Glutamate decarboxylase multi-site combined mutant and application thereof

Abstract

The invention discloses a glutamate decarboxylase multi-site combined mutant and application thereof, and relates to the technical field of enzyme engineering and gene engineering. Amino acid residue sites needing to be mutated are determined on the basis of amino acid sites near key amino acids of a coenzyme 5 '-phosphopyridoxal binding pocket, and experimental verification is performed through a site-directed mutagenesis technology in combination with a high performance liquid chromatography screening method. Compared with a chemical synthesis method, the compound is synthesized by utilizing glutamic acid decarboxylase through biological catalysis, the synthesis condition is mild, the operation is simple, and separation and extraction are easy. According to the method, the screening probability of mutant amino acid sites can be effectively improved, the experiment efficiency and feasibility are improved, and the mutant enzyme of which the enzyme activity is obviously superior to that of the parent enzyme is obtained through screening.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering and gene engineering, and in particular to a glutamate decarboxylase multi-site combination mutant and application thereof. Background Art

[0002] Enzymes, as biocatalysts, are gradually showing their irreplaceable importance in the fields of synthetic biology and organic synthesis. With the continuous advancement of science and technology, the application scope of enzymes is also expanding. Their unique catalytic ability and high stereoselectivity make enzymes a research hotspot in many fields such as drug synthesis, materials science and green chemistry. Among many enzymes, pyridoxal-5-phosphate (PLP)-dependent enzymes have attracted much attention due to their unique catalytic mechanism and versatility.

[0003] PLP, as the active form of vitamin B6, is widely present in various organisms and is an important participant in many key metabolic processes. PLP-dependent enzymes can catalyze a series of complex biochemical reactions through covalent binding to PLP at their active sites. These reactions include but are not limited to transamination, decarboxylation, racemization, and elimination or substitution of β- or γ-carbons. This versatility mainly stems from the fact that after PLP binds to the substrate, it can act as an electrophilic catalyst to stabilize different types of carbon ion reaction intermediates, thereby guiding the reaction in a specific direction.

[0004] In the field of synthetic biology, the versatility of PLP-dependent enzymes provides researchers with a rich tool library. By precisely regulating the active site and coenzyme binding pocket of the enzyme, researchers can achieve fine control over substrate selectivity and catalytic efficiency. This ability makes PLP-dependent enzymes have great potential in constructing complex biosynthetic pathways, optimizing metabolic flows, and producing high value-added compounds.

[0005] In organic synthesis, PLP-dependent enzymes also show their unique advantages. Traditional chemical synthesis methods often have problems such as cumbersome steps, low yields, and serious environmental pollution. The use of PLP-dependent enzymes for catalytic synthesis can effectively overcome these problems. Enzyme-catalyzed reactions have high stereoselectivity and regioselectivity, and can achieve precise synthesis of target compounds. In addition, enzyme-catalyzed reactions are usually carried out under mild conditions, such as normal temperature and pressure, aqueous solution environment, etc., which makes the reaction process safer and more environmentally friendly.

[0006] It is particularly worth mentioning that achieving "multiple uses of one enzyme" through different catalytic effects of one enzyme on a single substrate is one of the current research hotspots in the field of enzyme engineering. This strategy can not only improve the utilization efficiency of the enzyme, but also simplify the synthesis steps and reduce production costs. For example, by modifying the PLP-dependent enzyme through protein engineering, it can be endowed with new catalytic properties, enabling it to perform reactions other than the original reaction. The realization of this "molecular switch effect" provides new ideas for the diversified application of enzymes.

[0007] Among PLP-dependent enzymes, glutamate decarboxylase (GAD) is a typical example. GAD is mainly responsible for catalyzing the decarboxylation reaction of glutamate to produce γ-aminobutyric acid (GABA). However, by modifying GAD through protein engineering technology, it can show the ability to perform other types of catalytic reactions on glutamate, such as transamination or β-elimination. The key to this modification is to finely regulate the amino acid residues near the binding pocket of the coenzyme PLP in the enzyme molecule, and to change the spatial conformation and charge distribution of the enzyme molecule by introducing point mutations, deleting or inserting specific amino acids, thereby affecting its recognition and catalytic efficiency of the substrate, providing a new way for the biocatalytic synthesis of related compounds. Summary of the invention

[0008] Based on the deficiencies in the prior art, the present invention provides a glutamate decarboxylase multi-site combination mutant and its application in the preparation of succinamic acid, aiming to screen out a glutamate decarboxylase mutant that is conducive to the production of by-products. The present invention studies and changes the amino acid residues near the coenzyme binding pocket, and the applicant performs engineering modification on glutamate decarboxylase GAD so that it can exhibit two different catalytic properties to form a "molecular switch effect". Glutamate decarboxylase is also applied to the production of succinamic acid.

[0009] The invention is based on comparing the protein structure and amino acid sequence of glutamate decarboxylase to find mutation sites and transform the glutamate decarboxylase into an enzyme with oxidation function.

[0010] The present invention compares the pocket sizes formed by different mutation sites near the coenzyme binding pocket, and selects amino acid sites with greater steric hindrance as preferred mutation sites.

[0011] The mutation sites obtained above were characterized, and five beneficial mutants were screened and obtained: Y165S (indicating that the tyrosine at position 165 of the wild-type glutamate decarboxylase was mutated to serine, and the same applies to the others), V167F, C168M, F304Y, and Y308F.

[0012] By combining mutations at five sites 165, 167, 168, 304, and 308, the mutation sites of the glutamate decarboxylase multi-site combined mutant are any one of the following: (1) Y165S / C168M / F304Y / Y308F; (2) Y165S / V167F / C168M / F304Y / Y308F; (3) C168M / F304Y / Y308F; (4) V167F / C168M / F304Y / Y308F.

[0013] The mutants of the above-mentioned combined mutations were characterized to obtain a combined mutant with significantly improved by-product catalytic activity, which is a mutant of the Y165S / C168M / F304Y / Y308F quadruple mutation, that is, a mutant in which the tyrosine at position 165 of the wild-type glutamate decarboxylase is mutated to serine, the cysteine ​​at position 168 is mutated to methionine, the phenylalanine at position 304 is mutated to tyrosine, and the tyrosine at position 308 is mutated to phenylalanine, and the mutant exhibits bifunctional catalytic activity.

[0014] The present invention also provides a gene encoding the glutamate decarboxylase multi-site combination mutant.

[0015] Specifically, the gene sequences of the glutamate decarboxylase multi-site combination mutants with mutation sites of Y165S / C168M / F304Y / Y308F, Y165S / V167F / C168M / F304Y / Y308F, C168M / F304Y / Y308F and V167F / C168M / F304Y / Y308F are shown in SEQ ID NO.3-6 respectively.

[0016] The present invention also provides a recombinant expression plasmid containing the gene. And a genetically engineered bacterium containing the recombinant expression plasmid. Optionally, the GAD mutant is expressed by a recombinant plasmid pET-28a(+)-GAD. The original vector of the recombinant plasmid is pET-28a(+).

[0017] The present invention also provides the use of the glutamate decarboxylase multi-site combination mutant, the gene, or the genetically engineered bacteria in catalyzing glutamate to generate succinamic acid.

[0018] Compared with the parent enzyme, the mutant enzyme is more conducive to the production of succinamic acid under general conditions and is more suitable for industrial applications.

[0019] The glutamate decarboxylase mutant of the present invention can utilize L-glutamate (L-Glu) to catalyze the production of succinamic acid while retaining the original function.

[0020] The present invention also provides a method for catalyzing glutamate to generate succinamic acid, using glutamate as a reaction substrate, pyridoxal phosphate as a coenzyme, and using the glutamate decarboxylase multi-site combination mutant or the genetically engineered bacteria to carry out a catalytic reaction to obtain succinamic acid.

[0021] Preferably, during the catalytic reaction, the molar concentration of glutamic acid is 100 mM, the molar concentration of pyridoxal phosphate is 0.1 mM, the temperature of the catalytic reaction is 37° C., and the time of the catalytic reaction is 40 min.

[0022] The present invention is based on an amino acid site near a key amino acid in a coenzyme 5'-pyridoxal phosphate binding pocket, determines the amino acid residue site that needs to be mutated, combines a high performance liquid chromatography screening method, and performs experimental verification by site-directed mutagenesis technology. Biocatalysis generates succinamide acid. Compared with the chemical synthesis method, the above compound is synthesized by glutamate decarboxylase biocatalysis, and the synthesis conditions are mild, the operation is simple, and it is easy to separate and extract. The method can effectively increase the screening probability of the mutant amino acid site, improve the experimental efficiency and feasibility, and screen out mutant enzymes whose enzyme activity is significantly better than that of the parent enzyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the results of SDS-PAGE analysis of the glutamate decarboxylase parent and its mutants M1 (Y165S / V167F / C168M / F304Y / Y308F), M2 (V167F / C168M / F304Y / Y308F), M3 (Y165S / C168M / F304Y / Y308F) and M4 (C168M / F304Y / Y308F) prepared in Example 1.

[0024] Figure 2 The liquid chromatograms of the glutamate decarboxylase parent and its mutants catalyzing the substrate L-Glu at 37°C for the same reaction time.

[0025] Figure 3 It is the product conversion rate of the substrate L-Glu catalyzed by the glutamate decarboxylase parent and its mutants under the same reaction conditions at 37°C for the same time. DETAILED DESCRIPTION

[0026] Example 1

[0027] 1. Experimental Materials (1) LB liquid medium: 10 g / L trypsin (purchased from Oxoid), 5 g / L yeast powder (purchased from Oxoid), 10 g / L sodium chloride (purchased from Sangon Biotechnology Co., Ltd.), pH 7.0. LB solid medium: LB liquid medium with 2% ( w / v )Agar powder.

[0028] (2) Methanol (MeOH) was purchased from Aladdin Reagent Co., Ltd. Glycine, Tris, sodium dodecyl sulfate, universal protein staining solution, sodium chloride, glycerol, calcium chloride, imidazole, glacial acetic acid, disodium hydrogen phosphate, sodium dihydrogen phosphate, Coomassie brilliant blue protein concentration determination kit, Ni-NTA chromatography medium, isopropyl-β-D-thiogalactoside (IPTG), lysozyme, kanamycin sulfate and PLP were purchased from Shanghai Shenggong Biotechnology Co., Ltd. DNA marker, protein marker, protein loading buffer and nucleic acid dye were purchased from Beijing Quanshijin Biotechnology Co., Ltd. Agar powder and anhydrous ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd. Acetonitrile was purchased from Shanghai Wokai Chemical Reagent Co., Ltd.

[0029] (3) Strains: In the gene synthesis service, pET-28a(+) plasmid is used as the cloning vector, and the restriction sites are N Ⅰ and Hind III. The constructed recombinant plasmid pET-28a(+)-GAD (glutamate decarboxylase parent, mutants Y165S / C168M / F304Y / Y308F, Y165S / V167F / C168M / F304Y / Y308F, C168M / F304Y / Y308F and V167F / C168M / F304Y / Y308F plasmids) was transferred into E. coli BL21(DE3) to obtain recombinant bacteria.

[0030] 2. Establishment of HPLC detection method HPLC conditions (for product detection): The chromatographic column was Agilent Poroshell HPH.C18 (4.6×150mm, 4 μm), the column temperature was 25°C, the injection volume was 10 μL, the flow rate was 1 mL / min, and the mobile phases were: phase A (10 mM phosphate buffer, pH 6.5), phase B (pure methanol). The mobile phase used an isocratic elution program: 0-10min, and the proportion of phase A was 95%.

[0031] 3. Construction of screening method (1) Transformation of recombinant plasmid Take out the -80℃ storage E. coliBL21(DE3) competent cells, thaw on ice, add 2 μL pET-28a(+)-GAD dilution (20 ng / μL), mix and place on ice for 30 min. Heat shock in a 42℃ water bath for 90 s, quickly place on ice to fully cool for 5 min. Add 650 μL LB liquid culture medium to the tube, culture at 37℃, 180 rpm for 1 h to renature E. coli and express the kanamycin resistance gene encoded by the recombinant plasmid. Take 100 μL of bacterial solution, dilute and evenly spread on an LB plate containing 50μg / mL kanamycin, place it face up for half an hour, turn the plate upside down after the bacterial solution is completely absorbed by the culture medium, culture at 37℃ for 24 h, and then store in a 4℃ refrigerator.

[0032] (2) Screening of bacterial strains A single colony was picked from the above plate and colony PCR was performed using primers T7 (TAATACGACTCACTATAGG, sequence number: SEQ ID NO. 29) and T7t (CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG, sequence number: SEQ ID NO. 30). The PCR product was subjected to DNA agarose gel electrophoresis to observe whether there were bands at the corresponding position. The strains with bright bands were selected for glycerol preservation and stored at -80°C.

[0033] 4. Selection of mutation sites The amino acid residues that need to be mutated are screened by comparing the crystal structure of glutamate decarboxylase with the crystal structure of mammalian GAD65 and combining the amino acid sequence alignment results.

[0034] The key sites affecting the catalytic function were selected as 165, 166, 167, 168, 304, and 308. The obtained sites were combined for mutation, and finally the gene sequences of mutants Y165S / V167F / C168M / F304Y / Y308F (named as mutant M1), V167F / C168M / F304Y / Y308F (named as mutant M2), Y165S / C168M / F304Y / Y308F (named as mutant M3), and C168M / F304Y / Y308F (named as mutant M4) were obtained as shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.3, and SEQ ID NO.5, respectively.

[0035] Using the primers in Table 1, a gene encoding a glutamate decarboxylase mutant (the amino acid sequence of glutamate decarboxylase is shown in SEQ ID NO.2, the gene sequence is shown in SEQ ID NO.1, and the length is 1407 bp) was isolated from Lactobacillus brevis ( Lactobacillus brevis) was cloned from , GenBank No. GU987102) as a plasmid for PCR amplification. The PCR product was amplified at 37°C. Dpn After digestion with I enzyme, the PCR product was purified using a PCR product purification kit and then transferred into E. coli BL21 (DE3) competent cells, and 1 h later, the resuscitation solution was spread on LB solid plates containing kanamycin at a final concentration of 50 μg / μL to obtain a site-directed mutation library. The recombinant plasmid was sent to Anhui General Biosystems Co., Ltd. for nucleotide sequence determination, and the recombinant plasmid with the correct sequence was transformed into E. coli BL21(DE3) competent cells were used to obtain the target recombinant strain. The site-directed mutagenesis primers for each site corresponding to the GAD mutant are shown in Table 1.

[0036] Table 1 Mutation sites and primer sequences

[0037] 5. Establishment of mutation library and extraction of plasmid Take out the -80℃ storage E. coli BL21(DE3) competent cells were thawed on ice and 2 μL pET-28a(+)-GAD and its mutant dilution (20 ng / μL) was added. After mixing, the cells were placed on ice for 30 min. After heat shock in a 42°C water bath for 90 s, the cells were quickly placed on ice to cool for 5 min. 650 μL LB liquid medium was added to the tube and cultured at 37°C and 180 rpm for 1 h to allow E. coli to renature and express the kanamycin resistance gene encoded by the recombinant plasmid. 100 μL of the bacterial solution was diluted and evenly spread on an LB plate containing 50 μg / mL kanamycin. The plate was placed with the front side facing up for 30 min. After the bacterial solution was completely absorbed by the culture medium, the plate was inverted and cultured at 37°C for 24 h before being stored in a 4°C refrigerator.

[0038] A single colony was randomly picked from the plate and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C and 200 rpm until OD 600 When the value is 0.8, 1 mL of bacterial solution was sent to Hangzhou Youkang Biotechnology Co., Ltd. for nucleotide sequence determination. 1 mL of bacterial solution was used to preserve the strain, and 3 mL of bacterial solution was used to extract the plasmid. The specific steps refer to the instructions of the plasmid small-scale extraction kit. After the size and purity of the target band of the correctly sequenced strain plasmid were verified by DNA agarose gel electrophoresis, 5 μL of plasmid was transferred into E. coli BL21(DE3) competent cells to obtain the target recombinant strain.

[0039] 6. Enzyme expression and purification The parent enzyme and mutant single colonies were picked and inoculated into 5 mL LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured in a shaking incubator at 37°C and 200 rpm for 12 h. The bacterial solution was transferred to 200 mL LB liquid medium containing kanamycin at a final concentration of 50 μg / mL at a 2% inoculum (v / v), and cultured for 2-3 h at 37°C and 200 rpm. When OD 600 When the p-value reached 0.8, IPTG was added to a final concentration of 0.5 mM, and protein expression was induced at 25°C and 150 rpm. After 20 h of induction, the cells were collected at 6000 rpm and 4°C.

[0040] The bacterial cells were washed twice with 20 mM PBS buffer (pH 8.0) to remove the residual culture medium and then suspended in 50 mL cell disruption buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 20 mM imidazole, pH 8.0). The bacterial cells were broken by homogenizer under ice bath conditions. The cell disruption solution was centrifuged at 8000 rpm and 4°C for 1 h, and the supernatants were collected separately to obtain the crude enzyme solution containing glutamate decarboxylase. Subsequently, the crude enzyme solution was separated and purified by Ni-NTA affinity chromatography, and the crude enzyme was loaded, washed, and eluted to obtain the pure enzyme solution.

[0041] 7. Determination of protein content The protein content standard curve was established using a modified Bradford protein concentration assay kit to determine the concentration of the pure enzyme. The preparation steps of the protein standard curve were carried out according to the instructions. The molecular weight and purity of the purified protein were identified using the SDS-PAGE method (12% separation gel and 5% concentration gel).

[0042] The SDS-PAGE electrophoresis patterns of the parent enzyme and mutants are shown in Figure 1 The electrophoresis bands of the parent enzyme and the mutant were located at the same horizontal line, with a molecular weight of about 56 kDa, which was consistent with the theoretical molecular weight (56.2 kDa), laying the foundation for subsequent experiments.

[0043] Example 2

[0044] Characterization of mutants and determination of product conversion rates.

[0045] The enzymes expressed by each mutant (single point mutations including C168M, V167F, Q166H, Y165S, Q166A, V167M, C168S and combined mutations F304Y / Y308F, M1, M2, M3 and M4) were separated and purified, and the concentration of each purified protein was adjusted to 1 mg / mL. 200 μL of purified GAD and its mutants were mixed with 800 μL of a mixture containing 100 mM L-glutamate and 0.1 mM pyridoxal phosphate, and reacted at 37°C and 400 rpm for 40 min. Then, 100 μL of the reaction solution was immediately taken out and added to 900 μL of NaHCO3 solution (0.2 M, pH 9.8) to terminate the reaction. The above mixture was mixed, centrifuged, filtered, and the reactants and products (succinic acid) were analyzed by HPLC.

[0046] The product conversion rate is the molar concentration of the product divided by the initial molar concentration of the substrate. Figure 2 and Figure 3 As shown, compared with the parent enzyme GAD, the product conversion rates of mutants M1, M2, M3, and M4 were 75.7%, 65.3%, 77.4%, and 66.9%, respectively.

Claims

1. A glutamate decarboxylase multi-site combination mutant, characterized in that: The multi-site combination mutant of glutamate decarboxylase is obtained by multi-site combination mutation based on the amino acid sequence of SEQ ID NO.2, and the mutation site of the multi-site combination mutant of glutamate decarboxylase is any one of the following: (1) Y165S / C168M / F304Y / Y308F; (2) Y165S / V167F / C168M / F304Y / Y308F; (3) C168M / F304Y / Y308F; (4) V167F / C168M / F304Y / Y308F.

2. A gene encoding the glutamate decarboxylase multi-site combination mutant according to claim 1.

3. The gene according to claim 2, characterized in that The gene sequences of the glutamate decarboxylase multi-site combination mutants with mutation sites of Y165S / C168M / F304Y / Y308F, Y165S / V167F / C168M / F304Y / Y308F, C168M / F304Y / Y308F and V167F / C168M / F304Y / Y308F are shown in SEQ ID NO.3-6 respectively.

4. A recombinant expression plasmid comprising the gene according to claim 2.

5. A genetically engineered bacterium comprising the recombinant expression plasmid according to claim 4.

6. Use of the glutamate decarboxylase multi-site combination mutant according to claim 1, the gene according to claim 2 or 3, or the genetically engineered bacteria according to claim 5 in catalyzing glutamate to produce succinamic acid.

7. A method for catalyzing glutamic acid to produce succinamic acid, characterized in that: Glutamic acid is used as a reaction substrate, pyridoxal phosphate is used as a coenzyme, and the glutamate decarboxylase multi-site combination mutant according to claim 1 or the genetically engineered bacteria according to claim 5 is used to carry out a catalytic reaction to obtain succinamic acid.

8. The method for catalyzing glutamic acid to produce succinamic acid as claimed in claim 7, characterized in that: During the catalytic reaction, the molar concentration of the glutamic acid is 100 mM, and the molar concentration of the pyridoxal phosphate is 0.1 mM.

9. The method for catalyzing glutamic acid to produce succinamic acid as claimed in claim 7, characterized in that: During the catalytic reaction, the catalytic reaction temperature was 37°C and the catalytic reaction time was 40 min.

Images