Cellobiose epimerase mutant and application thereof

Abstract

The invention discloses a cellobiose epimerase mutant and application thereof, and belongs to the technical field of bioengineering. The mutant is obtained by simultaneously carrying out site-directed mutagenesis on seven amino acids of an amino acid sequence as shown in SEQ ID NO.2; the site-specific mutagenesis is that the 17th arginine of the amino acid sequence shown as SEQ ID NO.2 is mutated into glutamine, the 24th alanine is mutated into serine, the 64th isoleucine is mutated into valine, the 184th leucine is mutated into serine, the 243th phenylalanine is mutated into leucine, the 339th glutamic acid is mutated into aspartic acid, and the 340th lysine is mutated into isoleucine. The mutant can be applied to the field of industrial lactulose production, lactulose can be efficiently prepared, the production intensity is high, the catalytic effect on a high-concentration substrate is good, enzyme shows better stability, efficient conversion of lactulose can be achieved, and a favorable basis is further provided for industrial application of cellobiose epimerase.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a cellobiose epimerase mutant and application thereof. Background Art

[0002] Lactulose (4-O-β-D-galactopyranosyl-D-fructofuranose) is a disaccharide composed of D-galactosyl and D-fructose connected by β-1,4-glycosidic bonds, and has good water solubility. Lactulose has multiple physiological effects and is a functional oligosaccharide that can be used as both medicine and food. It is widely used in the pharmaceutical, food, health care and other industries. Concentrated lactulose syrup can be used as an oral solution to treat constipation and hepatic encephalopathy caused by high blood ammonia. At the same time, lactulose, as a prebiotic, can promote the reproduction of beneficial bacteria such as bifidobacteria and lactic acid bacteria in the intestine, inhibit the growth of harmful bacteria such as Salmonella and Clostridium, and achieve intestinal microenvironment balance. Lactulose is registered as an over-the-counter (OTC) drug in more than 100 countries and has been used for nearly 70 years; its safety is very high, and there are no reports of poisoning, cancer or teratogenicity even if taken in large doses.

[0003] The content of naturally occurring lactulose is extremely low, and a large amount of lactulose must be obtained through artificial synthesis. Chemical catalysis is currently the main method for industrial production of lactulose. Due to the problems of low conversion rate, many by-products, and difficult separation and purification in the chemical synthesis of lactulose, the biological enzyme method can achieve efficient conversion of lactulose, and is environmentally friendly and convenient for separation and purification. Therefore, the development of an effective biological method for preparing lactulose is of great significance for the industrial production of lactulose. In recent years, it has been found that cellobiose diastereomerase can efficiently prepare lactulose, and has a high production intensity, good catalytic effect on high-concentration substrates, and the enzyme shows good stability. It is a new generation of lactulose preparation method with great industrial potential.

[0004] However, the current technology of synthesizing lactulose by cellobiose epimerase still has some defects, the most notable of which is that the isomerization activity is too low, resulting in the need to add a large amount of enzyme in the reaction of synthesizing lactulose, increasing the production cost. In addition, since the reaction must be carried out at high temperatures, this puts higher requirements on the thermal stability of cellobiose epimerase. Therefore, it is not ideal to synthesize lactulose using only natural cellobiose epimerase, and it is necessary to improve the defects of the enzyme through molecular modification and improve the prospects for industrial application. Summary of the invention

[0005] The object of the present invention is to provide a cellobiose epimerase mutant and its application to solve the problems existing in the above-mentioned prior art. The cellobiose epimerase mutant provided by the present invention can efficiently prepare lactulose, and has high production intensity, good catalytic effect on high-concentration substrates, and the enzyme exhibits better stability, can achieve efficient conversion of lactulose, and further provides a favorable basis for the industrial application of cellobiose epimerase.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a cellobiose epimerase mutant, wherein the mutant is prepared by simultaneously subjecting 7 amino acids of an amino acid sequence shown in SEQ ID NO.2 to site-directed mutations; the site-directed mutations are as follows: the 17th arginine of the amino acid sequence shown in SEQ ID NO.2 is mutated to glutamine, the 24th alanine is mutated to serine, the 64th isoleucine is mutated to valine, the 184th leucine is mutated to serine, the 243rd phenylalanine is mutated to leucine, the 339th glutamic acid is mutated to aspartic acid, and the 340th lysine is changed to isoleucine.

[0008] The present invention also provides a gene encoding the cellobiose epimerase mutant.

[0009] The invention also provides a recombinant vector comprising the gene.

[0010] The invention also provides a recombinant bacterium comprising the gene.

[0011] The present invention also provides the use of the cellobiose epimerase mutant, the gene, the recombinant vector or the recombinant bacteria in the preparation of lactulose.

[0012] The present invention also provides the use of the cellobiose epimerase mutant, the gene, the recombinant vector or the recombinant bacteria in improving the lactulose production efficiency.

[0013] The present invention also provides a method for improving the production efficiency of lactulose, comprising the step of utilizing the cellobiose diastereomerase mutant to catalyze lactose to synthesize lactulose.

[0014] Furthermore, in the process of synthesizing lactulose, lactose is used as a substrate, a buffer solution with a pH of 7.5 is used as a reaction medium to form a reaction system, and the reaction is carried out at 80° C. to obtain lactulose.

[0015] The present invention discloses the following technical effects:

[0016] The invention provides a cellobiose epimerase mutant R17Q / L184S. Compared with the wild-type cellobiose epimerase (CsCE), the optimal catalytic conditions of the cellobiose epimerase mutant R17Q / L184S are not changed, but the mutant has a V of 80°C. max and k cat The reaction rate is higher, and the half-life of the enzyme activity at 80°C reaches 200 minutes. The mutant is applied to the industrial production of lactulose, which can efficiently prepare lactulose, and has a high production intensity. It has a good catalytic effect on high-concentration substrates, and the enzyme shows better stability, which can achieve efficient conversion of lactulose, and further provides a favorable basis for the industrial application of cellobiose isomerase. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 The temperature stability of the original enzyme and the R17Q / L184S mutant;

[0019] Figure 2 This is the HPLC detection diagram after the R17Q / L184S mutant catalyzed the lactose reaction. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] The experimental materials and reagents used in the embodiments of the present invention are as follows:

[0026] (1) The tryptone and yeast extract used in the present invention were purchased from Oxoid Company, UK, and the other analytical pure chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0027] (2) E. coli BL21 (DH5α), E. coli BL21 (DE3) and other molecular biology reagents were provided by Beijing Quanshijin Biotechnology Co., Ltd.

[0028] (3) Primer synthesis and sequencing services were provided by Beijing Qingke Biotechnology Co., Ltd. Nanjing Branch.

[0029] (4) The culture medium formula used is as follows:

[0030] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl. Solid medium is supplemented with 2% (w / v) agar.

[0031] A medium: tryptone 10g / L, KNO 3 10 g / L, glycerol 10 g / L, glucose 5 g / L, Na 2 HPO 4 6.78 g / L, KH 2 PO 4 3 g / L, NH 4 Cl 1g / L.

[0032] (5) Resorcinol-HCl solution formula: 0.09 g of resorcinol is dissolved in 180 mL of concentrated hydrochloric acid and water is added to make up to 500 mL.

[0033] (6) HPLC mobile phase formula: 84:16 (v / v) acetonitrile-phosphate buffer (1.15 g NaH 2 PO 4 Dissolve in 1000 mL of water), and then adjust the pH to 6.8 using 20% ​​(w / v) sodium hydroxide solution.

[0034] Example 1 Construction and expression of wild-type cellobiose epimerase gene

[0035] The cellobiose epimerase (CsCE, PDB number: 4Z4J) from Caldicellulosiruptorsaccharolyticus DSM 8903 was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. after codon optimization, and the sequence is shown in SEQ ID NO.1. The amino acid sequence encoded by the optimized gene sequence is shown in SEQ ID NO.2, and then the synthesized gene sequence was transferred into the vector pET-28a(+) through the restriction sites BamHI and XhoI to synthesize the recombinant plasmid pET-28a(+)-CsCE, and the synthesized recombinant plasmid was transformed into E.coli BL21(DE3), coated on LB agar plates containing kanamycin at a final concentration of 100 μg / mL, and cultured at 37°C for 12 hours.

[0036] The enzyme production process is as follows:

[0037] Pick a single clone and transfer it to 50mL liquid LB medium containing kanamycin at a final concentration of 50μg / mL, culture at 37℃, 220rpm for 12h, then transfer it to A medium at a 1% (v / v) inoculation amount, culture at 37℃, 220rpm for 5h, add isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 50μg / mL, and induce culture at 25℃, 220rpm for 18h. Take the induced bacterial solution, centrifuge at 8000rpm for 15min, pour out the supernatant, and add 40mL 10mM KH 2 PO 4 -NaOH buffer (pH 7.5), repeatedly shaken until the bacterial precipitate is dissolved. Then, ultrasonically disrupt the cells at 400W for 20min (working for 2s, resting for 3s), and centrifuge the disrupted cells at 8000rpm for 15min. The supernatant is the crude enzyme solution.

[0038] Example 2 Construction and expression of mutant genes

[0039] Using pET-28a(+)-CsCE as a template, primers were designed for site-directed mutagenesis. Based on the G4-C5 mutant studied by Shen et al. of Jiangnan University (disclosed in the document Enhancement of isomerization activity and lactulose production of cellobiose2-epimerase from Caldicellulosiruptorsaccharolyticus), in addition to introducing mutations A24S, I64V, F243L, E339D and K340I, new mutations R17Q and L184S were added to construct a mutant plasmid pET-28a(+)-R17Q / L184S. The amino acid sequence encoded by the plasmid is shown in SEQ ID NO.3. The designed primers are:

[0040] Forward primer R17Q: CAGATCTTCTTTAAACATGGTAATATCCATGCTGCCG (SEQ ID NO. 4);

[0041] Reverse primer R17Q: ATGTTTAAAGAAGATCTGAAATCGCATCTGG (SEQ ID NO. 5);

[0042] Forward primer A24S: TCGCATCTGGAAGAAAAAATTATTCCG (SEQ ID NO. 6);

[0043] Reverse primer A24S: TTCTTCCAGATGCGATTTCAGATCTTCT (SEQ ID NO. 7);

[0044] Forward primer I64V: AAAGCGCAGAAAGGCTGCGTTCTGAACAGCCG (SEQ ID NO. 8);

[0045] Reverse primer I64V: AACGCAGCTTTCTGCGCTTTGCGATCAATGTTC (SEQ ID NO. 9);

[0046] Forward primer L184S: TCGAGCGAAAACGGCGTGATTGCGAGC (SEQ ID NO. 10);

[0047] Reverse primer L184S: CGCCGTTTTCGCTCGAAAAGCGGTTTT (SEQ ID NO. 11);

[0048] Forward primer F243L: CTCTGCGATGATAACTGGAACGAACTGATT (SEQ ID NO. 12);

[0049] Reverse primer F243L: CCAGTTATCATCGCAGAGCACTTTAAAATGGCC (SEQ ID NO. 13);

[0050] Forward primer E339D-K340I: GATATCTATCTGGATGCGGCGATTAAAACCTGG (SEQ ID NO. 14);

[0051] Reverse primer E339D-K340I: CGCCGCATCCAGATAGATATCTTCTTTGGTTTTCTG (SEQ ID NO. 15).

[0052] PCR reaction system: forward primer 0.5 μL, reverse primer 0.5 μL, template 0.5 μL, 2×TransStartFastPfu Fly PCR Super Mix 12.5 μL, ddH 2 O 11 μL, total volume 25 μL.

[0053] PCR amplification conditions: pre-denaturation at 94°C for 5 min, 25 cycles of (94°C for 20 s, 55°C for 30 s, 72°C for 90 s), 72°C for 10 min, and finally incubation at 4°C.

[0054] Point mutations First, the original enzyme plasmid pET-28a(+)-CsCE was used as a template, one of the above primer pairs was selected, and the mutant plasmid was constructed by PCR amplification reaction under the conditions described, and then agarose gel electrophoresis was used for identification, and 0.5μLDMTase was added to react at 37°C for 1h to digest the template. It was then transformed into E.coli BL21 (DH5α), coated on an LB agar plate containing a final concentration of 50μg / mL kanamycin, and cultured at 37°C for 12h. The plate was picked by the Nanjing Branch of Beijing Qingke Biotechnology Co., Ltd. for single clone culture, plasmid extraction and sequencing. After sequencing verification, the successfully constructed mutant plasmid was used as a template, and other primers were selected according to the same method to construct a new mutant plasmid. After 6 rounds of mutation, the mutant plasmid pET-28a(+)-R17Q / L184S was finally obtained.

[0055] The mutant plasmid pET-28a(+)-R17Q / L184S that was successfully sequenced was selected and transformed into E. coli BL21 (DE3), coated on an LB agar plate containing kanamycin at a final concentration of 100 μg / mL, and cultured at 37° C. for 12 h. Then, the enzyme production process was carried out according to the method of Example 1 to obtain the enzyme solution of the mutant R17Q / L184S.

[0056] Example 3 Enzyme activity determination and specific activity determination

[0057] Enzyme activity assay conditions: total volume 3 mL, final lactose concentration 10%, enzyme addition 1 mL, reaction at 80°C for 20 min, add 100 μL concentrated hydrochloric acid to terminate the reaction. Centrifuge the reaction solution at 8000 rpm for 5 min, and take the supernatant to determine the enzyme activity using the resorcinol method.

[0058] Definition of enzyme activity: 1U of enzyme is required to produce 1μmol of lactulose per minute.

[0059] The specific process of determining enzyme activity by the resorcinol method is as follows: take 800 μL of resorcinol-HCl solution, add an appropriately diluted reaction solution (total volume 200 μL), mix and react in a boiling water bath for 7 minutes, immediately add 5 mL of pure water to cool, use a UV-visible spectrophotometer to measure the absorbance at 480 nm, and substitute it into the formula to calculate the enzyme activity.

[0060] Enzyme activity calculation formula: Enzyme activity (U / mL) = (OD 480 × dilution factor) / 0.07824;

[0061] The protein concentration was determined by Bradford method and the specific activity was further calculated.

[0062] The crude enzyme activity and specific activity of the original enzyme and the R17Q / L184S mutant are shown in Table 1. The crude enzyme activity and specific activity of the R17Q / L184S mutant are greatly improved compared with the original enzyme, with the crude enzyme activity being 320% of the original enzyme and the specific activity being 208% of the original enzyme.

[0063] Table 1 Crude enzyme activity and specific activity of the original enzyme and R17Q / L184S mutant

[0064]

[0065] Example 4 Kinetic constants of the original enzyme and the R17Q / L184S mutant

[0066] Different lactose concentration gradients (100mM, 200mM, 300mM, 400mM, 500mM and 600mM) were set, 1mL of pure enzyme solution was added, and the reaction was carried out at 80℃ for 10min. The enzyme activity was determined by the resorcinol method and the protein concentration was determined by the Bradford method. After fitting with the Lineweaver-Burk double reciprocal method, K m 、V max , k cat and k cat / K m The experimental results are shown in Table 2. The K m The value was lower than that of the original enzyme, indicating that the affinity for the substrate decreased, but V max and k cat Higher, indicating increased reaction speed.

[0067] Table 2 Kinetic constants of the original enzyme and the R17Q / L184S mutant

[0068]

[0069] Example 5 Temperature stability of the original enzyme and the R17Q / L184S mutant

[0070] The enzyme solution was incubated at 80°C for 4 hours, and samples were taken every 0.5 hours. After sampling, it was immediately cooled in an ice bath for 10 minutes, and then centrifuged at 12000 rpm. The supernatant was taken and stored in a refrigerator at 4°C for later use. The enzyme activity was determined using the method of Example 3, and the enzyme half-life at this temperature was calculated. The experimental results are shown in Figure 1 The thermal stability of the R17Q / L184S mutant was significantly improved compared with the original enzyme. The half-lives of the original enzyme and R17Q / L184S at 80°C were 120 min and 200 min, respectively.

[0071] Example 6 R17Q / L184S mutant catalyzes the synthesis of lactulose

[0072] Reaction conditions: total volume 20 mL, final lactose concentration 700 g / L, enzyme addition 25 U / mL, 80°C, 150 rpm, reaction for 3 h. After the reaction, the product in the reaction solution was detected by high performance liquid chromatography, and the chromatographic conditions were as follows:

[0073] Chromatographic column: amino column (4.6 mm × 250 mm, 5 μm);

[0074] Detector: differential refractive index detector;

[0075] Mobile phase: acetonitrile-phosphate buffer (84:16), pH 6.8;

[0076] Flow rate: 1.5 mL / min;

[0077] Column temperature: 40°C;

[0078] Injection volume: 20 μL.

[0079] The experimental results are shown in Figure 2 After the reaction, the lactulose yield was 77.4%, and the content of the byproduct epiratose was low, which achieved efficient conversion of lactulose under high substrate concentration and was suitable for industrial production.

[0080] Optimized CsCE gene sequence (SEQ ID NO.1):

[0081]

[0082] Amino acid sequence encoded by the optimized CsCE gene sequence (SEQ ID NO.2):

[0083] SMTGGQQMGRGSMDITRFKEDLKAHLEEKIIPFWQSLKDDEFGGYYGYMDFNLNIDRKAQKGCILNSRILWFFSACYNVLKSEKCKEMAFHAFEFLKNKFWDKEYEGLFWSVSHKGVPVDVTKHVYVQAFGIYGLSEYYEASGDEEALHMAKRLFEILETKCKRENGYTEQFERNWQEKENRFLSENGVIASKTMNTHLHVLESYTNLYRLLKLDDVYEALEWIVRLFVDKIYKKGTGHFKVFCDDNWNELIKAVSYGHDIEASWLLDQAAKYLKDEKLKEEVEKLALEVAQITLKEAFDGQSLINEMIEDRIDRSKIWWVEAETVVGFFNAYQKTKEEKYLDAAIKTWEFIKEHLVDRRKNSEWLWKVNEDLEAVNMPIVEQWKCPYHNGRMCLEIIKRVD。

[0084] Amino acid sequence encoded by the mutated CsCE gene sequence (SEQ ID NO.3):

[0085] SMTGGQQMGRGSMDITQFKEDLKSHLEEKIIPFWQSLKDDEFGGYYGYMDFNLNIDRKAQKGCVLNSRILWFFSACYNVLKSEKCKEMAFHAFEFLKNKFWDKEYEGLFWSVSHKGVPVDVTKHVYVQAFGIYGLSEYYEASGDEEALHMAKRLFEILETKCKRENGYTEQFERNWQEKENRFSSENGVIASKTMNTHLHVLESYTNLYRLLKLDDVYEALEWIVRLFVDKIYKKGTGHFKVLCDDNWNELIKAVSYGHDIEASWLLDQAAKYLKDEKLKEEVEKLALEVAQITLKEAFDGQSLINEMIEDRIDRSKIWWVEAETVVGFFNAYQKTKEDIYLDAAIKTWEFIKEHLVDRRKNSEWLWKVNEDLEAVNMPIVEQWKCPYHNGRMCLEIIKRVD。

[0086] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A cellobiose epimerase mutant, characterized in that: The mutant is a mutant in which 7 amino acids of the amino acid sequence shown in SEQ ID NO.2 are simultaneously subjected to site-directed mutation; the site-directed mutation is that the 17th arginine of the amino acid sequence shown in SEQ ID NO.2 is mutated to glutamine, the 24th alanine is mutated to serine, the 64th isoleucine is mutated to valine, the 184th leucine is mutated to serine, the 243rd phenylalanine is mutated to leucine, the 339th glutamic acid is mutated to aspartic acid, and the 340th lysine is changed to isoleucine.

2. A gene encoding the cellobiose epimerase mutant according to claim 1.

3. A recombinant vector comprising the gene according to claim 2.

4. A recombinant bacterium comprising the gene according to claim 2.

5. Use of the cellobiose epimerase mutant according to claim 1, the gene according to claim 2, the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in the preparation of lactulose.

6. Use of the cellobiose epimerase mutant according to claim 1, the gene according to claim 2, the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in improving lactulose production efficiency.

7. A method for improving lactulose production efficiency, characterized in that: The method comprises the step of utilizing the cellobiose epimerase mutant of claim 1 to catalyze lactose to synthesize lactulose.

8. The method according to claim 7, characterized in that In the process of synthesizing lactulose, lactose is used as a substrate, a buffer solution with a pH of 7.5 is used as a reaction medium to form a reaction system, and the reaction is carried out at 80° C. to obtain lactulose.

Images