Gene for promoting pichia pastoris to express foreign protein, recombinant pichia pastoris, construction method of recombinant pichia pastoris and method for efficiently expressing recombinant protein

Abstract

The invention provides a gene for promoting pichia pastoris to express foreign protein, recombinant pichia pastoris, a construction method of the recombinant pichia pastoris and a method for efficiently expressing recombinant protein, and belongs to the technical field of bioengineering. The gene for promoting pichia pastoris to express foreign protein is marked as the gene PASchr30259, the gene sequence of the gene is shown as Seq No.1, the amino acid sequence coded by the gene is shown as Seq No.2, and the amino acid sequence is marked as PASchr30259 coded protein. The gene PASchr30259 is connected with a carrier and transferred into pichia pastoris cells, and experimental results show that the expression quantity of exogenous genes driven by an alcohol oxidase 1 promoter of the strain is increased by overexpression of the gene PASchr30259; according to the invention, microorganisms are modified by means of genetic engineering, so that the yield of foreign proteins expressed by the microorganisms is increased, and a foundation is laid for large-scale commercial production of the foreign proteins.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a gene for promoting Pichia pastoris to express exogenous protein, a recombinant Pichia pastoris and a construction method thereof, and a method for efficiently expressing recombinant protein. Background Art

[0002] Pichia pastoris (Komagataella phaffii), formerly known as Pichia pastoris, is a well-known methylotrophic microorganism. Moreover, Pichia pastoris has the characteristics of fast growth, high-density fermentation, simple genetic engineering operation, and post-translational modification (folding, disulfide bond formation and glycosylation) of exogenous protein expression. Therefore, Pichia pastoris has become an important cell factory for the production of exogenous proteins. Pichia pastoris uses the alcohol oxidase 1 promoter to activate exogenous genes and uses methanol or formate as inducers to express exogenous proteins. It has become a generally recognized safe (GRAS) yeast (Trends in Biotechnology 2022, 40: 576-590). In recent years, more than 5,000 exogenous proteins and high value-added chemicals have been successfully expressed and produced using Pichia pastoris (Trends in Biotechnology 2023, 41: 1066-1079.). Increasing the amount of exogenous protein expressed by Pichia pastoris is a hot topic that promotes its wider application. Kranthi et al. reported the transcription factor Mxr1 (Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms 2009, 1789: 460-468). Wang et al. reported the transcription factor Mit1 (Journal of Biological Chemistry 2016, 291: 6245-6261.). Zheng et al. reported the transcription factor Fhl1p (Microbial cell factories 2019, 18: 207). Summary of the invention

[0003] The present invention is made to solve the above problems, and aims to provide a gene for promoting Pichia pastoris to express foreign protein, a recombinant Pichia pastoris and a construction method thereof, and a method for efficiently expressing recombinant protein.

[0004] The present invention provides a gene for promoting Pichia pastoris to express exogenous protein, which has the following characteristics: the gene is recorded as gene PAS_chr3_0259, the gene sequence is shown in Seq No.1, the amino acid sequence encoded by the gene is shown in Seq No.2, and the amino acid sequence is recorded as PAS_chr3_0259 encoded protein.

[0005] The present invention also provides a recombinant Pichia pastoris, characterized in that it comprises the above-mentioned gene for promoting Pichia pastoris to express foreign protein.

[0006] The present invention also provides a method for constructing the above-mentioned recombinant Pichia pastoris, characterized in that the xylanase gene of Aspergillus niger is used as a reporter gene, the alcohol oxidase 1 promoter and the xylanase gene are transformed into Pichia pastoris, and the PAS_chr3_0259 encoding protein is co-expressed to obtain the recombinant Pichia pastoris.

[0007] The method for constructing the recombinant Pichia pastoris provided by the present invention may also have the following characteristics: wherein the reporter gene is the xylanase gene of Aspergillus niger ATCC1015, the gene is denoted as xynB, and the gene sequence thereof is shown in Seq No.3.

[0008] The method for constructing the recombinant Pichia pastoris provided by the present invention may also have the following characteristics, including the following steps:

[0009] Step S1: Recombining the reporter gene and plasmid pPIC9K to obtain plasmid pPIC9K-xynB;

[0010] Step S2: Recombining the upstream and downstream fusion fragments of gene PAS_chr3_0259 with plasmid pPICZA to obtain plasmid pPICZA-△0259;

[0011] Step S3: Recombining gene PAS_chr3_0259 with plasmid pPICZA and connecting with His4 gene to obtain plasmid pPICZA-0259-His4;

[0012] Step S4: hydrolyze plasmid pPIC9K-xynB with restriction endonuclease Sal I, and hydrolyze plasmid pPICZA-△0259 and plasmid pPICZA-0259-His4 with restriction endonuclease Not I, respectively, to obtain corresponding linearized plasmid fragments;

[0013] Step S5: The linearized pPIC9K-xynB plasmid is transformed into Pichia pastoris by electroporation technology to obtain recombinant Pichia pastoris KxP1, and the linearized pPICZA-△0259 plasmid and the linearized pPICZA-0259-His4 plasmid are respectively transformed into the recombinant Pichia pastoris KxP1 to obtain recombinant Pichia pastoris KxP1△0259 and recombinant Pichia pastoris KxP1::0259.

[0014] The method for constructing the recombinant Pichia pastoris provided by the present invention may also have the following characteristics: in step S1, the specific process for preparing the plasmid pPIC9K-xynB is: connecting the reporter gene obtained by polymerase chain reaction technology with the plasmid pPIC9K cut with restriction endonuclease Not I to obtain the plasmid pPIC9K-xynB.

[0015] The method for constructing the recombinant Pichia pastoris provided by the present invention may also have the following characteristics: In step S2, the specific process of preparing the plasmid pPICZA-△0259 is as follows:

[0016] The upstream and downstream fragments of gene PAS_chr3_0259 were obtained by polymerase chain reaction technology and fused, and the fused fragment was connected with plasmid pPICZA double-digested with restriction endonucleases Bgl II and BamH I to obtain plasmid pPICZA-△0259.

[0017] In the construction method of recombinant Pichia pastoris provided by the present invention, the following features may also be provided: in step S3, the specific process of preparing plasmid pPICZA-0259-His4 is: using polymerase chain reaction technology to obtain a fragment of gene PAS_chr3_0259, connecting the fragment with a pPICZA plasmid double-digested with restriction endonucleases Xho I and Not I, and then digesting the recombinant plasmid with Bgl II, and then connecting it with the His4 fragment obtained by polymerase chain reaction technology to obtain plasmid pPICZA-0259-His4.

[0018] The present invention also provides a method for efficiently expressing recombinant proteins, characterized in that the recombinant Pichia pastoris is cultured in a culture medium, and methanol or formate is added after the culture to induce the recombinant Pichia pastoris to express the recombinant protein.

[0019] The method for efficiently expressing recombinant protein provided by the present invention may also have the following characteristics: wherein the concentration of methanol is 0.5-3%, the concentration of formate is 0.2-1.5%, the culture medium is BMGY culture medium, and the culture medium includes 10 g / L yeast powder, 20 g / L peptone, 100 mmol / L potassium phosphate buffer pH 6.0, 13.4 g / L yeast nitrogen source culture medium, 4×10 -4 g / L and glycerol 10g / L, and the culture time was 2 days.

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] 1. The gene for promoting Pichia pastoris to express foreign proteins, the recombinant Pichia pastoris and the construction method thereof, as well as the method for efficiently expressing recombinant proteins provided by the present invention, taking the secretion expression of xylanase as an example, under the condition of 1% methanol induction, the co-expression gene PAS_chr3_0259 driven by the alcohol oxidase promoter 1 can increase the expression level by 58.4%. Under the condition of 0.2% sodium formate induction, the co-expression gene PAS_chr3_0259 driven by the alcohol oxidase promoter 1 can increase the expression level by 88.1%.

[0022] 2. The method for efficiently expressing recombinant proteins provided by the present invention has a significantly higher expression level than traditional methods.

[0023] 3. The present invention can use safe formate induction to efficiently express recombinant proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a flow chart of the construction of the recombinant Pichia pastoris KxP1 in Example 1 of the present invention.

[0025] Figure 2 It is a flow chart of the construction of recombinant Pichia pastoris KxP1△0259 in Example 1 of the present invention.

[0026] Figure 3 This is a flow chart of the construction of the recombinant Pichia pastoris KxP1::0259 in Example 1 of the present invention.

[0027] Figure 4 The figure is a schematic diagram of the cell concentration, xylanase activity and xylanase expression of the recombinant Pichia pastoris KxP1△0259, KxP1 and KxP1::0259 in Example 1 of the present invention after 144 hours of culture under 1% methanol induction. Wherein, (a) cell concentration; (b) xylanase activity; (c) xylanase expression measured by SDS-PAGE polyacrylamide gel electrophoresis, M: non-prestained protein marker, 4.1-66 kDa, 1: K.phaffii GS115, 2: KxP1, 3: KxP1△0259, 4: KxP1::0259.

[0028] Figure 5The diagram is a schematic diagram of the cell concentration, xylanase activity and xylanase expression level of the recombinant Pichia pastoris KxP1△0259, KxP1 and KxP1::0259 in Example 2 of the present invention after 144 hours of culture under 1% methanol induction. (a) Cell concentration; (b) Xylanase activity; (c) SDS-PAGE polyacrylamide gel electrophoresis to determine the xylanase expression level, M: non-prestained protein marker, 4.1-66 kDa, 1: K.phaffii GS115, 2: KxP1, 3: KxP1△0259, 4: KxP1::0259. DETAILED DESCRIPTION

[0029] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the following examples and accompanying drawings specifically describe the genes for promoting Pichia pastoris to express foreign proteins, recombinant Pichia pastoris and its construction method, and the method for efficiently expressing recombinant proteins of the present invention.

[0030] Example 1

[0031] This example provides a gene that promotes Pichia pastoris to express exogenous proteins. The gene is recorded as gene PAS_chr3_0259, and its gene sequence is shown in Seq No. 1. The specific sequence is as follows:

[0032] AAGTAGCAGTGAAACTAAAAGGCACTCTTCCACAAAATCAAAGCACC

[0033] CATCACCTCAAAAATCTCAATTGATGCGAAGACTTCTCGCCTTATTTGATCT

[0034] TGCGTAGCATTGCTACAGGTAGGAAAATTCCAAACTTTATTTTTTCTTCCAA

[0035] TCAGTCCTCTTAGTGTGAAATGTGTCACCCTAATTAACCCTGTCCAGCATAT

[0036] GGGACGATTCGCTAATCGCGGCTACGATGTCCCCCATTTTGGCTAGCGCTCT

[0037] CCGCTTTTTTAAGAGTGGAGAACAGAAATCTACCGTCAACCGCCTCCTCCT

[0038] TTTGATAACCACATGTATTAAGTAAGAATTTTCTAATATTCTTTTACCAAATT

[0039] CTACAAGTTCATTGTCCGATCCCACTGATACTTTGCGCCTCATCCGTAACTT

[0040] TCAATGGGTCCTCAGAAAAGATACATTTGTTCCTTCTGTGCTAAGGCTTTTT

[0041] CACGGTCTGAGCATAAGCTCCGTCATGAACGTTCTCATACGAAGGAGAAGC

[0042] CTTTTGTCTGCAATGTCTGCGATAATTCCTTTGTTCGAAGAGATTTGCTGCA

[0043] ACGGCATTGTCGAACTGTTCATGGAATGCTTTTGAAGGAAAACATCGATGC

[0044] CGCGGTGAATATAAAGCAATACGCAACAGGATTGGCTGAGAGTTCAGCAA

[0045] ACGATCTGGTTGAACCAAGTCCCAGTCAGAATCCAACCCTAAACACTCCCA

[0046] GCTCGGTTCCTGTTGGTGATTCGTTTCTGGAAAAAAATATCATCTCTTTATTA

[0047] ACGTTATGCAAGAAATTTAGCCAGGTATCAATTGATCTACAGTTAGACAATA

[0048] ACATTTCTGGGTATCTGTTAACTTATTGCAATAATTTTCAGTTTCGCCCTGAG

[0049] TACCCTTCATTCTTCAAAGTGTTTGATACTTCGTCGACTGTGAACCCTTCTC

[0050] CGGAGCCGTTTTCAAGCCATTTTCTGACTAATTCCAGTTCAACGTCATCCAG

[0051] GTTTTTAAGCCTAGATGGAAATAGTGAATTCCTTTATTTAATTATCTGTCTAG

[0052] GGGCTTGTGAACAATCACAATCTTTGGATGCAATCAAGCTATTTAACAAGA

[0053] GTTGGGCAATAATAATCAATAAAATATCAAATCAATTAATTAATTACAACAGT

[0054] GACAACTTTTCAGAATTCCATCGAGAACTTGATCCTCTTATGTTTCATCTATCT

[0055] CAATTATTTTGCAAATCATGACTTTGAGGATATTGATAATCACAACATTGACC

[0056] ACGACAATATAAACATTGTTCTACCATGTCCAGTTATAACGTTGGATGTCTT

[0057] GTTCGAATACCTTAACAATATTATTAGCACGCATATTAATAACAATTCCTCCA

[0058] ATCCATTGGAAACGGTTGAACCTTTCTATTGGTATGCGTATGTGCTGCTGTC

[0059] GAAATACTCGTTCATCTATAACAAATCACCTTCATCATTGCATATGTTCCTAG

[0060] CTGACAAGTTTCTTCCGAATACTCAGGTCACTATGGCTCAATTACTAAGGAA

[0061] TTTATTCAGTTACTTCGTTAACTGACCAGCCTGAAACAATTGTTTCACAATTG

[0062] GAATATTCACAGGATGACATTTCCAAAAATGTGTTCTTGAATAATATGAATCT

[0063] AGTTGTCAATCACAGAATTAGCAACATTGAGCAAACGCTCATATGTGCGCT

[0064] TTTGAATGAACTACAGATGATCAAATTCAATGATAACCAAATTAGAAAATCC

[0065] ACCTCCAAAATTCAACATGGTATTTTCAATGACAGCAAAAACTTTCTTCAC

[0066] AACGCAATTATTCTAGCTAACAAATCGTTCAACAATATTTACAACGCAGTGA

[0067] GTGATGATCCAGGAAGTTCAGCTCTTCCTTCAGGGAAAGAAACGTCATTCA

[0068] ATGACTCAGTCGGTGCAACCGCAGTGAATATCATACAGGAGAATAACAAAG

[0069] GCAAGCTGGAGGCTAATTACCCACCAAGTAGTAGCAGACCTGATGAATAACA

[0070] ACAAAATTTGTAGAGTTTGTCAATTCATTGATTCTCAACAAGAAGAAACTGC

[0071] TTATCAATTGTCCACTGAAGTTCCATGACCTGCTATTCAATTACCTTTTTTTG

[0072] CCTTTGCAGGATTACAACTGGGTTCTGGCTGTCTTTAACATTGAAAGACTTCA

[0073] TGTATGAAGTGGAATCTTTATACAACACTTTAACGTCCACCAGTCAACATGT

[0074] CCCATCAGAAATGCGGAATTTGATATTGCCAAGTTTTGTCATTCTTCGTTG

[0075] ACTGTTCCAGACATCAAATCAAACTTGGAAGGTTCATTTTTCATCCATTTA

[0076] ACAAGATGCTAGTTGTGAATAACAACCTTGGCTTGACAACCCTGCCTTTGC

[0077] TATTTATCTCACTAATTTACAATAACAAACAAAGCTTTGCGAGTATCAAGT

[0078] GTTTTTAAGTCTTCCTAGTAACAAACTTTTACTGCTGGGTTTATCATCGGA

[0079] AATTTCCTGCTTCTTATTAGGATACTAGTACAAAGACGAATTTCTTACAGTTC

[0080] GCAAGTTGTGGAAGATACAGAGGAAGACACACCTATCCTGAATGTTATTAT

[0081] CTATCTAATTAGTGAACTGGGATCTGGTTTTCTGCTATTCATAATTCAGAGG

[0082] GGCATAAGAATAGGAGTTATTCCATCACCATTGGAATCCTTCAAAGTCAAGT

[0083] TCAACAAAGCAAGCAAAGAGGCTCTGGATCCAAAATATATGTTGGTT

[0084] CAGAAAACGACCTTGATGTGTCTGGAATGACTTTGCAACAAATTCTTACTA

[0085] ATGATGACTTGTACAAATTTATACTTCAAAACATTGAGAAATCTCTTATCAAT

[0086] TGGATCAGCATTCTGGTATCCATTCAAATGTCTACAACAAACTTAATATTGG

[0087] CACTGAATGTAGTGATGAAGTCGATTTATGCCAGTGCTGCAATGGAGAAGT

[0088] TTAACGGTGCGGCCAATAAATCACCAACCAACTTCAATAACAATCACAACA

[0089] ACAACAACGCTCTTGATTTAGCGACTTATCAGACTAATGTTCAAGCCTG

[0090] TGGTTGAACATGAATCTTCGGCACAAGATTTACCCAATAAGAGAATCCGCC

[0091] TTCCGCCTATCTTACAGTCACCAATCCCAGGATCTAAGGACGCTGACTATAT

[0092] GGTTAATGGTGGGAATGCAAATAACGGTAAACAGGATGGCCTTTTATGGGG

[0093] GTTTAATTAGATTTATTGGGACTATCATAAGTGTTTAATTATTGTTCTTCTATG

[0094] CTCAAATGAATCAAAGCCACGAATGTTCCGGTCCGTCAACTCGGCTATCTT

[0095] TCTTATTCTCAGCGGCAGCATTATTCTTCAAAACTTCCATAAAGGAAGAATA

[0096] GATATGATCCAAATCGTTCAAGTCGACAATTGCATCAGGTCGTAGAGTGAAT

[0097] ATGATTTGACGAAATGCATGAGTCTTGACAACATCTATACTTAGTTTCTGCT

[0098] CAGTCAGAAATCTCATGATATCTTTATGGAACTTCATTTGAGAGTAAGGGGA

[0099] AATATCGAACTCACTCAATAGATGTTGGGGAACGTGAGCCAAACCGCCAAC

[0100] TGGAACCACATTGGGCCTAGGACCGTTGTTGTTATTGTTAACTTGATTATTG

[0101] CTGACC。

[0102] The amino acids encoded by gene PAS_chr3_0259 are recorded as PAS_chr3_0259 encoded protein, and its sequence is shown in SeqNo.2, which is as follows:

[0103] MGPQKRYICSFCAKAFSRSEHKLRHERSHTKEKPFVCNVCDNSFVRRDLLQRHCRTVHGMLLKENIDAAVNIKQYATGLAESSANDLVEPSPSQNPTLNTPSSVPVGDSFLEKNIISLLTLCKKFSQVSIDLQLDNNISGYLLTYCNNFQFRPEYPSFFKVFDTSSTVNPSPEPFSSHFLTNSSSTSSRFLSLDGNSEFLYLIICLGACEQSQSLDAIKLFNKSWAIIINKISNQLINYNSDNFSEFIENLILLCFIYLNYFANHDFEDIDNHNIDHDNINIVLPCPVITLDVLFEYLNNIISTHINNNSSNPLETVEPFYWYAYVLLSKYSFIYNKSPSSLHMFLADKFLPNTQVTMAQLLRNLSVTSLTDQPETIVSQLEYSQDDISKNVFLNNMNLVVNHRISNIEQTLICALLNELQMIKFNDNQIRKSTSKIQHGIFNDSKNFLHNAIILANKSFNNIYNAVSDDPGSSALPSGKETSFNDSVGATAVNIIQENNKGKLEANYPPKVADLMNNNKFVEFVNSLILNKKKLLINCPLKFHDLLFNYLFLPLQDYNWVLLSLTLKDFMYEVESLYNTLTSTSQHVPSENAEFDIAKFCHSSLTVPDIKSNLEKFIFHPFNKMLVVNNNLGLTTLPLLFISLIYNNKQSFASIKSFLSLPSNKLLLLEFIIGNFLLLIRILVQRRISYSSQVVEDTEEDTPILNVIIYLISELGSGFSAIHNSEGHKNRSYSITIGILQSQVQQSKSKKSSGSKKYVGSENDLDVSGMTLQQILTNDDLYKFILQNIEKSLINWISILVSIQMSTTNLILALNVVMKSIYASAAMEKFNGAANKSPTNFNNNHNNNNALDLATYQTNVQKPVVEHESSAQDLPNKRIRLPPILQSPIPGSKDADYMVNGGNANNGKQDGLLWGFN。

[0104] The characteristics of the protein encoded by PAS_chr3_0259 are as follows: >tr|C4R410|C4R410_KOMPG C2H2-typedomain-containing protein (domain-containing protein) OS=Komagataella phaffii (Phaffia form yeast) (strain GS115 / ATCC 20864) OX=644223 GN=PAS_chr3_0259 PE=4SV=1.

[0105] This embodiment also provides a method for efficiently expressing recombinant proteins. The method uses the xylanase gene (xynB) of Aspergillus niger ATCC1015 as a reporter gene, transforms the alcohol oxidase 1 promoter and the xynB gene into Pichia pastoris, and co-expresses the PAS_chr3_0259 encoded protein to obtain recombinant Pichia pastoris, and the recombinant Pichia pastoris is used to express the recombinant protein-xylanase.

[0106] Among them, the gene sequence of the xynB gene is shown in Seq No.3, and is as follows:

[0107] .

[0108] The method for efficiently expressing recombinant protein in this embodiment specifically comprises the following steps:

[0109] (1) Construction of xylanase expression plasmid pPIC9K-xynB

[0110] The plasmid pPICZαA-xynB was used as a template and the primers XynB-F / R (XynB-F: 5'-gtatctctcgagaaaagatcgaccccgagctcgaccg-3' (Seq No.4), XynB-R: 5'-attaattcgcggccgcttactgaacagtgatggacgaag-3' (Seq No.5)) were used to amplify the xynB gene. The reaction conditions were as follows: 94°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 54°C annealing for 15 s, 72°C extension for 40 s, for a total of 30 cycles; and finally 72°C extension for 10 min. The PCR amplification system is shown in Table 1.

[0111] Table 1

[0112]

[0113] The amplified xynB gene fragment was verified by agarose gel electrophoresis and then Gel DNA Extraction Mini Kit Vazyme Cat Instruction Manual (Nanjing Novozyme Biotechnology Co., Ltd.) was used for recycling.

[0114] The plasmid pPIC9K was digested with restriction endonuclease NotI according to Table 2. The digestion product was verified by agarose gel electrophoresis and then the high molecular weight plasmid backbone fragment was recovered using a DNA gel purification recovery kit (Nanjing Novogene Biotech Co., Ltd.).

[0115] Table 2

[0116]

[0117]

[0118] Prepare the In-fusion seamless cloning reaction system on ice according to Table 3, connect the purified xynB gene fragment and the linearized plasmid at 37°C for 30 minutes, add the connection product to 0.1mL E. coli TOP 10 competent cells, and gently rotate the centrifuge tube to mix. Let it stand on ice for 30 minutes, bathe in 42°C water for 60-90 seconds, and cool in an ice bath for 2-3 minutes. Be careful not to shake the centrifuge tube during the process. Add 0.9mL of sterile LB medium to the centrifuge tube and mix it by pipetting. Cultivate at 37°C and 200rpm for 45 minutes to revive the bacteria. Pipette 100μL of the transformed bacteria and spread it on the LB plate containing 100μg / mL ampicillin antibiotic (Amp), and let it stand and culture at 37°C for 12-16h.

[0119] Table 3

[0120]

[0121] Several E. coli transformants were selected and inoculated into liquid LB containing 100 μg / mL Amp for overnight culture. 1 μL of bacterial solution was taken as a template, and YZ-F / R (YZ-F: 5'-cacgaggccctttcgtcttc-3' (Seq No.6), YZ-R: 5'-aatgaagcctgcatctctcagg-3' (Seq No.7)) was used as primers for colony PCR verification. The verification reaction system is shown in Table 4. After the fragment length was verified by agarose gel electrophoresis, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After successful sequencing and alignment, the recombinant plasmid pPIC9K-xynB was obtained.

[0122] Table 4

[0123]

[0124] (2) Construction of plasmid pPICZA-△0259 for knocking out the PAS_chr3_0259 gene

[0125] Firstly, the Pichia pastoris genome was used as a template, and 0259UP-F / R (0259UP-F: 5'-cttccaactaaaaccgcggccgccacggaccagtattacctt-3' (Seq No.8), 0259UP-R: 5'-ggtgtgtgggggatctgaaagttacggatgaggcgcaaag-3' (Seq No.9)) and 0259DOWN-F / R (0259DOWN-F: 5'-tcatgagatcagatcatttattgggactatcataagtgtttaattattgttcttctatg-3' (Seq No.10), 0259DOWN-R: 5'-taatactggtccgtggcggccgcggttttagttggaagtgtttagtgtgagc-3' (Seq No.11), No.11)) was used as primer to amplify the upstream and downstream fragments of the PAS_chr3_0259 gene. The amplification system is shown in Table 1 and recovered after verification by agarose gel electrophoresis. Then, the above two fragments were overlapped and extended with primers 0259DOWN-F / 0259UP-R, and the upstream and downstream fragments of the PAS_chr3_0259 gene were recovered after verification by agarose gel electrophoresis. Plasmid pPICZA was double-digested with BglII and BamHI, and the double-digestion system is shown in Table 5. After seamless cloning and connection of the digestion product and the upstream and downstream fragments of the PAS_chr3_0259 gene, it was transferred into Escherichia coli competent cells, coated on an LB plate containing 25 μg / mL bleomycin, and single colonies were cultured overnight. Several transformants were picked and the upstream and downstream fragments of the PAS_chr3_0259 gene were verified by colony PCR using primers 0259DOWN-F / 0259UP-R. The verification system is shown in Table 4. The successfully verified transformants were sequenced and aligned to obtain the recombinant plasmid pPICZA-△0259.

[0126] Table 5

[0127]

[0128] (3) Construct P AOX1 Plasmid pPICZA-0259-His4 driving the expression of PAS_chr3_0259 gene

[0129] The PAS_chr3_0259 gene was amplified using the Pichia pastoris genome as a template and primers ZA-0259-F / R (ZA-0259-F: 5'-gtctcggatcggtacctcgaatgggtcctcagaaaagatacatttgttcc-3' (Seq No. 12), ZA-0259-R: 5'-tcgggcccaagctggcggccctaattaaacccccataaaaggccatcc-3' (Seq No. 13)). The amplification system is shown in Table 1. The amplified product was verified by agarose gel electrophoresis and the PAS_chr3_0259 gene fragment was recovered. Plasmid pPICZA was double-digested with XhoI and NotI. The double-digestion system is shown in Table 6.

[0130] Table 6

[0131]

[0132]

[0133] The digested product and the amplified product PAS_chr3_0259 gene fragment were seamlessly cloned and connected into E. coli competent cells, spread on LB plates containing 25 μg / mL bleomycin, and cultured overnight to obtain single colonies. The transformants were verified by primers 0259-YF / R (0259-Y: 5'-gcgactggttccaattgacaag-3' (Seq No. 14), 0259-R: 5'-gcttgaaaacggctccggag-3' (Seq No. 15)) to obtain the recombinant plasmid pPICZA-0259. Using pPIC9K plasmid as template, 0259-His4UP-F / R (0259-His4UP-F: 5'-aaactgggacttatttaagcggccgcatgacatttcccttgctacctgcatac-3' (Seq No. 16), 0259-His4UP-R: 5'-tcgtctttggatgttagatctttaggcatcttcaatttcttgtgaggaggc-3' (Seq No. 17)) and 0259-His4DOWN-F / R (0259-His4DOWN-F: 5'-tttggtcatgagatcagatcttcgtcgtcctatccagaaaacggaac-3' (Seq No.18), 0259-His4DOWN-R:5'-gggaaatgtcatgcggccgcttaaataagtcccagtttctccatacgaaccttaac-3'(Seq No.19)) were used as primers to amplify the upstream and downstream fragments of the His4 gene, and then 0259-His4DOWN-F / 0259-His4UP-R were used as primers to perform overlap extension amplification on the upstream and downstream fragments of the His4 gene. The amplified product was seamlessly cloned and connected with the BglII-digested plasmid pPICZA-0259, transformed into Escherichia coli competent cells, spread on LB plates containing 25 μg / mL bleomycin, and cultured overnight to obtain a single colony. Several transformants were selected and the His4 gene fragment was verified by colony PCR using primers 0259ZA-YF / R (0259ZA-YF: 5'-gcaagcagcagattacgcg-3' (Seq No. 20), 0259ZA-YR: 5'-caggaacacccagcatcagg-3' (Seq No. 21)). The successfully verified transformants were sequenced and aligned to obtain the recombinant plasmid pPICZA-0259-His4.

[0134] (4) Construction of recombinant Pichia pastoris KxP1△0259, KxP1 and KxP1::0259

[0135] Electroporation of Pichia pastoris: Take out 80 μL of competent cells frozen at -80°C and thaw on ice. Add 10-20 μg of linearized plasmid, gently pipette to mix, and let stand on ice for 15 minutes. Precool the electroporation cup on ice for 5 minutes. Quickly transfer the competent cells and linearized plasmid mixture into the electroporation cup and let stand on ice for 5 minutes. After electroporation on the electroporator, quickly take it out and place it on ice, quickly add 1mL, 1mol / L ice-cold sorbitol to recover, and gently pipette to mix. Let the bacterial solution stand at 30°C for 1-2 hours. Pipette 100 μL of the transformed bacterial solution and spread it on the corresponding resistance plate or selective plate, and let it stand at 30°C for 2-5 days.

[0136] Plasmid pPIC9K-xynB was digested with SalI, and the digestion system is shown in Table 7. The linearized plasmid pPIC9K-xynB was transformed into Pichia pastoris K. phaffii competent cells by electroporation technology and spread on MD plates. After colony PCR verification, recombinant Pichia pastoris KxP1 expressing xynB was obtained.

[0137] Table 7

[0138]

[0139] Plasmids pPICZA-△0259 and pPICZA-0259-His4 were digested with NotI, and the digestion system is shown in Table 2. The linearized pPICZA-△0259 and pPICZA-0259-His4 plasmids were electroporated into recombinant Pichia pastoris KxP1 competent cells, spread on YPD plates containing 100 μg / mL bleomycin, and verified by colony PCR, the recombinant Pichia pastoris strain KxP1△0259 with the PAS_chr3_0259 gene knocked out and the recombinant Pichia pastoris strain KxP1::0259 with the alcohol oxidase promoter 1 co-expressing the PAS_chr3_0259 gene were obtained.

[0140] (5) Recombinant Pichia pastoris culture

[0141] The recombinant Pichia pastoris KxP1, KxP1△0259 and KxP1::0259 strains frozen at -80°C were streaked on plates containing the corresponding antibiotics and incubated upside down at 30°C for 2 days to grow single colonies. The recombinant strains were picked and inoculated into 50 mL of liquid YPD and cultured at 30°C and 200 rpm for 18-24 h until the OD 600 The inoculum was 4.0-6.0, and the seed solution was obtained. 15 mL of BMGY medium (10 g / L yeast powder, 20 g / L peptone, 100 mmol / L potassium phosphate buffer pH 6.0, 13.4 g / L yeast nitrogen source medium, 4 × 10-4 g / L, glycerol 10g / L) in a 50mL centrifuge tube and cultured for 48h until glycerol was exhausted, 1% methanol was added for induction, and then methanol was added every 24h to induce the recombinant Pichia pastoris to express xylanase. Before each addition of inducer, the fermentation broth was fully pipetted and mixed, and samples were taken. Three parallel experiments were set for the culture of each recombinant strain. The samples were used to detect the cell concentration, xylanase activity and xylanase expression of the recombinant strain.

[0142] (6) Detection of xynB gene expression

[0143] Determination of cell concentration: Take an appropriate amount of fresh fermentation broth and dilute it appropriately, then use an ELISA reader to measure the absorbance OD of the sample at a wavelength of 600 nm. 600 , the measured OD 600 Between 0.2 and 0.8, three sets of parallel data were measured for each sample, cell concentration = OD 600 value × dilution factor.

[0144] Determination of xylanase standard curve: Take appropriate amount of 1mg / mL xylose mother solution and dilute it into standard solution with concentration of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6mg / mL, take 2μL of each concentration mother solution, add 200μL DNS reagent, boil in water bath for 10min, cool in ice bath, add 1.6mL distilled water to 2mL, mix by pipetting, and measure absorbance at 540nm. Set 3 parallels for each concentration standard solution. Draw the standard curve with xylose concentration as the horizontal axis and absorbance at OD540 as the vertical axis.

[0145] Xylanase activity determination: Take an appropriate amount of fresh fermentation liquid in a refrigerated centrifuge, centrifuge at 4°C and 12000g for 5 minutes, take the supernatant and dilute it appropriately, take 2μL of the diluent and mix it with 200μL of xylan solution (the blank group is replaced by deionized water), react at 50°C for 5 minutes, immediately put it on ice and add 200μL of DNS solution in a boiling water bath for 10 minutes, cool it in an ice bath, add 1.6mL of distilled water to 2mL, use an enzyme reader to measure its absorbance at 540nm, and measure three sets of parallel data for each sample. Substitute the measured absorbance value into the standard curve to calculate the xylose mass concentration, and then substitute it into the following enzyme activity calculation formula to calculate the xylanase activity value.

[0146]

[0147] Determination of xylanase expression: Take an appropriate amount of fresh fermentation broth and centrifuge at 4500g for 2 minutes, and collect the supernatant. Add trichloroacetic acid to the sample supernatant at a ratio of 4:1 and freeze at -20℃ for 24 hours. Take out the frozen sample and thaw it on ice, centrifuge it at 4℃ and 3000g for 20 minutes, and discard the supernatant. Add acetone with an equal volume of trichloroacetic acid for bath washing, centrifuge it at 4℃ and 3000g for 8 minutes, and discard the supernatant. Dry the precipitate at 60℃ for 1 hour. Add 30μL deionized water, 10μL Loading Buffer, boil in water bath for 10 minutes, and then centrifuge at 4500g for 5 minutes. The supernatant is the sample. After preparing the SDS-PAGE gel, add the treated samples to the gel wells for electrophoresis in turn, and the sample volume is 20μL. After the electrophoresis, take out the colloid and stain it with Coomassie Brilliant Blue for more than 30 minutes. The colloid was taken out from the staining solution and placed in a destaining solution for overnight destaining until the colloid background was clear, and then the results were photographed using a gel imager.

[0148] The results are as follows Figure 4 As shown, under the induction of 1% methanol, the cell concentrations of recombinant Pichia pastoris KxP1, KxP1△0259 and KxP1::0259 increased from 12.0 OD 600 Increased to 25.6, 23.6 and 24.1 OD 600 Therefore, the knockout or overexpression of PAS_chr3_0259 slightly affected the growth of recombinant Pichia pastoris. Within 144 hours of 1% methanol induction, the xylanase activities of the recombinant strains KxP1, KxP1△0259 and KxP1::0259 reached 1322.0U / mL, 1128.4U / mL and 2093.7U / mL, respectively. The SDS-PAGE polyacrylamide gel electrophoresis of the fermentation supernatants of the three recombinant strains also showed that compared with the control strain KxP1, the xylanase expression of the PAS_chr3_0259 gene knockout strain KxP1△0259 was slightly reduced, while the xylanase expression of the PAS_chr3_0259 gene overexpression strain KxP1::0259 was significantly increased, which was basically consistent with the xylanase activity of the three recombinant strains.

[0149] Therefore, the protein encoded by PAS_chr3_0259 can improve the expression of Pichia pastoris recombinant proteins under the condition of methanol inducer. The co-expression of PAS_chr3_0259 gene driven by the recombinant Pichia pastoris alcohol oxidase promoter 1 can increase the expression level of xylanase by 58.4%, and knocking out the PAS_chr3_0259 gene can reduce the expression level of xylanase by 14.6%.

[0150] Example 2

[0151] In order to prove that the protein encoded by PAS_chr3_0259 can also improve the expression of Pichia recombinant protein under other inducer conditions, the recombinant Pichia KxP1, KxP1△0259 and KxP1::0259 were cultured and induced using formate. The construction of the recombinant strains KxP1, KxP1△0259 and KxP1::0259 and the method for detecting the expression of the xynB gene were the same as in Example 1, and the culture method was also the same as in Example 1, except that the 1% methanol inducer was replaced by 0.2% sodium formate.

[0152] The results are as follows Figure 5 As shown in the figure, under the condition of sodium formate induction, the knockout or overexpression of PAS_chr3_0259 gene had little effect on the growth of recombinant Pichia pastoris. Within 144h of sodium formate induction, the highest xylanase activities of recombinant strains KxP1, KxP1△0259 and KxP1::0259 reached 228.1U / mL, 195.1U / mL and 429.0U / mL, respectively. It can also be seen from the SDS-PAGE polyacrylamide gel electrophoresis of the fermentation supernatant of the three recombinant strains that compared with the control strain KxP1, the expression of xylanase in the PAS_chr3_0259 gene knockout strain KxP1△0259 was slightly reduced, while the expression of xylanase in the PAS_chr3_0259 gene overexpression strain KxP1::0259 was significantly increased, which was basically consistent with the performance of xylanase activity expressed by the three recombinant strains.

[0153] Therefore, the protein encoded by PAS_chr3_0259 can also improve the expression of recombinant proteins in Pichia pastoris under other inducer conditions. Under sodium formate induction, the recombinant Pichia pastoris alcohol oxidase promoter 1 drove the co-expression of PAS_chr3_0259 gene to increase the expression level of xylanase by 88.1%, and knocking out the PAS_chr3_0259 gene reduced the expression level of xylanase by 14.5%.

[0154] Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A gene that promotes Pichia pastoris to express exogenous protein, characterized in that: The gene is recorded as gene PAS_chr3_0259, the gene sequence is shown in Seq No. 1, the amino acid sequence encoded by the gene is shown in Seq No. 2, and the amino acid sequence is recorded as PAS_chr3_0259 encoded protein.

2. A recombinant Pichia pastoris, characterized in that: The invention comprises the gene for promoting Pichia pastoris to express foreign protein as claimed in claim 1.

3. A method for constructing a recombinant Pichia pastoris according to claim 2, characterized in that: Using the xylanase gene of Aspergillus niger as a reporter gene, the alcohol oxidase 1 promoter and the xylanase gene were transformed into Pichia pastoris, and the PAS_chr3_0259 encoding protein was co-expressed to obtain recombinant Pichia pastoris.

4. The method for constructing a recombinant Pichia pastoris according to claim 3, wherein: in, The reporter gene is the xylanase gene of Aspergillus niger ATCC1015, which is denoted as xynB and has a gene sequence as shown in Seq No.

3.

5. The method for constructing a recombinant Pichia pastoris according to claim 3, characterized in that: The following steps are involved: Step S1: Recombining the reporter gene and plasmid pPIC9K to obtain plasmid pPIC9K-xynB; Step S2: Recombining the upstream and downstream fusion fragments of the gene PAS_chr3_0259 with the plasmid pPICZA to obtain the plasmid pPICZA-△0259; Step S3: recombining the gene PAS_chr3_0259 with the plasmid pPICZA, and connecting with the His4 gene to obtain the plasmid pPICZA-0259-His4; Step S4: hydrolyzing the plasmid pPIC9K-xynB with restriction endonuclease Sal I and the plasmid pPICZA-△0259 and the plasmid pPICZA-0259-His4 with restriction endonuclease Not I, respectively, to obtain corresponding linearized plasmid fragments; Step S5: The linearized pPIC9K-xynB plasmid is transformed into Pichia pastoris by electroporation technology to obtain recombinant Pichia pastoris KxP1, and the linearized pPICZA-△0259 plasmid and the linearized pPICZA-0259-His4 plasmid are respectively transformed into the recombinant Pichia pastoris KxP1 to obtain recombinant Pichia pastoris KxP1△0259 and recombinant Pichia pastoris KxP1::0259.

6. The method for constructing a recombinant Pichia pastoris according to claim 5, characterized in that: in, In step S1, the specific process of preparing the plasmid pPIC9K-xynB is as follows: The reporter gene obtained by polymerase chain reaction technology was connected with the plasmid pPIC9K cut with restriction endonuclease Not I to obtain the plasmid pPIC9K-xynB.

7. The method for constructing a recombinant Pichia pastoris according to claim 5, characterized in that: in, In step S2, the specific process of preparing the plasmid pPICZA-△0259 is as follows: The upstream fragment and the downstream fragment of the gene PAS_chr3_0259 were obtained by polymerase chain reaction technology and fused, and the fused fragment was connected with the plasmid pPICZA double-digested with restriction endonucleases Bgl II and BamH I to obtain the plasmid pPICZA-△0259.

8. The method for constructing a recombinant Pichia pastoris according to claim 3, characterized in that: in, In step S3, the specific process of preparing the plasmid pPICZA-0259-His4 is as follows: The gene PAS_chr3_0259 fragment was obtained by polymerase chain reaction technology, and the fragment was connected to the pPICZA plasmid double-digested with restriction endonucleases Xho I and Not I. The recombinant plasmid was then digested with Bgl II and connected to the His4 fragment obtained by polymerase chain reaction technology to obtain the plasmid pPICZA-0259-His4.

9. A method for efficiently expressing a wood recombinant protein, characterized in that: The recombinant Pichia pastoris of claim 2 is placed in a culture medium for cultivation, and methanol or formate is added after the cultivation to induce the recombinant Pichia pastoris to express the recombinant protein.

10. The method for efficiently expressing recombinant protein according to claim 9, characterized in that: in, The concentration of the methanol is 0.5-3%, The concentration of the formate is 0.2-1.5%, The culture medium is BMGY culture medium, which includes 10 g / L yeast powder, 20 g / L peptone, 100 mmol / L potassium phosphate buffer pH 6.0, 13.4 g / L yeast nitrogen source culture medium, 4×10 -4 g / L and glycerol 10g / L, and the culture time was 2 days.

Images