Moso bamboo PeTEM1 gene as well as expression protein and application thereof

Abstract

The invention discloses a moso bamboo PeTEM1 gene as well as an expression protein and application thereof, and relates to the technical field of plant genetic engineering. The nucleotide sequence of the phyllostachys pubescens PeTEM1 gene disclosed by the invention is as shown in SEQ ID NO.1, and the amino acid sequence of the expression protein of the phyllostachys pubescens PeTEM1 gene is as shown in SEQ ID NO.2. The method comprises the following steps: constructing an overexpression vector of a phyllostachys edulis PeTEM1 gene; the constructed overexpression vector of the phyllostachys edulis PeTEM1 gene is transformed into arabidopsis thaliana; and cultivating and screening to obtain transgenic arabidopsis thaliana with delayed flowering time and / or increased rosette leaf number. Results of the embodiment of the invention show that a strain with overexpression of the PeTEM1 gene shows an obvious late flowering phenotype, the number of rosette leaves is increased, and the flowering time is delayed; and the expression quantities of downstream regulation genes FT, SOC1 and GA3OX1 are obviously reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically relates to a bamboo PeTEM1 gene and an expression protein and application thereof. Background Art

[0002] Phyllostachys edulis belongs to the subfamily Bambusoideae of the Poaceae family. It is widely distributed in southwest my country and has the advantages of strong adaptability and rapid growth. The flowering of bamboo plants is very different from that of other plants. It usually takes decades to hundreds of years to bloom. For example, it takes about 60 years for bamboo to bloom. After bamboo plants bloom, bamboo forests die, causing great losses in production. At present, the flowering mechanism of bamboo is still unclear, so exploring the flowering regulatory genes and their regulatory mechanisms of bamboo has important practical significance for variety improvement.

[0003] It is crucial for plants to flower and bear fruit at the right time for the continuation of the species. Plants have evolved different molecular mechanisms to regulate their flowering and fruiting at the appropriate time of the year. TEM1 is a transcriptional repressor that participates in multiple flowering pathways. Under long-day conditions, CO activates the expression of FT, and TEM1 and TEM2 inhibit the expression of FT. Under short-day conditions, gibberellins accumulate and induce SOC1 and LFY to regulate flowering. TEM1 and TEM2 can regulate gibberellins accumulation by inhibiting GA3OX1 and GA3OX2, thereby affecting flowering. Although the function of the TEM1 gene has been reported in model plants, the function of the bamboo TEM1 gene is still unclear, especially its role in regulating flowering. Summary of the invention

[0004] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a PeTEM1 gene of moso bamboo. Another technical problem to be solved by the present invention is to provide an expression protein of the PeTEM1 gene of moso bamboo. Another technical problem to be solved by the present invention is to provide an application of the PeTEM1 gene of moso bamboo in regulating the flowering time of plants, for regulating the flowering time of plants. Another technical problem to be solved by the present invention is to provide an application of the PeTEM1 gene of moso bamboo in regulating the number of rosette leaves of plants, for regulating the number of rosette leaves of plants. Another technical problem to be solved by the present invention is to provide an application of the PeTEM1 gene of moso bamboo in regulating the expression amount of downstream genes.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0006] A PeTEM1 gene of moso bamboo, whose nucleotide sequence is shown as SEQ ID NO.1.

[0007] The amino acid sequence of the protein encoded by the PeTEM1 gene of Phyllostachys pubescens is shown in SEQ ID NO.2.

[0008] Vectors and recombinant bacteria containing the PeTEM1 gene of bamboo.

[0009] Application of the bamboo PeTEM1 gene in regulating the flowering time of plants.

[0010] The method of regulating the flowering time of plants is to delay the flowering time of plants, including:

[0011] 1) Constructing an overexpression vector of the bamboo PeTEM1 gene;

[0012] 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana;

[0013] 3) Cultivate, screen and obtain transgenic Arabidopsis strains with delayed flowering time.

[0014] Application of PeTEM1 gene in regulating the number of rosette leaves in plants.

[0015] The method of regulating the number of rosette leaves of a plant is to promote an increase in the number of rosette leaves, and comprises:

[0016] 1) Constructing an overexpression vector of the bamboo PeTEM1 gene;

[0017] 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana;

[0018] 3) Cultivate, screen and obtain transgenic Arabidopsis thaliana with increased number of rosette leaves.

[0019] Application of bamboo PeTEM1 gene in regulating the expression of downstream genes of PeTEM1 gene.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The nucleotide sequence of the bamboo PeTEM1 gene disclosed in the present invention is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2. The present invention constructs an overexpression vector of the bamboo PeTEM1 gene; transforms the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana; cultivates, screens and obtains transgenic Arabidopsis thaliana with delayed flowering time and / or increased number of rosette leaves. The results of the examples of the present application show that the strains overexpressing the PeTEM1 gene show obvious late flowering phenotypes, increased number of rosette leaves, and delayed flowering time; and the expression levels of downstream regulatory genes FT, SOC1 and GA3OX1 are significantly downregulated. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1This is the electrophoresis diagram of PCR amplification of PeTEM1 gene of Moso bamboo (lane 1 is DNA Marker, lane 2 is the PCR product of PeTEM1);

[0023] Figure 2 is the vector structure diagram of the expression vector pCAMBIA1302;

[0024] Figure 3 This is the subcellular localization map of PeTEM1 in bamboo (scale bar is 10 μm);

[0025] Figure 4 This is a diagram of the PCR identification results of transgenic Arabidopsis thaliana (Control is the control plant, #1, 2, 3, 5, 6, 7, 8 are the overexpression lines pCAMBIA1302-PeTEM1-1, 2, 3, 5, 6, 7, 8 respectively);

[0026] Figure 5 The flowering phenotype diagram (A), rosette leaf number diagram (B) and flowering time diagram (C) of transgenic Arabidopsis thaliana (Control is the control plant, #1 is the overexpression line pCAMBIA1302-PeTEM1-1, and #2 is the overexpression line pCAMBIA1302-PeTEM1-2);

[0027] Figure 6 Quantitative analysis of FT, SOC1 and GA3OX1 genes in transgenic Arabidopsis and control plants (Control is the control plant, #1 is the overexpression line pCAMBIA1302-PeTEM1-1, #2 is the overexpression line pCAMBIA1302-PeTEM1-2). DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art. Molecular biology experimental methods not specifically described can be carried out with reference to the methods listed in the book "Molecular Cloning Experiment Guide" (3rd Edition) by J. Sambrook or conventional methods in the art, or according to the kit and product instructions.

[0029] The plant materials used in this application are bamboo leaves, which were collected in Guangxi Zhuang Autonomous Region.

[0030] Example 1

[0031] 1. PeTEM1 gene cloning

[0032] Take bamboo leaves, extract total RNA with a plant total RNA extraction kit (purchased from TIANGEN), and reverse transcribe to obtain cDNA with a reverse transcription kit (purchased from Vazyme). Log in to the bamboo genome database http: / / gigadb.org / dataset / view / id / 100498, and use Primer 5 software to design amplification primers with restriction sites based on the PeTEM1 gene sequence. PCR amplification was performed using bamboo leaf cDNA as a template to obtain the PeTEM1 gene. The primer sequence is as follows:

[0033] Forward Primer:

[0034] 5'-GAGAACACGGGGGACTCTAGAATGGACAGCACGAGCTGCCTCGTG GA-3',

[0035] Reverse Primer:

[0036] 5'-GCCCTTGCTCACCATGGATCCCTCTACACTAGCGTATAGTGTCAGCT CT-3'.

[0037] The PCR reaction system was: ddH2O 18 μL, 2×Super Pfx MasterMix (purchased from Vazyme) 25 μL, cDNA 2 μL, dNTP Mix 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and 2 μL of upstream and downstream primers respectively.

[0038] The PCR reaction program was as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing at 59°C for 15 seconds, extension at 72°C for 1 minute and 30 seconds, 35 cycles; and 72°C for 5 minutes.

[0039] The amplified product was subjected to 1% agarose gel electrophoresis and a single PCR band was detected ( Figure 1 After gel excision, the amplified fragments were recovered using a gel recovery kit (purchased from Beijing Kangwei Century Biotechnology Co., Ltd.), and the fragments were sent to a biological company (Shanghai Biotechnology Co., Ltd.) for sequencing. The sequencing results showed that the nucleotide sequence of the PeTEM1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.2

[0040] 2. Construction of PeTEM1 gene overexpression vector

[0041] The pCAMBIA1302 vector (vector information is as follows) was double-digested with Xba I and Bam HI. Figure 2 shown).

[0042] The double enzyme digestion reaction system was: 22 μL pCAMBIA1302 plasmid, 5 μL 10× Buffer, 2 μL Bam HI, 2 μL Xba I (purchased from Thermo Fisher Scientific), and 19 μL deionized water. Mix well on ice.

[0043] The double enzyme digestion reaction procedure is: digest at 37℃ for 4 hours and then cut the gel for recovery.

[0044] The double-enzyme-digested linearized vector fragment and the above-mentioned gene amplification fragment were connected at 37° C. for 30 minutes using homologous recombinase (purchased from Vazyme).

[0045] The ligation reaction system was: 3 μL PeTEM1 amplified fragment, 1 μL linearized vector, 2 μL 5×CEⅡBuffer, 1 μL ExpressⅡ, and 3 μL deionized water.

[0046] After the ligation reaction is completed, it is immediately placed on ice. After cooling, 10 μL of the ligation product is transferred into Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biological Company) by heat shock method. Select the monoclonal colony and shake it with LB liquid medium containing kanamycin (50 mg / L). After PCR detection and sequencing verification, the recombinant plasmid pCAMBIA1302-PeTEM1 is obtained. The recombinant vector is transferred into Agrobacterium GV3101 cells (purchased from Shanghai Weidi Biological Company) by freeze-thaw method. The transformation product is spread on LB solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. Cultivate at 28℃ for 36 hours, select the monoclonal colony and shake it with LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. After the PCR detection is correct, the bacteria are retained. The transformation methods of Escherichia coli and Agrobacterium are carried out according to the instructions.

[0047] 3. Subcellular localization of PeTEM1

[0048] The stored Agrobacterium strain containing the recombinant plasmid pCAMBIA1302-PeTEM1 was inoculated into 50 ml LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampicin) and cultured at 28°C, 200 rpm, for 24 hours until the bacterial solution OD reached 600 After the OD was 0.75, centrifuge at 4000 rpm for 15 minutes to collect the bacterial precipitate. Resuspend the precipitate in buffer (9 mL of ddH2O, 500 μL of 200 mM MES, 500 μL of 200 mM MgCl2, 30 μL of acetosyringone) until the OD was 0. 600 The concentration of the bacterial strain was 0.6, and the cells were placed in the dark for 5 hours. According to the tobacco transient expression technique, the bacterial solution was injected into tobacco leaves and the fluorescence was observed using a confocal fluorescence microscope.

[0049] The results are as follows Figure 3 As shown, PeTEM1 is localized in the cell nucleus, indicating that PeTEM1 is a nuclear localized protein.

[0050] Example 2

[0051] 1. Overexpression of PeTEM1 gene in Arabidopsis

[0052] The Agrobacterium strain containing the recombinant plasmid pCAMBIA1302-PeTEM1 was inoculated into 200ml LB liquid medium containing 50mg / L kanamycin and 50mg / L rifampicin at a volume ratio of 1:50, and cultured at 28°C and 200rpm for 22 hours; centrifuged at 5000rpm for 12 minutes to collect the bacterial precipitate; the precipitate was violently resuspended with an equal volume of transformation solution (sucrose 5g, surfactant 20μL, ddH2O100mL); the Arabidopsis inflorescence with the opened flowers and siliques removed was immersed in the resuspension for 8 minutes; after dark culture for one day, it was transferred to a climate chamber for normal culture. The seeds received after infection were sown on MS solid medium containing hygromycin. The leaves of the positive seedlings with true leaves were selected to extract total RNA and synthesize cDNA in the same manner as in Example 1. The quantitative primers (forward primer qPeTEM1-S: GAGCTACGTCCTCACCAAGGG, reverse primer qPeTEM1-A: GTCCACGCCGAAGAGCCT) were designed using the PeTEM1 gene sequence, and the PeTEM1 expression was detected by PCR using the gene quantitative primers.

[0053] The results are as follows Figure 4 As shown, the target fragment was not detected in the control plants, but was detected in all seven positive seedlings, indicating that PeTEM1 had been successfully transferred into Arabidopsis. Two transgenic lines (#1 and #2) with brighter target bands were selected, and self-pollination was continued to be harvested, and quantitative detection was performed using T3 seedlings.

[0054] 2. Statistics and quantitative analysis of transgenic plant phenotypes

[0055] T3 generation Arabidopsis plants of #1 and #2 lines were planted in a climate chamber under long-day conditions (16 hours of daylight and 8 hours of darkness). Twenty-four plants of each line were transplanted, and the number of rosette leaves and flowering time were counted.

[0056] The results are as follows Figure 5 As shown, compared with the control plants, the number of rosette leaves in the PeTEM1 overexpressing plants was significantly increased, and the flowering time was significantly delayed, showing an obvious late flowering phenotype.

[0057] T3 generation Arabidopsis positive seedlings were selected to extract total RNA and synthesize cDNA, the method was the same as Example 1. AtActin gene was used as an internal reference gene. AtFT, AtSOC1 and AtGA3OX1 quantitative primers were designed, and their expression in transgenic plants was detected by quantitative PCR.

[0058] qAtActin-S: 5'-TTGACAATTGATGCAAACAATGACG-3'

[0059] qAtActin-A: 5'-CCATTGCTTAATTCCACGGACAAAC-3'

[0060] qAtFT-S: 5'-AGTCCTAGCAACCCTCACCTCC-3'

[0061] qAtFT-A: 5'-CCTGCCAAGCTGTCGAAACA-3'

[0062] qAtSOC1-S: 5'-ATCGAGTCAGCACCAAACCG-3'

[0063] qAtSOC1-A: 5'-TTCCTATGCCTTCTCCCAAGAG-3'

[0064] qAtGA3OX1-S: 5'-ACAAGTGGACCCCTAAAGACGA-3'

[0065] qAtGA3OX1-A: 5'-TTGGACAGGTAGCCCGAAGA-3'

[0066] Quantitative PCR reaction system: 5 μL qPCR Master Mix (purchased from TOROIVD), 1 μL cDNA, 0.4 μL forward primer, 0.4 μL reverse primer, 3.2 μL deionized water.

[0067] The quantitative PCR reaction program was: 95°C for 1 min; 95°C for 10 s, 60°C for 30 s, and 40 cycles.

[0068] The results are as follows Figure 6 As shown in the figure, compared with the control plants, the expression levels of AtGA3OX1, AtSOC1 and AtFT were significantly downregulated in the PeTEM1 overexpressing plants. The results showed that PeTEM1 delayed plant flowering by inhibiting the expression of GA3OX1, SOC1 and FT.

[0069] The above description is only illustrative rather than restrictive of the present invention. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all will fall within the scope of protection of the present invention.

Claims

1. A PeTEM1 gene of bamboo, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The protein encoded by the bamboo PeTEM1 gene according to claim 1, whose amino acid sequence is shown in SEQ ID NO.

2.

3. A vector and recombinant bacteria containing the bamboo PeTEM1 gene according to claim 1.

4. Use of the bamboo PeTEM1 gene according to claim 1 in regulating the flowering time of plants.

5. The use according to claim 4, characterized in that: The regulating the flowering time of plants is to delay the flowering time of plants.

6. The use according to claim 5, characterized in that: include: 1) Constructing an overexpression vector of the bamboo PeTEM1 gene; 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana; 3) Cultivate, screen and obtain transgenic Arabidopsis strains with delayed flowering time.

7. Use of the bamboo PeTEM1 gene according to claim 1 in regulating the number of rosette leaves of a plant.

8. The use according to claim 7, characterized in that: The regulating the number of rosette leaves of the plant is to promote the increase of the number of rosette leaves.

9. The use according to claim 8, characterized in that: include: 1) Constructing an overexpression vector of the bamboo PeTEM1 gene; 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana; 3) Cultivate, screen and obtain transgenic Arabidopsis thaliana with increased number of rosette leaves.

10. Use of the bamboo PeTEM1 gene according to claim 1 in regulating the expression of genes downstream of the PeTEM1 gene.

Images