Genetically engineered bacterium for producing gibberellin GA4+7 as well as construction method and application thereof

Abstract

The invention provides a genetically engineered bacterium for producing gibberellin GA4 + 7 as well as a construction method and application of the genetically engineered bacterium. According to the genetically engineered bacterium, a CRISPR-Cas9 gene editing technology is adopted, a truncated mevalonyl coenzyme A reductase encoding gene tHMGR is inserted into a P450-3 gene locus in a Fusariumfujikuroi genome of a chassis bacterium, and POT1, FOX1 and FAA1 genes are further inserted into a fsr1 locus, a fsr3 locus and a fsr4 locus respectively, so that the reinforcement of a beta oxidation pathway is realized. The genetically engineered bacterium improves the supply capacity of a precursor acetyl CoA in the process of producing gibberellin GA4 + 7, and the yield of GA4 + 7 after fermentation of a fermentation medium for 168 hours reaches 2.66 g / L and is improved by 443.33% compared with the yield of an original strain GA4 + 7.

Description

Technical Field

[0001] The present invention belongs to the field of metabolic engineering, and specifically relates to a method for producing gibberellin GA 4+7 Genetically engineered bacteria and their construction methods and applications. Background Art

[0002] Gibberellic acid GA 4+7 It is a tetracyclic diterpenoid compound with the molecular formula C 19 H 22 O5 is a white crystalline powder, easily soluble in methanol, ethanol, acetone, and alkaline solution, slightly soluble in ethyl acetate, and insoluble in chloroform. 4+7 It is an improved version of "920", which is more efficient, more stable and safer. It can significantly promote the growth of plant stems and leaves, especially for genetic and physiological dwarf plants.

[0003] Gibberellic acid GA 4+7 As a tetracyclic diterpenoid, it is generated from acetyl CoA through the mevalonate pathway and a series of enzymes. Therefore, acetyl CoA is the most important precursor. More acetyl CoA can be obtained by β-oxidative decomposition of fatty acids. Fatty acids are activated to acyl CoA under the catalysis of acyl CoA synthetase, and acyl CoA is catalyzed to generate α, β-enoyl CoA under the catalysis of acyl CoA dehydrogenase. Enoyl CoA is added under the catalysis of hydratase to generate β-hydroxyacyl CoA, and then β-ketoacyl CoA is generated under the catalysis of β-hydroxyacyl CoA dehydrogenase. Finally, butyryl CoA is generated under the catalysis of thiolase, and finally acetyl CoA is generated.

[0004] Gibberellic acid GA 4+7 The structure of gibberellins is relatively complex, and the chemical synthesis of gibberellins has many steps and is prone to produce by-products during the reaction process. The requirements for separation and purification are extremely high, making it difficult to use it for the industrial production of gibberellins. The main industrial production method of gibberellins is currently the microbial deep fermentation method, which has the advantages of easy extraction and separation of products and a simple and controllable fermentation process. However, the natural synthesis ability of industrial production strains is low, and the genetic modification of filamentous fungi is difficult, resulting in a long culture cycle for the synthesis of gibberellins by existing strains, high fermentation energy consumption, and low production titer, which seriously restricts the development of the industry. Therefore, modern genetic engineering technology and metabolic engineering modification methods are considered to be efficient microbial breeding methods. At present, the production of gibberellins by biological fermentation still has problems such as low fermentation yield. Summary of the invention

[0005] In order to solve the problem of producing gibberellin GA by biological fermentation in the prior art 4+7 The invention provides a method for producing gibberellin GA. 4+7The invention uses Fujikura Gibberella as the base bacteria, and transforms the key genes in the β-oxidation pathway through metabolic engineering technology to enable it to efficiently produce gibberellin GA. 4+7 .

[0006] The technical solution adopted by the present invention is: producing gibberellin GA 4+7 The method for constructing a genetically engineered bacterium comprises: using CRISPR-Cas9 gene editing technology to insert and overexpress the tHMGR gene at the P450-3 gene site in the genome of the chassis fungus Fusariumfujikuroi, thereby enhancing the expression of key genes in the β-oxidation pathway, and constructing a gene that produces gibberellin GA 4+7 of genetically engineered bacteria.

[0007] The key gene of the β-oxidation pathway is selected from at least one of the POT1 gene, FOX1 gene, FOX2 gene, FAA1 gene, FAA2 gene and PXA1 gene, preferably at least one of the POT1 gene, FOX1 gene and FAA1 gene.

[0008] The method for enhancing the expression of key genes in the β-oxidation pathway comprises: inserting one or more of the key genes in the β-oxidation pathway into the fsr gene site; wherein the fsr gene is selected from at least one of the fsr1 gene, fsr2 gene, fsr3 gene, fsr4 gene, fsr5 gene and fsr6 gene, preferably at least one of the fsr1 gene, fsr3 gene and fsr4 gene.

[0009] Currently used in GA 4+7 Industrial production is carried out by using Fusarium fusogenum as the production strain for liquid submerged fermentation. Figure 1 In Fusarium fujikura, GA 4+7The synthesis site is in the cytoplasm, where fatty acids are activated to acyl CoA under the catalysis of acyl CoA synthetase, acyl CoA generates α, β-enoyl CoA under the catalysis of acyl CoA dehydrogenase, enoyl CoA generates β-hydroxyacyl CoA under the catalysis of β-hydroxyacyl CoA dehydrogenase, and finally generates butyryl CoA under the catalysis of thiolase, and finally generates acetyl CoA. After that, isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) are produced through the mevalonate (MVA) pathway. IPP and DMAPP can be condensed into geranyl diphosphate (GPP), farnesyl diphosphate (FPP), geranyl diphosphate (GGPP) and geranyl farnesyl diphosphate (GFPP) under the catalysis of enzymes, and then further catalyzed by various oxidases and cyclases to form gibberellins GA4+7. Therefore, the present invention uses CRISPR-Cas9 gene editing technology to guide the Cas9 protein to accurately cut the P450-3 encoding gene of the metabolic pathway in the chassis strain Fusarium fujikuroi CCTCCNO:M 2019378 through the positioning of sgRNA, create a double-strand break gap on the genome, introduce the meglutaryl-CoA reductase catalytic region encoding gene tHMGR during repair, and use the technology to integrate POT1, FOX1, and FAA1 genes at the fsr1, fsr3, and fsr4 sites respectively to achieve the enhancement of the β-oxidation pathway, thereby constructing a high-yield Fusarium fujikuroi genetically engineered bacterium CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1 / Δfsr1::POT1 / Δfsr3::FOX1 (denoted as strain FF9), which is effective in producing gibberellin GA 4+7 The process improves the supply of precursor acetyl CoA. After 168h of fermentation, GA 4+7 The yield reached 2.66g / L, compared with the bottom plate bacteria GA 4+7 The yield (600 mg / L) increased by 443.33%.

[0010] Preferably, the tHMGR gene and the key genes of the β-oxidation pathway are constructed in a eukaryotic expression cassette having a promoter and a terminator; wherein the promoter is selected from the endogenous promoter Pdes of Gibberella fujikura (the nucleotide sequence is shown in SEQ ID NO.4) or the endogenous promoter Pggs2 of Gibberella fujikura (the nucleotide sequence is shown in SEQ ID NO.5), and the terminator is selected from the terminator Ttef1 derived from Aspergillus nidulans (the nucleotide sequence is shown in SEQ ID NO.6) or the terminator TglaA derived from Aspergillus niger (the nucleotide sequence is shown in SEQ ID NO.7).

[0011] Preferably, the bottom plate fungus is Fusariumfujikuroi CCTCC NO:M 2019378.

[0012] As preferably, the production of gibberellin GA 4+7 The method for constructing a genetically engineered bacterium comprises: using CRISPR-Cas9 gene editing technology, inserting and overexpressing the tHMGR gene at the P450-3 gene site, inserting the POT1 gene at the fsr1 gene site, inserting the FOX1 gene at the fsr3 gene site, and inserting the FAA1 gene at the fsr4 gene site in the genome of the chassis fungus Fusariumfujikuroi CCTCC NO:M 2019378, so as to construct a gene that produces gibberellin GA 4+7 of genetically engineered bacteria. Wherein, the amino acid sequence of the FAA1 gene is shown in SEQ ID NO.1, the amino acid sequence of the FOX1 gene is shown in SEQ ID NO.2, and the amino acid sequence of the POT1 gene is shown in SEQ ID NO.3. It should be noted that, due to the particularity of the amino acid sequence, any fragment or variant of the peptide protein containing the amino acid sequence shown in the present invention, such as its conservative variant, biologically active fragment or derivative, as long as the fragment or variant of the peptide protein has a homology of more than 90% with the aforementioned amino acid sequence, all belong to the scope of protection of the present invention. Specifically, the changes include deletion, insertion or substitution of amino acids in the amino acid sequence; wherein, for the conservative changes of the variant, the replaced amino acid has a similar structure or chemical property to the original amino acid, such as replacing leucine with isoleucine, and the variant may also have non-conservative changes, such as replacing alanine with glycine.

[0013] The present invention also provides the gibberellin GA produced by the method. 4+7 of genetically engineered bacteria.

[0014] As preferably, the production of gibberellin GA 4+7 The genetically engineered bacteria is any of the following:

[0015] (1) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr1::POT1;

[0016] (2) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr2::FOX2;

[0017] (3) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr3::FOX1;

[0018] (4) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1;

[0019] (5) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr5::FAA2;

[0020] (6) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr6::PXA1;

[0021] (7) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1 / Δfsr1::POT1;

[0022] (8) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1 / Δfsr1::POT1 / Δfsr3::FOX1.

[0023] The present invention also provides the method for producing gibberellin GA 4+7 Genetically engineered bacteria in microbial fermentation to produce gibberellin GA 4+7 Application in.

[0024] As a preferred application, the application comprises: producing gibberellin GA 4+7 The genetically engineered bacterial strain is inoculated into a fermentation medium and cultured at 25-35° C. and 200-300 rpm for 5-15 days.

[0025] Preferably, the fermentation medium comprises: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean flour, 10-30 g / L peanut flour, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, and the solvent is water.

[0026] Beneficial effects of the present invention: The present invention provides a high-yield GA 4+7 The modified Fujikura Gibberella has improved the GA 4+7The supply of acetyl CoA, the precursor in the synthesis process, enables GA to be produced more efficiently compared to the starting strain. 4+7 The fermentation production was realized, and the yield was increased from 600 mg / L to 2.66 g / L, providing a feasible route for the construction of engineering strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Fusarium fujikura GA 4+7 Node graph of the compositing path.

[0028] Figure 2 GA in the embodiment of the present invention 4+7 Liquid phase spectra of specimen, fermentation solution of chassis bacteria WT, fermentation solution of strain FF1, and fermentation solution of strain FF9. DETAILED DESCRIPTION

[0029] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0030] Example 1: Construction and production of gibberellin GA 4+7 Genetically engineered bacteria

[0031] Construction of tHMGR overexpressing strain FF1

[0032] (1) Construction of tHMGR gene overexpression vector

[0033] The CRISPR-Cas9 system was used to knock out the P450-3 gene in Fusarium fujikura and overexpress the tHMGR gene. First, the sgRNA-ΔP450-3-1 fragment was amplified by PCR using primers 1 and 2 and the sgRNA expression frame as a template. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The sgRNA-ΔP450-3-2 fragment was amplified using primers 3 and 4 in the same way. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The two purified DNA fragments were subjected to fusion PCR using primers 1 and 4. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. Primers 5 and 6 were used to amplify the upstream homologous fragment of the P450-3 gene using the genome of Fusarium fujikuroi CCTCC NO:M 2019378 as a template. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The downstream homologous fragment of the P450-3 gene was amplified using primers 7 and 8 in the same way. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, repeated for 32 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The pFC332-Ffcas9 vector was used as a template and connected by a one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Novozyme) to construct a pFC332-Ffcas9-ΔP450-3 plasmid vector capable of expressing the target gene P450-3. The ligation product was transformed into E. coli DH5α recipient bacteria, spread on LB solid plates containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. Single colonies were picked and transferred to LB liquid culture medium containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. The bacteria were collected to extract the plasmid and the plasmid was linearized using the rapid endonuclease PacⅠ (purchased from Beijing Langbolide).The des promoter sequence (its nucleotide sequence is shown in SEQ ID NO.4) was amplified by PCR using primers 9 and 10 with the genome of Fusariumfujikuroi CCTCC NO:M 2019378 as template, and the tef1 terminator sequence (its nucleotide sequence is shown in SEQ ID NO.6) was amplified by primers 11 and 12 with the genome of Aspergillus nidulans as template. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The des promoter fragment and the tef1 terminator were connected to the plasmid linearized by the rapid endonuclease PacⅠ by using the one-step cloning kit ClonExpress IIOne Step CloningKit (purchased from Nanjing Novozyme).

[0034] An expression vector containing a gene expression cassette containing a des promoter fragment and a tef1 terminator fragment was constructed in pFC332-Ffcas9-ΔP450-3. The ligation product was transformed into E. coli DH5α recipient bacteria, spread on an LB solid plate containing ampicillin resistance at a final concentration of 100 mg / L, cultured at 37°C for 12 hours, and then a single colony was picked and placed in an LB liquid medium containing ampicillin resistance at a final concentration of 100 mg / L, cultured at 37°C for 12 hours, and the bacterial cells were collected to extract the plasmid and the plasmid was linearized using the rapid endonuclease PacⅠ (purchased from Beijing Langbolide).

[0035] In order to obtain highly expressed megaloyl-CoA reductase, the truncated tHMGR from Fusarium fujikuroi was overexpressed. The catalytic region sequence of megaloyl-CoA reductase was amplified by PCR using primers 13 and 14 respectively with the genome of Fusarium fujikuroi CCTCC NO: M2019378 as the template. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃60s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The DNA fragment was ligated into the plasmid pFC332-Ffcas9-ΔP450-3-Pdes-Ttef1 treated with rapid endonuclease PacⅠ by one-step cloning kit ClonExpress IIOne StepCloning Kit (purchased from Nanjing Novozyme). The ligation product was transformed into E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 h. A single colony was picked and transferred to an LB liquid culture medium containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 h. The bacteria were collected and the plasmid was extracted to obtain the plasmid pFC332-Ffcas9-ΔP450-3::Pdes-tHMGR overexpressing Gibberella fujikuraensis tHMGR.

[0036] (2) Protoplast transformation of Gibberella fujikura and identification of transformants

[0037] Fusariumfujikuroi CCTCC NO:M 2019378 preserved in a glycerol tube was inoculated into YPD medium and cultured at 28°C and 220rpm for 2 days. After the culture, 1g of mycelium was collected using a Buchner funnel and enzymatically hydrolyzed for 3h using an enzyme solution (Yatalase 1%, snail enzyme 0.5%, and lysozyme 0.5%) at 120rpm and 30°C. The protoplast fluid was filtered, and the filtrate was centrifuged at 4°C and 2700rpm for 10min, the supernatant was discarded, and the filtrate was washed once with STC Buffer and centrifuged again at 4°C and 2700rpm for 10min, and the supernatant was discarded. The protoplasts were resuspended with 1mL STC Buffer. Take 160 μL of protoplast resuspension, 100 μL of tHMGR overexpression plasmid and 60 μL of precooled PEG solution in a 2 mL EP tube and mix them evenly. After ice bathing for 30 minutes, add precooled PEG solution to the 2 mL mark, mix evenly, place at room temperature for 25 minutes, mix evenly with 6 mL of CD soft agar medium (containing hygromycin with a final concentration of 100 mg / L), and pour on CD hard agar medium (containing hygromycin with a final concentration of 100 mg / L). Culture at 28°C for 5 to 6 days, pick a single colony to extract the genome, and perform PCR with primers 15 and 16 to confirm the insertion of the tHMGR expression frame. The strain constructed in this way is recorded as FF1.

[0038] (3) Plasmid recycling method

[0039] The strain FF1 was cultured in YPD liquid medium containing hygromycin at 28°C for 2 days to remove the pFC332 plasmid and then recycle the hygromycin resistance tag.

[0040] Table 1 Primer sequences

[0041] Primer 1 tgtttccgctgagggtttaatcacatacgaccaaaggtagtg Primer 2 ctgtcctttgatagatcggacatacaacagcggggattcg Primer 3 tccgatctatcaaaggacaggttttagagctagaaatagcaag Primer 4 taggccgagtgttgaatttcaaaaaaaagcaccgactcggt Primer 5 ccgagtcggtgcttttttttgaaattcaacactcggcctaa Primer 6 ccgccactgtatttaattaacatagttaaaagaaattttaggatc Primer 7 cttttaactatgttaattaaatacagtggcggtatgaaatg Primer 8 ctgtctcggctgaggtcttaaatatgcgtcgttttaggagtg Primer 9 atacaaaattcatcccaatacttaattaacttgtgtaagtattccagatcc Primer 10 tctggattttgcggaggcatgataatgttgtgatgtgttcgtt Primer 11 gccctaaggcgaagttgtaaacaatcaatccatttcgctatag Primer 12 gtctaccagtcccttctttatacccttttccttgattctcgc Primer 13 atcattcttgtcacgttaatatggccaagtccaacaaccg Primer 14 ataaatcgaatgtccgcttactatcgctttgacctctgaatag Primer 15 agggaatactatggagctgg Primer 16 cggaaagacgagagtgttac

[0042] Construction of β-oxidation pathway strains FF2-FF7

[0043] (1) Construction of overexpression vectors for FAA1, FAA2, PXA1, FOX1, FOX2, and POT1

[0044] First, sgRNA-Δfsr4-1 fragment was amplified by PCR using primers 17 and primer 18, with the sgRNA expression frame as a template. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, repeated for 32 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. In the same way, primers 19 and primer 20 were used to amplify the sgRNA-Δfsr4-2 fragment. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, repeated for 32 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The two purified DNA fragments were subjected to fusion PCR using primers 17 and 20. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. Primers 21 and 22 were used to amplify the upstream homologous fragment of the fsr4 gene using the genome of Fusariumfujikuroi CCTCC NO:M 2019378 as a template. The PCR reaction conditions were as follows: 98℃5min; 98℃30s, 60℃30s, 72℃30s, repeated 32 cycles; 72℃ continued for 5min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The downstream homologous fragment of the fsr4 gene was amplified using primers 23 and 24 in the same way. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, repeated for 32 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. The pFC332-Ffcas9 vector was used as a template and connected by a one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Novozyme) to construct a pFC332-Ffcas9-Δfsr4 plasmid vector capable of expressing the target gene fsr4.In the same way, primers 25 and 26, primers 27 and 28, primers 29 and 30, primers 31 and 32 were used to construct a pFC332-Ffcas9-Δfsr3 plasmid vector capable of expressing the target gene fsr3. Primers 33 and 34, primers 35 and 36, primers 37 and 38, primers 39 and 40 were used to construct a pFC332-Ffcas9-Δfsr1 plasmid vector capable of expressing the target gene fsr1. Primers 41 and 42, primers 43 and 44, primers 45 and 46, primers 47 and 48 were used to construct a pFC332-Ffcas9-Δfsr1 plasmid vector capable of expressing the target gene fsr1. Primer 48 was used to construct the pFC332-Ffcas9-Δfsr2 plasmid vector capable of expressing the targeted target gene fsr2, primer 49 and primer 50, primer 51 and primer 52, primer 53 and primer 54, primer 55 and primer 56 were used to construct the pFC332-Ffcas9-Δfsr5 plasmid vector capable of expressing the targeted target gene fsr5, and primer 57 and primer 58, primer 59 and primer 60, primer 61 and primer 62, primer 63 and primer 64 were used to construct the pFC332-Ffcas9-Δfsr6 plasmid vector capable of expressing the targeted target gene fsr6. The ligation product was transformed into E. coli DH5α recipient bacteria, spread on LB solid plates containing ampicillin resistance at a final concentration of 100 mg / L, cultured at 37°C for 12 h, picked up single colonies and transferred to LB liquid culture medium containing ampicillin resistance at a final concentration of 100 mg / L, cultured at 37°C for 12 h, collected the cells, extracted the plasmid, and linearized the plasmid using the rapid endonuclease PacⅠ. The des promoter fragment and the tef1 terminator were ligated to the plasmids pFC332-Ffcas9-Δfsr1, pFC332-Ffcas9-Δfsr2, pFC332-Ffcas9-Δfsr3, pFC332-Ffcas9-Δfsr4, pFC332-Ffcas9-Δfsr5, and pFC332-Ffcas9-Δfsr6 linearized by the rapid endonuclease PacⅠ using the one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Novogene) to construct an expression vector containing the gene expression cassette containing the des promoter fragment and the tef1 terminator fragment. The ligation product was transformed into the E. coli DH5α recipient bacteria, spread on an LB solid plate containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. Then, a single colony was picked and transferred to an LB liquid medium containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. The bacteria were collected to extract the plasmid and the plasmid was linearized using the rapid endonuclease PacⅠ.The POT1 sequence (its amino acid sequence is shown in SEQ ID NO.3) was amplified by PCR using primers 65 and 66, with the genome of Fusariumfujikuroi CCTCC NO:M 2019378 as a template. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 60 s, repeated for 32 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis and the fragment was purified. In the same way, the FOX2 sequence was amplified by primers 67 and 68, the FOX1 sequence was amplified by primers 69 and 70, the FAA1 sequence was amplified by primers 71 and 72, the FAA2 sequence was amplified by primers 73 and 74, and the PXA1 sequence was amplified by primers 75 and 76. Subsequently, POT1, FOX2, FOX1, FAA1, FAA2, and PXA1 were respectively ligated into plasmids pFC332-Ffcas9-Δfsr1-Pdes-Ttef1, plasmid pFC332-Ffcas9-Δfsr2-Pdes-Ttef1, plasmid pFC332-Ffcas9-Δfsr3-Pdes-Ttef1, plasmid pFC332-Ffcas9-Δfsr4-Pdes-Ttef1, plasmid pFC332-Ffcas9-Δfsr5-Pdes-Ttef1, and plasmid pFC332-Ffcas9-Δfsr6-Pdes-Ttef1 linearized by rapid endonuclease PacⅠ using the one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Novozymes). The ligation product was transformed into E. coli DH5α recipient bacteria, spread on an LB solid plate containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. A single colony was picked and transferred to an LB liquid medium containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h. The bacteria were collected and plasmids were extracted to obtain plasmids pFC332-Ffcas9-Δfsr1::Pdes-POT1, pFC332-Ffcas9-Δfsr2::Pdes-FOX2, pFC332-Ffcas9-Δfsr3::Pdes-FOX1, pFC332-Ffcas9-Δfsr4::Pdes-FAA1, pFC332-Ffcas9-Δfsr5::Pdes-FAA2, and pFC332-Ffcas9-Δfsr6::Pdes-PXA1, respectively.

[0045] (2) Protoplast transformation of Gibberella fujikura and identification of transformants

[0046] Plasmids pFC332-Ffcas9-Δfsr1::Pdes-POT1, pFC332-Ffcas9-Δfsr2::Pdes-FOX2, pFC332-Ffcas9-Δfsr3::Pdes-FOX1, pFC332-Ffcas9-Δfsr4::Pdes-FAA1, pFC332-Ffcas9-Δfsr5::Pdes-FAA2, and pFC332-Ffcas9-Δfsr6::Pdes-PXA1 were transformed into the protoplasts of Gibberella fujikura FF1. The transformed bacterial solution was cultured at 28°C for 5 to 6 days on CD plates containing hygromycin at a final concentration of 100 mg / L. Single colonies were picked to extract the genome, and PCR was performed with primers 77 and 78 to confirm the insertion of these expression cassettes. The confirmed strains were cultured in YPD liquid medium containing hygromycin at 28°C for 2 days to remove the pFC332-Ffcas9 plasmid, thereby constructing FF2, FF3, FF4, FF5, FF6, and FF7 strains.

[0047] Table 2 Primer sequences

[0048]

[0049]

[0050]

[0051] Construction of combined expression strains FF8 and FF9

[0052] The plasmid pFC332-Ffcas9-Δfsr1::Pdes-POT1 was transformed into the protoplasts of Fusarium fujikura FF5. The transformed bacterial solution was cultured on a CD plate containing hygromycin at a final concentration of 100 mg / L at 28°C for 5 to 6 days, and a single colony was picked to extract the genome. PCR was performed with primers 79 and 80 to confirm the insertion of the POT1 expression frame. The strain that passed this confirmation was cultured at 28°C in a YPD liquid medium containing hygromycin for 2 days to remove the pFC332-Ffcas9 plasmid, and the FF8 strain was constructed.

[0053] The plasmid pFC332-Ffcas9-Δfsr3::Pdes-FOX1 was transformed into the protoplasts of Fusarium fujikura FF8. The transformed bacterial solution was cultured on a CD plate containing hygromycin at a final concentration of 100 mg / L at 28°C for 5 to 6 days, and a single colony was picked to extract the genome. PCR was performed with primers 81 and 82 to confirm the insertion of the FOX1 expression frame. The strain that passed this confirmation was cultured at 28°C in a YPD liquid medium containing hygromycin for 2 days to remove the pFC332-Ffcas9 plasmid, and the FF9 strain was constructed.

[0054] Table 3 Primer sequences

[0055] Primer 79 gtcatagctgtttccgctga Primer 80 gcaagatagaccgcaagaaaat Primer 81 ttgagccttggtggcgacat Primer 82 tgagagataacggatggtgct

[0056] Example 2: Preparation of gibberellin GA by microbial fermentation using genetically engineered bacteria 4+7 Applications

[0057] The engineered strain and the initial strain constructed in Example 1 were respectively spread on PDA plates for activation, cultured at 28°C for 3 days, and inoculated into 25 mL of seed culture medium respectively. After cultured at 28°C and 250 rpm for 48 h, the seed liquid was inoculated into 40 mL of fermentation medium at a volume ratio of 10% (V / V), and cultured at 28°C and 250 rpm for 7 days.

[0058] Seed culture medium composition: corn starch 20g / L, sucrose 20g / L, peanut powder 20g / L, soybean powder 20g / L, potassium dihydrogen phosphate 1.0g / L, magnesium sulfate 1.0g / L, the solvent is tap water, pH is natural, and sterilized at 115℃ for 30min.

[0059] The fermentation medium composition: corn starch 80g / L, rice flour 80g / L, soybean flour 5g / L, peanut flour 5g / L, potassium sulfate 0.5g / L, potassium dihydrogen phosphate 0.5g / L, the solvent is tap water, pH is natural, and sterilized at 115°C for 30min.

[0060] After 168 h of shake flask fermentation of the engineered strain, 2 mL of fermentation broth was centrifuged at 12,000 rpm for 5 minutes in a centrifuge tube. The supernatant was diluted 50 times and filtered once with a 0.22 μm filter membrane for sample injection testing.

[0061] HPLC detection instrument: Agilent LC1260, using Welchrom C18 4.6*150mm*5um chromatographic column. Mobile phase: methanol: water: phosphoric acid = 68:32:0.05. Flow rate: 0.7mL / min. Detection wavelength: 210nm. Injection volume: 10μL. GA 4+7 Retention time: about 13 minutes.

[0062] Shake flask fermentation of GA with metabolically modified strains 4+7 The yield is shown in Table 4. It can be seen that the genetically engineered bacteria FF9 is effective in producing gibberellin GA. 4+7 The process improves the supply of precursor acetyl CoA. After 168h of fermentation, GA 4+7 The yield reached 2.66g / L, compared with the starting strain GA 4+7 Output increased by 443.33%.

[0063] Table 4 Fermentation results of different genotype engineering strains

[0064] strain genotype Yield (g / L) FF0 FusariumfujikuroiCCTCCNO:M2019378 0.6 FF1 FF0,ΔP450-3::tHMGR 1.49 FF2 FF1,Δfsr1::POT1 1.93 FF3 FF1,Δfsr2::FOX2 1.37 FF4 FF1,Δfsr3::FOX1 1.76 FF5 FF1,Δfsr4::FAA1 2.14 FF6 FF1,Δfsr5::FAA2 1.52 FF7 FF1,Δfsr6::PXA1 1.45 FF8 FF5,Δfsr1::POT1 2.37 FF9 FF8,Δfsr3::FOX1 2.66

[0065] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for producing gibberellin GA 4+7 A method for constructing a genetically engineered bacterium, characterized in that: include: Using CRISPR-Cas9 gene editing technology, the tHMGR gene was inserted and overexpressed at the P450-3 gene site in the genome of the chassis fungus Fusariumfujikuroi to enhance the expression of key genes in the β-oxidation pathway and construct a gene that produces gibberellin GA. 4+7 Genetically engineered bacteria; Wherein, the key gene of the β-oxidation pathway is selected from at least one of the POT1 gene, FOX1 gene, FOX2 gene, FAA1 gene, FAA2 gene and PXA1 gene.

2. The method according to claim 1, characterized in that The method for enhancing the expression of key genes in the β-oxidation pathway comprises: inserting one or more key genes in the β-oxidation pathway into the fsr gene locus; Wherein, the fsr gene is selected from at least one of the fsr1 gene, the fsr2 gene, the fsr3 gene, the fsr4 gene, the fsr5 gene and the fsr6 gene.

3. The method according to claim 1, characterized in that The tHMGR gene and the key gene of the β-oxidation pathway are constructed in a eukaryotic expression box with a promoter and a terminator; The promoter is selected from the endogenous promoter Pdes of Gibberella fujikura or the endogenous promoter Pggs2 of Gibberella fujikura, and the terminator is selected from the terminator Ttef1 derived from Aspergillus nidulans or the terminator TglaA derived from Aspergillus niger.

4. The method according to claim 1, characterized in that The chassis fungus is Fusariumfujikuroi CCTCCNO:M 2019378.

5. The method according to any one of claims 1 to 4, characterized in that: include: Using CRISPR-Cas9 gene editing technology, the tHMGR gene was inserted and overexpressed at the P450-3 gene locus, the POT1 gene was inserted at the fsr1 gene locus, the FOX1 gene was inserted at the fsr3 gene locus, and the FAA1 gene was inserted at the fsr4 gene locus in the genome of the chassis fungus Fusariumfujikuroi CCTCC NO:M 2019378 to construct a gene that produces gibberellin GA. 4+7 of genetically engineered bacteria.

6. The method according to claim 5, characterized in that The amino acid sequence of the FAA1 gene is shown in SEQ ID NO.1, the amino acid sequence of the FOX1 gene is shown in SEQ ID NO.2, and the amino acid sequence of the POT1 gene is shown in SEQ ID NO.

3.

7. The gibberellin GA produced by the method of any one of claims 1 to 6 4+7 of genetically engineered bacteria.

8. Production of gibberellin GA as claimed in claim 7 4+7 The genetically engineered bacteria is characterized in that Any of the following: (1) Fusariumfujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr1::POT1; (2) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr2::FOX2; (3) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr3::FOX1; (4) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1; (5) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr5::FAA2; (6) Fusarium fujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr6::PXA1; (7) Fusariumfujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1 / Δfsr1::POT1; (8) Fusariumfujikuroi CCTCC NO:M 2019378, ΔP450-3::tHMGR / Δfsr4::FAA1 / Δfsr1::POT1 / Δfsr3::FOX1.

9. Production of gibberellin GA as claimed in claim 8 4+7 Genetically engineered bacteria in microbial fermentation to produce gibberellin GA 4+7 Application in.

10. The use according to claim 9, characterized in that include: The production of gibberellin GA 4+7 The genetically engineered bacterial strain is inoculated into the fermentation medium and cultured at 25-35°C and 200-300rpm for 5-15 days; The fermentation medium comprises: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean flour, 10-30 g / L peanut flour, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, and the solvent is water.

Images