Induction method for obtaining transgenic avocado composite plant without tissue culture

Abstract

The invention discloses an induction method for obtaining a transgenic persea americana composite plant without tissue culture, and belongs to the technical field of persea americana biology. The induction method provided by the invention comprises the following steps: germinating avocado seeds by using quartz sand to obtain avocado seedlings, infecting rootless seedlings from the avocado seedlings by adopting a vacuum infiltration method, and inserting the rootless seedlings subjected to dip dyeing into a sterilized coco coir matrix for culturing to obtain the avocado composite plant. According to the method, an efficient avocado genetic transformation system mediated by agrobacterium rhizogenes is established, tissue culture is not needed, rootless seedlings are adopted as materials, the transformation efficiency is improved, meanwhile, consumption of experimental equipment, consumables and manpower is reduced, the problem that the avocado genetic transformation system is not established yet is solved, and the method is suitable for popularization and application. The technical effect of quickly, efficiently, simply and easily obtaining the transgenic material with low consumption is achieved, and a more convenient and efficient way is provided for genetic transformation of avocados.

Description

Technical Field

[0001] The invention relates to the technical field of avocado biological technology, and in particular to an induction method for obtaining a transgenic avocado composite plant without tissue culture. Background Art

[0002] Avocado (Persea americana L.) is a fruit tree with high nutrition and economic value. Due to the large market demand and high planting income of avocado, its industry has developed rapidly in Yunnan, Guangdong, Guangxi and other places, and the planting area has rapidly increased from 270,000 mu in 2015 to 345,000 mu. Avocado has high demand for fertilizer and water, and root diseases such as root rot and brown root disease are very harmful to it. Therefore, it is urgent to establish avocado germplasm with strong resistance and high nutrient absorption and utilization rate. At present, the mainstream idea of ​​establishing the genetic transformation system of avocado is to obtain transgenic plants through co-cultivation of Agrobacterium under tissue culture conditions. However, there has been no report on the successful acquisition of avocado tissue culture seedlings. The tissue culture-free genetic transformation system of avocado is not only the most important tool for the study of resistance-related gene functions, but also an important prerequisite for the molecular precision cultivation of resistant rootstocks, which is of great significance for the cultivation of highly resistant avocado germplasm. Agrobacterium rhizogenes can integrate foreign genes into the plant genome through the Ri plasmid, inducing the plant to produce hairy roots with stable genetic traits, thereby achieving genetic transformation of the target gene. Genetic transformation mediated by Agrobacterium rhizogenes has the advantages of short cycle, simple operation and wide application range, and has become a powerful tool for plant gene function verification and root biology research.

[0003] The system of genetic transformation of avocado mediated by Agrobacterium rhizogenes has not been reported. This is because obtaining transgenic plants through co-cultivation with Agrobacterium under tissue culture conditions requires strict control of various parameters of the growth environment during the transformation process. In addition, to ensure the success of tissue culture experiments, highly sophisticated laboratory equipment and precise experimental personnel are required. This transformation system has the following bottlenecks and defects, which make it extremely difficult to obtain transgenic materials:

[0004] (1) Long cycle and low conversion rate: Due to the high content of phenolic compounds and oxidases in avocado tissue, they have an inhibitory effect on Agrobacterium, resulting in a prolonged transformation cycle, increased risk of infection and necrosis, and a low conversion rate;

[0005] (2) The operation is complex and the experimental requirements are strict, which takes up a lot of human resources: Under tissue culture conditions, the process of obtaining transgenic plants through co-cultivation with Agrobacterium is very complex and requires strict control of various parameters of the growth environment during the transformation process, including oxygen content, hormone concentration, mineral nutrient concentration, pH value, etc. These operations require full-time technicians to perform regularly and require the operators to be skilled and operate in a standardized manner. This process takes up a lot of human resources;

[0006] (3) Long-term occupation of experimental equipment and consumables: In the process of culturing cells, some important instruments and equipment need to be occupied for a long time, such as incubators and clean benches. At the same time, a large number of consumables are also required to support the experiment, such as culture dishes, culture media, centrifuge tubes and pipette tips.

[0007] Therefore, it is of great significance to improve the above-mentioned defects of the existing avocado genetic transformation technology and successfully realize a technical solution for obtaining transgenic composite plants without relying on tissue culture. Summary of the invention

[0008] The purpose of the present invention is to provide an induction method for obtaining a transgenic avocado composite plant without tissue culture, so as to solve the problems existing in the above-mentioned prior art. The avocado efficient genetic transformation system induced by Agrobacterium rhizogenes established in the present invention can realize functional verification in the avocado itself.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] Technical solution 1: A method for inducing avocado composite plants with transgenic hairy roots without tissue culture, comprising the following steps: germinating avocado seeds with quartz sand to obtain avocado seedlings, infecting rootless seedlings from the avocado seedlings with a vacuum infiltration method, inserting the infected rootless seedlings into a sterilized coconut bran matrix for cultivation, and obtaining the avocado composite plants.

[0011] Furthermore, the quartz sand is sterilized.

[0012] Furthermore, the rootless seedlings are cut from avocado seedlings between 5 cm from the roots and 20 cm from the ground.

[0013] Furthermore, the infection solution used is obtained by activated culture of Agrobacterium rhizogenes MSU440.

[0014] Preferably, the activation of Agrobacterium rhizogenes MSU440 is to culture the Agrobacterium rhizogenes MSU440 strain carrying the GFP reporter gene on the surface of a solid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin) at 28° C. for 48 hours.

[0015] Furthermore, the preparation method of the impregnation solution includes: picking a single clone from the activated Agrobacterium rhizogenes MSU440 and transferring it to a liquid LB medium for cultivation, removing the supernatant and resuspending it in a MgCl2 solution until the bacterial solution OD is 600 The value is 1.0, 10 mmol / L of 2-morpholineethanesulfonic acid and 200 μmol / L of acetosyringone are added, and the mixture is allowed to stand in the dark for 3 hours to obtain the infection solution.

[0016] Preferably, it is allowed to stand at room temperature; preferably, the MgCl2 solution is 10 mmol / L.

[0017] Furthermore, the liquid LB culture medium contains 100 mg / L of kanamycin and 50 mg / L of streptomycin.

[0018] Furthermore, the vacuum infiltration method is to immerse the rootless seedlings in the infection solution and evacuate the solution for 20 minutes.

[0019] Preferably, soaking the rootless seedlings in the infection liquid is done by soaking the rootless seedlings in the infection liquid with the cut end facing downwards, and transferring the rootless seedlings and the infection liquid to a vacuum pump to evacuate for 20 minutes.

[0020] Furthermore, the culture is first cultured in the dark for 2 days and then transferred to normal culture under light.

[0021] Preferably, water is sprayed several times a day to keep the substrate moist, and after 2 days of dark culture, it is transferred to light culture to induce the generation of hairy roots to obtain transgenic composite plants; the coconut bran is sterilized at high temperature.

[0022] The present invention discloses the following technical effects:

[0023] The invention uses a 20 cm tall avocado seedling as experimental material, high temperature sterilized coconut bran as culture medium, uses a sterile blade to directly cut off the seedling root, and after vacuum infiltration infection for 20 minutes, uses the MSU440 strain carrying the GFP reporter gene to infect the seedling wound to induce the generation of hairy roots, and induces the avocado seedling to generate hairy roots under relatively open environmental conditions, omitting the complex process of tissue culture steps and strict experimental conditions in the Agrobacterium tumefaciens transformation system, and achieving the purpose of being able to obtain transgenic avocado materials. The invention uses rootless seedlings to avoid the interference of the original root system, and improves the occurrence rate and positive rate of hairy roots; vacuum infection is used to improve the occurrence rate and positive rate of hairy roots; and by using the GFP marker gene combined with PCR analysis, non-destructive, rapid, and high-throughput detection of positive hairy roots is achieved. The invention can obtain composite avocado plants containing hairy roots within 30-40 days, and the hairy root positive rate is 100%.

[0024] In summary, the present invention establishes an efficient genetic transformation system of avocado mediated by Agrobacterium rhizogenes in avocado, does not require tissue culture, uses rootless seedlings as materials, improves transformation efficiency, and also reduces the consumption of experimental equipment, consumables and manpower, solves the problem that the genetic transformation system of avocado has not yet been established, achieves the technical effect of obtaining transgenic materials quickly, efficiently, simply and with low consumption, and provides a more convenient and efficient way for genetic transformation of avocado. Moreover, the efficient genetic transformation system of avocado induced by Agrobacterium rhizogenes established in avocado can realize functional verification in avocado itself. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The specific process of inducing avocado composite plants;

[0027] Figure 2 This is the plasmid map of vector pCAMBIA1300;

[0028] Figure 3 This is the result of GFP fluorescence detection of positive hairy roots;

[0029] Figure 4 The results of positive hairy root PCR detection are shown in Figure 2, where lane M is Mark, lane 11 is the DNA template of the wild-type GFP root system, and lanes 1-10 are positive plants. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0036] A simple and efficient method for inducing avocado composite plants with transgenic hairy roots without tissue culture, comprising the following steps:

[0037] Step S1, avocado germination: transferring avocado seeds to sterilized quartz sand for germination;

[0038] Step S2, activation of Agrobacterium rhizogenes: Agrobacterium rhizogenes MSU440 strain carrying GFP reporter gene was cultured on the surface of solid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin) at 28° C. for 48 h;

[0039] Step S3, preparation of infection solution: pick a single clone of the activated Agrobacterium rhizogenes MSU440 strain and transfer it to liquid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin), and culture it at 28°C, 220 rpm for 48 h; centrifuge the cultured bacterial solution to remove the supernatant, and resuspend the cultured bacterial solution in sterile 10 mmol / L MgCl2 solution to an OD of 0. 600 The value is 1.0; add 10mmol / L 2-morpholineethanesulfonic acid and 200μmol / L acetosyringone to the bacterial solution and let it stand at room temperature away from light for 3 hours to obtain the infection solution.

[0040] Step S4, infection with Agrobacterium rhizogenes: select an avocado seedling with an above-ground height of 20 cm, cut it with a sterile blade at 5 cm from the root, soak the cut rootless seedling in the infection solution, and vacuum for 20 minutes;

[0041] Step S5, induction of composite plants containing transgenic hairy roots: insert the infected rootless avocado seedlings into a sterilized coconut bran culture medium, spray water several times a day to keep the medium moist, culture in the dark for 2 days and then transfer to light culture for 30-40 days to induce the formation of hairy roots and obtain transgenic composite plants.

[0042] Example 1 Induction of transgenic hairy roots in avocado

[0043] (1) Agrobacterium rhizogenes transformation

[0044] The Agrobacterium rhizogenes used in the present invention is the MSU440 strain (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and the GFP reporter gene vector is pCAMBIA1300 (plasmid map as shown in Figure 2 The pCAMBIA1300 vector was transformed into the competent state of MSU440 by freeze-thaw method. The MSU440 strain carrying the pCAMBIA1300 vector was streaked on a solid medium of LB+100 mg / L kanamycin+50 mg / L streptomycin. After the bacterial solution was dried, the plate was sealed and inverted in a 28°C constant temperature incubator for 48 hours.

[0045] (2) Preparation of Agrobacterium rhizogenes infection solution

[0046] Preparation of infection solution: Pick a single clone of the activated Agrobacterium rhizogenes MSU440 strain and transfer it to liquid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin), and culture it at 28°C, 220 rpm for 48 h; centrifuge the cultured bacterial solution at 6000 rpm for 5 min, remove the supernatant, resuspend it in sterile 10 mmol / L MgCl2 solution, and adjust the bacterial solution OD 600 The value is 1.0; add 10mmol / L 2-morpholineethanesulfonic acid and 200μmol / L acetosyringone to the bacterial solution and let it stand at room temperature away from light for 3 hours to obtain the infection solution.

[0047] (3) Preparation of Avocado Explants

[0048] The avocado seeds were transferred to sterilized quartz sand for germination. After germination, healthy avocado seedlings with an aboveground height of 20 cm were selected, and the aboveground part of the avocado was cut off 5 cm from the substrate using a sterile blade to obtain the avocado rootless seedlings.

[0049] (4) Infection with Agrobacterium rhizogenes

[0050] The rootless avocado seedlings were soaked in the infection solution with the cut side facing downwards, and the rootless avocado seedlings and the infection solution were transferred to a vacuum pump to evacuate for 20 minutes; after the infection, the rootless avocado seedlings were quickly inserted into the sterilized and moistened coconut bran substrate, and after culturing in the dark for 2 days, they were transferred to the light and covered with a sunshade net. Water was sprayed several times a day to keep the substrate moist, and the hairy root induction was checked after culturing for 30-40 days. Plants with hairy roots were transgenic composite avocado plants.

[0051] Example 2 Identification of transgenic hairy roots

[0052] (1) GFP fluorescence identification

[0053] The transgenic composite avocado plants were carefully removed from the substrate, the hairy roots were washed with sterile water, and then moved to a dark room. The GFP fluorescence signal was observed and photographed using a handheld GFP fluorescence detector or a fluorescent stereo microscope.

[0054] (2) PCR detection of GFP gene

[0055] The CTAB method was used to extract DNA from hairy roots, as follows: half of a single hairy root cut with a sterile blade was placed in a mortar, and after being fully ground with liquid nitrogen, 1 mL of CTAB extraction solution (12.114 g L-1 Tris, 7.44 g L-1 EDTA-Na2, 81.9 g L-1 NaCl, 20 g L-1 CTAB, 10 g L-1 PVP-40) was added and transferred to a centrifuge tube, and heated in a 65°C water bath for 1 h (mixed up and down once every 15 min). Centrifuge at 11200rpm for 10min, transfer the supernatant to a new centrifuge tube, add an equal volume of chloroform:isoamyl alcohol mixture (24:1), mix thoroughly and let stand for 5min, centrifuge at 11200rpm for 10min, aspirate the supernatant into a new 1.5mL centrifuge tube, add 2 / 3 volume ratio of pre-cooled isopropanol, mix and let stand at 4℃ for 30min, centrifuge at 12000rpm for 5min, discard the supernatant, wash DNA twice with 70% ethanol, air-dry on a clean bench, add 10μL ddH2O to dissolve DNA and measure the concentration.

[0056] PCR identification was performed using GFP-specific gene primers F and R. Primer F: CGGGGTGGTGCCCATCCTGGTCGA (SEQ ID NO.1); Primer R: TGGTCGGCGAGCTGCACGCTGCCG (SEQ ID NO.2). The PCR program was set as: 95°C for 3 min, 35 repeated cycles (specifically including: 95°C for 15 seconds, 56°C for 15 seconds, 72°C for 1 min), 72°C for 10 min. The hairy roots that could amplify a GFP gene band of about 500 bp were positive.

[0057] The experimental results show that the rootless avocado seedlings infected by the present invention began to form hairy roots ( Figure 1 The Agrobacterium rhizogenes MSU440 strain used in the present invention has been transformed into the pCAMBIA1300 vector containing the GFP reporter gene ( Figure 2 ), the induced hairy roots can be quickly and non-destructively identified by GFP fluorescence identification and GFP gene PCR detection. By observing with a handheld GFP fluorescence detector or a fluorescent stereo microscope, it can be clearly observed that the GFP tag protein is stably expressed in all hairy roots ( Figure 3). The DNA of wild-type avocado roots and fluorescent avocado hairy root materials obtained by the genetic transformation system of the present invention were extracted by conventional methods, and PCR amplification was performed using the GFP gene primers of the present invention. Figure 4 It can be obtained that: the wild-type GFP root DNA as a template cannot expand a specific band, and the fluorescent avocado hairy root obtained by the genetic transformation system of the present invention can amplify a specific band of about 500 bp, and the positive rate is 100% ( Figure 4 ).

[0058] The technical path of transforming avocado rootless seedling materials using Agrobacterium MSU440 under tissue culture-free conditions to obtain transgenic composite plants is feasible, simple and efficient. According to statistics, the positive rate of hairy roots obtained by the genetic transformation system established by the present invention is 100%. The present invention establishes a genetic transformation system without tissue culture, using avocado rootless seedlings germinated in sand culture as materials, using the MSU440 root-generating Agrobacterium strain carrying the GFP reporter gene to induce wounds to generate hairy roots through vacuum infiltration infection, obtaining transgenic composite avocado plants, and quickly and non-destructively identifying positive hairy roots through GFP fluorescence detection and PCR detection, successfully establishing a rapid, efficient, simple and non-destructive genetic transformation system for obtaining avocado transgenic materials.

[0059] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for inducing avocado composite plants with transgenic hairy roots without tissue culture, characterized in that: The following steps are involved: Avocado seeds are germinated with quartz sand to obtain avocado seedlings, rootless seedlings of the avocado seedlings are infected by vacuum infiltration, and the rootless seedlings after infection are inserted into sterilized coconut bran substrate for cultivation to obtain the avocado composite plant.

2. The induction method according to claim 1, characterized in that: The quartz sand is sterilized.

3. The induction method according to claim 1, characterized in that: The rootless seedlings are cut from avocado seedlings in the range of 5 cm from the root to 20 cm from the ground.

4. The induction method according to claim 1, characterized in that: The infection solution used in the infection is obtained by activated culture of Agrobacterium rhizogenes MSU440.

5. The induction method according to claim 4, characterized in that: The preparation method of the impregnation solution comprises: picking a single clone from the activated Agrobacterium rhizogenes MSU440 and transferring it to a liquid LB medium for cultivation; removing the supernatant and resuspending it in a MgCl2 solution until the bacterial solution OD is 600 The value is 1.0, 10 mmol / L of 2-morpholineethanesulfonic acid and 200 μmol / L of acetosyringone are added, and the mixture is allowed to stand in the dark for 3 hours to obtain the infection solution.

6. The induction method according to claim 5, characterized in that: The liquid LB culture medium contains 100 mg / L of kanamycin and 50 mg / L of streptomycin.

7. The induction method according to claim 1, characterized in that: The vacuum infiltration method is to immerse the rootless seedlings in the infection solution and evacuate the solution for 20 minutes.

8. The induction method according to claim 1, characterized in that: The culture is first cultured in the dark for 2 days and then transferred to normal culture under light.

Images