosensors based on functional nucleic acids have achieved high sensitivity and high specificity detection of heavy metal ions through changes in electrochemical, fluorescence and colorimetric signals. Among them, hybridization chain reaction (HCR) is an isothermal nucleic acid amplification technology. The hydrogel-based clamped hybridization chain reaction (C-HCR) technology developed based on the principle of HCR can synthesize DNA hydrogels. Hydrogel is a three-dimensional network structure material with high water content and excellent biocompatibility, so it is often used in biomedicine and sensing fields. In the C-HCR technology, hydrogels detect heavy metal ions through visualized sol-gel transitions, such as in miRNAs and Hg 2+ It has been successfully applied in the detection of heavy metals. By adding a trigger chain, the hydrogel undergoes a sol-gel phase transition, and its morphological change can be used for high-sensitivity detection of heavy metal ions. Since the hydrogel can show significant morphological changes during the detection process, it is easy to observe with the naked eye or simple equipment, so it has great potential in the rapid detection of heavy metals and other harmful substances in food. This not only improves the detection sensitivity and accuracy, but also simplifies the operation process and reduces the detection cost. It is suitable for on-site and large-scale food safety monitoring, and helps to timely detect and prevent heavy metal contamination in food. Summary of the invention

[0005] The invention provides a DNA hydrogel and application of the DNA hydrogel in copper ion detection. The invention realizes efficient recognition and high-sensitivity rapid detection of copper ions.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows: 1. Preparation of the hairpin structure of the H1 chain or the hairpin structure of the H2 chain The H1 chain or H2 chain was washed with 1×TAE-Mg 2+ After the buffer solution was dissolved, it was denatured at 95°C for 10 min, and then rapidly cooled to -4°C and kept for 1 h to obtain the hairpin structure of the H1 chain or the hairpin structure of the H2 chain; The nucleotide sequence of the H1 chain is GATCGCGATCGTCACGAGTCACTATrAGGAAGATGGCGA AACGAGACTTTCGCCATCTTCACC; The nucleotide sequence of the H2 chain is TTTCGCCATCTTCACCAGGAAATAGTGACTCGTGACGGTGAAG ATGGCGAAAGTCTCG;

[0007] 2. Preparation of DNA hydrogel The hairpin structure of the H1 chain at a concentration of 320-640 μmol / L, the hairpin structure of the H2 chain at a concentration of 320-640 μmol / L, and the trigger probe at a concentration of 42-100 μmol / L were mixed and incubated at 37 °C for 12 h for hybridization chain reaction to obtain a DNA hydrogel, wherein the hairpin structure of the H1 chain and the hairpin structure of the H2 chain were added in equal amounts; The nucleotide sequence of the trigger probe was TTTCGCCATCTTCCTATAGTGACTCGTGAC; 3. Application of DNA hydrogel in copper ion detection Add the sample to be tested to the DNA hydrogel, let it stand for 50-70 minutes, and then use a capillary to absorb the liquid in the mixture. When the volume of the liquid in the capillary is significantly higher than the volume of the added sample to be tested, it indicates that the sample to be tested contains copper ions, and the copper ions specifically cut the hybridization chain reaction products, destroying the hydrogel network structure to form a sol liquid.

[0008] Compared with the prior art, the present invention has the following beneficial effects: The invention designs H1 chain and H2 chain based on the substrate chain and enzyme chain of copper ion DNAzyme, uses H1 chain or H2 chain to prepare hairpin structure, synthesizes responsive DNA hydrogel through hybridization chain reaction (HCR), and applies the DNA hydrogel of the invention to the detection of copper ions. Experimental results show that DNA hydrogel has strong recognition ability and selectivity for copper ions and can realize specific detection of copper ions. By adopting the capillary detection method, the volume change of the sample to be detected can be intuitively seen, thereby judging whether the sample to be detected contains copper ions. The method of the invention is simple to prepare, the detection method is intuitive and convenient for on-site operation, the detection can be realized without complex instruments, and the cost is low, which provides a strong guarantee for the research and development of fast, simple and economical heavy metal ion sensing technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is a schematic diagram of the DNA hydrogel morphology structure of Example 1; Figure 2 This is the fluorescence scanning result after the HCR product is cleaved by copper ions; Figure 3 This is a schematic diagram of the DNA hydrogel morphology structure of Example 2; Figure 4 This is a schematic diagram of the DNA hydrogel morphology structure of Example 3; Figure 5 This is a graph showing the specificity detection results of the present invention; Figure 6Figure 1 is a sensitivity test result diagram of the present invention, wherein Figure a is a fluorescence detection diagram, and Figure b is a standard curve between fluorescence intensity and copper ion concentration; Figure 7 The specificity diagram of the visualized detection system of DNA hydrogel combined with capillary in Example 6, wherein Figure a is a bar chart and Figure b is the capillary observation result; Figure 8 This is a sensitivity diagram of the visualized detection system of DNA hydrogel combined with capillary in Example 6; Fig. 9 This is a schematic diagram of the results of detecting copper ions in actual samples using the DNA hydrogel combined with a capillary in Example 7. DETAILED DESCRIPTION

[0010] The present invention is further explained by examples below, but these examples do not limit the scope of protection of the present invention. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified; Example 1: Preparation of DNA hydrogel 1. Consult the literature and 2+ The DNAzyme sequence was used to design the H1 chain, H2 chain, and trigger probe, which were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence is as follows: H1 chain: GATCGCGATCGTCACGAGTCACTATrAGGAAGATGGCGAAACGAGACTTTCGCCATCTTCACC (SEQID NO: 1); H2 chain: TTTCGCCATCTTCACCAGGAAATAGTGACTCGGTGACGGTGAAGATGGCGAAAGTCTCG (SEQ ID NO: 2); Trigger probe: TTTCGCCATCTTCCTATAGTGACTCGTGAC (SEQ ID NO: 3); 2. Preparation of DNA hydrogel The synthesized H1 chain, H2 chain, and trigger probe were attached to the wall of the centrifuge tube in the form of a very light dry film. They were centrifuged at 1000 r / min for 5 min to prevent them from dispersing. According to the DNA synthesis report, 1×TAE-Mg 2+ The H1 chain and the H2 chain were dissolved in a buffer solution to prepare an H1 chain solution and an H2 chain solution with a concentration of 420 μmol / L; the H1 chain solution and the H2 chain solution were denatured at 95°C for 10 min, rapidly cooled to 4°C and maintained for 1 h to prepare a hairpin structure of the H1 chain or a hairpin structure of the H2 chain with a concentration of 420 μmol / L.

[0011] At a volume ratio of 5:5:1, 55 μL of 420 μmol / L H1 chain hairpin structure, 55 μL of 420 μmol / L H2 chain hairpin structure, and 42 μmol / L trigger probe (1×TAE-Mg 2+ Buffer solution) 11 μL was mixed and incubated at 37°C for 12 h for hybridization chain reaction to obtain DNA hydrogel. The water stains on the filter paper were used to determine whether the hydrogel was formed. The DNA gel and water were placed on the filter paper respectively. Figure 1 It can be seen that DNA hydrogel will not leave water stains on the filter paper, but water will form water stains on the filter paper.

[0012] 3. Experimental verification that DNA hydrogel (HCR product) can be specifically cleaved by copper ions (1) According to Cu 2+ The enzyme chain and substrate chain of DNAzyme are designed into H3 chain and H4 chain; Substrate strand: GTCACGAGTCACTATrAGGAAGATGGCGAAA; Enzyme chain (I): TTTCGCCATCTTCCTATAGTGACTCGTGACTTTCGCCATCTTCACCAGGAAATAGTGACTCGTGAC; H3 chain: GTCACGAGTCACTATrAGGAAGATGGCGAAACGAGACTTTCGCCATCTTCACC; H4 chain: FAM-TTTCGCCATCTTCACCAGGAAATAGTGACTCGGTGACGGTGAAGATGGCGAAAGTCTCG-BHQ1; The synthesized H3 chain, H4 and enzyme chain are attached to the wall of the centrifuge tube in the form of a very light dry film. Centrifuge at 1000 r / min for 5 minutes to prevent them from dispersing. 2+ The buffer solution dissolves the H3 chain, the H4 chain and the enzyme chain to prepare a 300 μmol / L H3 chain solution and an H4 chain solution and a 100 μmol / L enzyme chain solution; Mix 400 μL of 300 μmol / L H3 chain solution, 400 μL of H4 chain solution, and 80 μL of 100 μmol / L enzyme chain solution, denature at 95°C for 10 min, and perform HCR reaction. After the reaction is completed, slowly cool to room temperature and stand for 2 h to obtain HCR product; 40 μL of 100 μmol / L copper ion solution was added to the HCR product. At the same time, 40 μL of distilled water was added to the HCR product as a negative control, and the HCR product without any substance was set as a blank control. After standing for 60 minutes, the three samples were subjected to fluorescence scanning at a wavelength of 521 nm to detect the fluorescence signal intensity. The results are as follows: Figure 2 As shown in the figure, it can be seen that the fluorescence intensity of the experimental group and the negative control group with added copper ions is higher than that of the blank control group, and when copper ions are present, the HCR product is cleaved, the fluorescence energy resonance transfer disappears, and the fluorescent group is exposed to the solution to emit a fluorescent signal, resulting in the fluorescence intensity of the experimental group being higher than that of the negative control group, indicating that the HCR product can be specifically cleaved by copper ions.

[0013] Example 2: Preparation of DNA hydrogel The synthesized H1 chain or H2 chain is attached to the wall of the centrifuge tube in the form of a very light dry film. Centrifuge at 1000r / min for 5min to prevent it from dispersing. According to the DNA synthesis report, use 1×TAE-Mg 2+ The buffer solution is prepared to obtain a H1 chain solution and an H2 chain solution with a concentration of 320 μmol / L, and a trigger probe with a concentration of 50 μmol / L; the H1 chain solution and the H2 chain solution are denatured at 95°C for 10 min, and then quickly cooled to -4°C and maintained for 1 h to obtain a hairpin structure of the H1 chain or a hairpin structure of the H2 chain with a concentration of 320 μmol / L; In a volume ratio of 5:5:1, 55 μL of 320 μmol / L H1 chain hairpin structure, 55 μL of 320 μmol / L H2 chain hairpin structure, and 11 μL of 50 μmol / L trigger probe were mixed and incubated at 37°C for 12 h for hybridization chain reaction to obtain DNA hydrogel. The results are shown in Figure 3 It can be seen from the figure that the DNA hydrogel does not produce water stains on the filter paper, indicating that the method of this embodiment can form a hydrogel.

[0014] Example 3: Preparation of DNA hydrogel The synthesized H1 chain or H2 chain is attached to the wall of the centrifuge tube in the form of a very light dry film. Centrifuge at 1000 r / min for 5 min to prevent it from dispersing. 2+ The H1 chain solution and the H2 chain solution with a concentration of 640 μmol / L and the trigger probe with a concentration of 100 μmol / L were prepared by dissolving in a buffer solution; the H1 chain solution and the H2 chain solution were denatured at 95°C for 10 min, rapidly cooled to -4°C and maintained for 1 h to prepare the hairpin structure of the H1 chain or the hairpin structure of the H2 chain with a concentration of 640 μmol / L.

[0015] At a volume ratio of 5:5:1, 55 μL of the hairpin structure of the H1 chain at a concentration of 640 μmol / L, 55 μL of the hairpin structure of the H2 chain at a concentration of 640 μmol / L, and 11 μL of the trigger probe at 100 μmol / L were mixed and incubated at 37°C for 12 h for hybridization chain reaction to obtain DNA hydrogel. The results are shown in Figure 4 It can be seen from the figure that the DNA hydrogel does not produce water stains on the filter paper, indicating that the method of this embodiment can form a hydrogel.

[0016] Example 4: Specificity detection experiment of the detection system In order to verify the detection system of the present invention for Cu 2+ To improve the specificity, 400 μL of 300 μmol / L H3 chain solution, 400 μL of 300 μmol / L H4 chain solution, and 80 μL of 100 μmol / L enzyme chain were mixed and denatured at 95°C for 10 min to perform HCR reaction. After the reaction, the system was slowly cooled to room temperature and allowed to stand for 2 hours to obtain HCR product. Cu 2+ at a concentration of 10 μM was added to the HCR product. 2+ 40 μL of the solution was allowed to stand for 60 min and then detected using an ELISA reader and analyzed by the fluorescence signal value; At the same time, other heavy metal ions (Pb at a concentration of 1 mM) were determined under the same conditions. 2+ 、Zn 2+ , Ca 2+ , Fe 3+ 、Ni 2+ Cr 2+ , K + 、Cd 2+ , Mn 2+ ), the specificity of the mixture to the detection system; The mixed solution is a liquid in which the above 10 kinds of metal ions are mixed at the above concentrations.

[0017] Results Figure 5 From the figure, it can be seen that when Cu 2+ When the concentration is 10μM and the concentration of other metal ions is 1mM, adding Cu 2+ The fluorescence intensity of the experimental group was significantly higher than that of the experimental group with other metal ions added. In the case of mixed detection, the fluorescence intensity of the mixed liquid group was also significantly higher than that of the experimental group with other metal ions added. The experimental results show that the detection system of the present invention has specificity and anti-interference ability for copper ions, so the constructed detection system can specifically detect target heavy metal ions.

[0018] Example 5: Sensitivity test experiment of the detection system In order to verify the sensitivity of the developed detection system, Cu 2+The solution was prepared into solutions of different concentrations, including 0, 10 nM, 30 nM, 50 nM, 70 nM, 90 nM, 100 nM, 200 nM, 300 nM, 400 nM, 600 nM, and 800 nM; the preparation of the HCR product in this example was the same as that in Example 4; Adding the above concentration of Cu to the HCR product 2+ The solution was allowed to stand for 60 min, and then the fluorescence intensity was detected at a wavelength of 521 nm using an enzyme reader. By measuring the fluorescence intensity of a series of samples with known copper ion concentrations, a standard curve between fluorescence intensity and copper ion concentration was drawn to obtain a linear equation.

[0019] Results Figure 6 (a) In the concentration range of 0-800 nM, the fluorescence intensity of the reaction product increases with the increase of Cu 2+ The concentration of Cu 2+ When the concentration is 10-90 nM, △F shows a linear relationship with the concentration Figure 6 (b) For Cu 2+ The linear equation of the detection system is Y=1795.37185X+3902.98294 (X is in nM), and the linear correlation coefficient is R 2 =0.99651, and the detection limit is 0.31 nM. The detection system of the present invention has high sensitivity and wide detection limit.

[0020] Example 6: Visual detection of DNA hydrogel binding capillaries 1. Prepare DNA hydrogel according to the method of step 2 of Example 1; 2. Add 10 μM Cu to the DNA hydrogel 2+ 10 μL of solution was added, and other metal ion solutions of the same concentration (Pb 2+ 、Zn 2+ , Ca 2+ , Fe 3+ 、Ni 2+ Cr 2+ , K + 、Cd 2+ , Mn 2+ ) 10μL, and set up a blank control without adding metal solution. After standing for 60 minutes, use a capillary to absorb the reacted liquid, place the capillary above the scale to read, and keep two decimal places. Figure 7 As can be seen from the figure, in the experimental group after adding copper ion solution, the increase in solution in the capillary is more than twice that of the experimental group adding other metal ions, indicating that copper ions have a specific cutting effect on the HCR product in the DNA hydrogel, destroying the network structure of the DNA hydrogel and forming a sol liquid.

[0021] 3. To verify the detection sensitivity of the DNA hydrogel and capillary combined detection system, copper ion solutions with concentrations of 0.1, 0.9, 1, 3, 5, 7, 9, 10, 30, 50, and 70 μM were added to the DNA hydrogel. After standing for 60 minutes, the reacted liquid was aspirated with a capillary and the capillary was placed above the scale for reading, with two decimal places. A standard curve was drawn based on the liquid flow distance in the capillary and the copper ion concentration, and the linear regression equation Y=1.2831X+0.33669 (R 2 =0.99658), the results are shown in Figure 8 , it can be seen from the figure that Cu 2+ The concentration showed a good linear relationship between 0.1-0.9 μM. The results showed that the concentration of copper ions in the sample to be tested can be determined by the flow distance of the liquid in the capillary, thereby achieving the purpose of quantitative detection.

[0022] Example 7: Using DNA hydrogel to detect actual samples 1. Prepare DNA hydrogel according to the method of step 2 of Example 1; 2. Select green tea and wine as test samples, grind the tea leaves, sieve to remove the stems, weigh 0.05g, dissolve it in 1mL ultrapure water, and extract it at 600 r / min for 30 min in a 90 ℃ constant temperature mixer, cool to room temperature, centrifuge at 10000 r / min for 15 min, and filter with a 0.22μM filter to obtain 1mL of extract; the original solution of wine was used as the test sample; the pH of the green tea extract and wine was adjusted to 7.4-8.0.

[0023] 3. Detection of DNA hydrogel and capillary binding Add 20 μL of tea or wine to the prepared DNA hydrogel, and set up a blank control with 20 μL of distilled water. Shake well, let stand at room temperature for 60 minutes, and use a capillary to absorb the liquid after the reaction. If the tea or wine contains copper ions, it will cut the DNA hydrogel. Finally, use a capillary to absorb the amount of DNA hydrogel collapse, place the capillary above the scale to read, and keep two decimal places. To ensure the accuracy and reliability of the constructed detection system, repeat three times. Capillary results are shown in Fig. 9 It can be clearly seen that the flow distance of tea soup and wine is significantly higher than that of the blank control group, indicating that metal copper ions were detected in tea soup and wine.

Claims

1. A DNA hydrogel, characterized in that: DNA hydrogel is prepared by hybridization chain reaction using the hairpin structure of H1 chain, the hairpin structure of H2 chain and trigger probe; The nucleotide sequence of the H1 chain is GATCGCGATCGTCACGAGTCACTATrAGGAAGATGGCGA AACGAGACTTTCGCCATCTTCACC; The nucleotide sequence of the H2 chain is TTTCGCCATCTTCACCAGGAAATAGTGACTCGTGACGGTGAAG ATGGCGAAAGTCTCG; The nucleotide sequence of the trigger probe is TTTCGCCATCTTCCTATAGTGACTCGTGAC.

2. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain or the hairpin structure of the H2 chain is obtained by mixing the H1 chain or the H2 chain with 1×TAE-Mg 2+ After the buffer solution is dissolved, it is denatured at 95°C for 10 min, rapidly cooled to -4°C and kept for 1 h.

3. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain at a concentration of 320-640 μmol / L, the hairpin structure of the H2 chain at a concentration of 320-640 μmol / L, and the trigger probe at a concentration of 42-100 μmol / L were mixed and incubated at 37°C for 12 h for hybridization chain reaction to obtain DNA hydrogel, in which the added amounts of the hairpin structure of the H1 chain and the hairpin structure of the H2 chain were equal.

4. Use of the DNA hydrogel according to any one of claims 1 to 3 in copper ion detection.

5. The use according to claim 4, characterized in that: The sample to be tested is added to the DNA hydrogel, and after standing, the liquid in the mixture is absorbed by a capillary. When the volume of the liquid in the capillary is significantly higher than the volume of the added sample to be tested, it indicates that the sample to be tested contains copper ions.

Images